915 Pages • 466,702 Words • PDF • 108.9 MB
+ edition+ Ninth+ Fundamentals
Uploaded at 2021-09-26 09:17
Report DMCA
PREVIEW PDF
Pronouncing Organism Names Some of the scientific names for microorganisms, which have Latin or Greek roots, can be hard to pronounce. As an aid in pronouncing these names, the primary microorganisms used in this textbook are listed alphabetically below, followed by the pronunciation. The following pronunciation key will aid you in saying these names. The accented syllable (') is placed directly after the syllable being stressed. Pronunciation Key a add –a ace
ch check
g go
ã care
e end –e even
i it –ı ice
ä father
e˙ term
ng ring
Acanthamoeba castellani a-kan-thä-me–'bä kas-tel-än'e– Acetobacter aceti a-se–'to–-bak-te˙r a-set'e– –-bak-te˙r Acinetobacter baumannii a-si-ne'to bou-mä'ne–-e– Actinobacillus muris –-bä'cil-lus mu –'ris ak-tin-o –r'us Agaricus bisporis ä-gãr'i-kus bı–-spo Agrobacterium tumefaciens ag'ro–-bak-ti're–-urn tü'me-fa–sh-enz –-mı–'se–s Ajellomyces dermatitidis ä-jel-lo de˙r-mä-tit'i-dis Alcaligenes viscolactis al'kä-li-gen-e–s vis-co-lak'tis Amanita muscaria am-an-ı–'tä mus-kãr'e-ä A. phalloides fal-loi'dez Amoeba proteus ä-me–'bä pro–'te–-us –Anaplasma phagocytophilum an'ä-plaz-mä fäg'-o-sı–-to fil-um –'sto–-mä du –-o–-de'näl-e– Ancylostoma duodenale an-sil-o – Aquifex ä'kwe -feks Armillaria är-mil-lãr'e–-ä Arthrobacter är-thro–-bak'te˙r Arthroderma är-thro–-de˙r'mä Ascaris lumbricoides as'kar-is lum-bri-koi'de–z Aspergillus favus a-spe˙r-jil'lus fla–'vus A. fumigatus fü-mi-gä'tus A. niger nı–'je˙r A. oryzae ô'ri-zı– A. parasiticus pãr-ä-si-ti-kus Azotobacter ä-zo'to-bak-te˙r Babesia bigemina ba-be–'se–-ä big-em-e–'na B. microti mı–-kro–'te– Bacillus amyloliquefaciens bä-sil'lus –-li-kwä-fäs'e–-enz am-i-lo B. anthracis an-thra–'sis
62582_CH30_CVRS_p002-005.pdf 2
o odd – open o
ou out
u put
sh rush
ô order
th thin
ü rule – use u
oi oil
u up
B. cereus se're–-us B. sphaericus sfe'ri-kus B. subtilis su'til-us B. thuringiensis thur-in-je–-en'sis Bacteroides fragilis bak-te˙-roi'de–z fra'gil-is B. thetaiotaomicron tha–-tä-ı–-o–-täw-mi'kron Bartonella henselae bär-to–-nel'lä hen'sel-ı– Beggiatoa bej'je–-ä-to–-ä Blastomyces dermatitidis blas-to–-mı–'se–z de˙r-mä-tit'i-dis Bordetella bronchiseptica bor-de-tel'lä bron-ke–-sep'ti-kä B. parapertussis pãr'ä-pe˙r-tus-sis B. pertussis pe˙r-tus'sis Borrelia burgdorferi bôr-rel'e–-ä burg-dôr'fe˙r-e– B. hermsii he˙rm-se–'-e– B. recurrentis re–-cür-ren'tis B. turicatae te˙r-i-kät'-ı– Botrytis cinerea bo-trı–'tis cin-e˙r-e–'ä Brevibacterium bre-vi-bak-ti're–-um Brucella abortus brü’sel-lä ä-bôr'tus B. canis can'is B. melitensis me-li-ten'sis B. suis sü'is Brugia malayi brü'-ge–-ä mä-la–'e– –ld-e˙r-e–-ä se-pa–'se–-ä Burkholderia cepacia berk'ho –-bak-te˙r ko–'lı– (or ko–'le–) Campylobacter coli kam'pi-lo – – – C. jejuni je -ju'ne Candida albicans kan'did-ä al'bi-kanz –-lo–-bak'te˙r kre-sen'tus Caulobacter crescentus ko Cellulomonas sel-u-lo-mo–'näs Cephalosporium acremonium sef-ä-lo–-spô're–-um ac-re-mo–'ne–-um Chlamydia trachomatis kla-mi'de–-a trä-ko–'mä-tis
2/4/10 3:16 PM
Pronouncing Organism Names (continued) –-mo –'näs Chlamydomonas klam-i-do –'ne–-ı– Chlamydophila pneumoniae kla-mi'dof-i-la nü-mo – C. psittaci sit'a-se –-bak'-te˙r Chromobacter violaceum kro–-mo – – – – vı -o-la 'se -um Claviceps purpurea kla'vi-seps pür-pü-re–'ä Clostridium acetobutylicum klôs-tri’de–-um –a -se–-to––-til'i-kum bu –-lı–'num C. botulinum bot-u C. difficile dif'fi-sil-e– C. perfringens pe˙r-frin'jens C. tetani te'tän-e– Coccidioides immitis kok-sid-e–-oi'de–z im'mi-tis –-sä-da'se–-e– C. posadasii po Corynebacterium diphtheriae kôr'e–-ne–-bak-ti-re–-um dif-thi're–-ı– Coxiella burnetii käks'e–-el-lä be˙r-ne'te–-e– –-kok-kus Cryptococcus neoformans krip'to – – ne -o-fôr'manz –-spô-ri-de–-um Cryptosporidium coccidi krip'to – kok'sid-e C. hominis ho–'mi-nis C. parvum pär'vum Cyclospora cayetanensis sı–'klo–-spô-rä kı–'e–-tan-en-sis Deinococcus radiodurans dı–'no–-kok-kus ra–-de–-o–dür'anz –-vib-re–-o – Desulfovibrio de–'sul-fo – – –-näs Desulfuromonas de 'sul-für-o-mo –-kok'kus Echinococcus granulosus –e -kı–n-o –-1o –'sis gra-nu Ehrlichia chaffeensis e˙r'lik-e–-ä chäf-fen'sis –-cı–-to'fı–-lä E. phagocytophila fa–-go Emmonsiella capsulata em'mon-se–-el-lä cap-sül-ä'tä –-li'ti-kä Entamoeba histolytica en-tä-me–'bä his-to – Enterobacter aerogenes en-te-ro-bak'te˙r ã-rä'jen-e–z E. cloacae klo–-a–'ki –'be–-us ver-mi-ku –-lar'is Enterobius vermicularis en-te-ro –-kok'kus fe–-ka–'lis Enterococcus faecalis en-te˙-ro – – E. faecium fe 'se -um –-fı–'ton Epidermophyton ep-e–-der-mo Erysipelothrix rhusiopathiae –a r-e–-sip'e-lo–-thriks rü'sı–-o–-pa-the– –’le–) Escherichia coli esh-e˙r-e–'ke–-ä ko–'lı– (or ko –-gle–'nä Euglena u
Filobasidiella neoformans fı–-lo-ba-si-de–-el'lä ne–-o-fôr'mäns Francisella tularensis fran'sis-el-lä tü'lä-ren-sis –-so–-bak-ti're–-um Fusobacterium fu Gambierdiscus toxicus gam'be–-e˙r-dis-kus toks'i-kus Gardnerella intestinalis gärd-ne˙-rel'lä in-tes-ti-nal'is G. vagin*lis va-jin-al'is Geobacillus stearothermophilus je–-o–-bä-sil'lus ste-är-o–-the˙r-mä'fil-us Giardia lamblia je–-är'de–-ä lam'le–-ä –-bak-te˙r Gluconobacter glü'kon-o Gonyaulax catanella gon-e–-o–'laks kat-ä-nel'lä –-din'e–-um Gymnodinium jim-no Haemophilus ducrcyi he–-mä'fil-us dü-krä'e– H. influenzae in-flü-en'zı– –-bak-ti're–-um Halobacterium salinarum ha-lo sal-i-när'um Hartmannella vermiformis hart-mä-nel'lä vêr-mi-fôr'mis –-bak-te˙r pı–'lo–-re– Helicobacter pylori he–'lik-o –-plaz'mä kap-su-lä'tum Histoplasma capsulatum his-to Klebsiella pneumoniae kleb-se–-el'lä nü-mo–'ne-ı– Lactobacillus acidophilus lak-to–-bä-sil'lus a-sid-o'fil-us L. bulgaricus bul-gã'ri-kus L. caseii ka–'se–-e– L. plantarum plan-tär'um L. sanfranciscensis san-fran-si-sen'-sis –-kok'kus lak'tis Lactococcus lactis lak-to Lagenidium giganteum la-je-ni'de–-um jı–-gan'te–-üm Legionella pneumophila le–-jä-nel'lä nü-mo–'fi-lä Leishmania donovani lish'mä-ne–-ä don'o–-vän-e– L. tropica trop'i-kä –-ganz Leptospira interrogans lep-to–-spı–'rä in-te˙r'ro – – Leuconostoc citrovorum lü-ku-nos'tok sit-ro-vôr'um L. mesenteroides mes-en-ter-oi'de–z Listeria monocytogenes lis-te're–-ä mo-no–-sı–-tô'je-ne–z Methanobacterium meth-a-no–-bak-te˙r'e–-um Methanococcus jannaschii meth-a-no–-kok'kus jan-nä'she–-e– –'te–-us Micrococcus luteus mı–-kro–-kok'kus lu – – – – Micromonospora mı -kro-mo-nos'por-ä
(continued on inside back cover)
62582_CH30_CVRS_p002-005.pdf 3
2/4/10 3:16 PM
Alcamo’s FUNDAMENTALS OF
Microbiology
62582_FMXX_i_xxx.pdf i
2/10/10 10:37 AM
Jones and Bartlett Titles in Biological Science AIDS: Science and Society, Fifth Edition
Laboratory and Field Investigations in Marine Life, Ninth Edition
Hung Fan, Ross F. Conner, & Luis P. Villarreal
James L. Sumich & Gordon Dudley
AIDS: The Biological Basis, Fifth Edition
Laboratory Fundamentals of Microbiology, Eighth Edition
Benjamin S. Weeks & I. Edward Alcamo
Jeffrey C. Pommerville
Alcamo’s Fundamentals of Microbiology: Body Systems Edition
Laboratory Investigations in Molecular Biology
Jeffrey C. Pommerville
Steven A. Williams, Barton E. Slatko, & John R. McCarrey
Aquatic Entomology
Laboratory Textbook of Anatomy and Physiology: Cat Version, Ninth Edition
W. Patrick McCafferty & Arwin V. Provonsha
Anne B. Donnersberger
Bioethics: An Introduction to the History, Methods, and Practice, Second Edition
Lewin’s CELLS, Second Edition
Nancy S. Jecker, Albert R. Jonsen, & Robert A. Pearlman
Lynne Cassimeris, Vishwanath R. Lingappa, & George Plopper
Bioimaging: Current Concepts in Light and Electron Microscopy
Lewin’s Essential GENES, Second Edition
Douglas E. Chandler & Robert W. Roberson
Jocelyn E. Krebs, Elliott S. Goldstein, & Stephen T. Kilpatrick
Biomedical Graduate School: A Planning Guide to the Admissions Process
Lewin’s GENES X
David J. McKean & Ted R. Johnson
Jocelyn E. Krebs, Elliott S. Goldstein, & Stephen T. Kilpatrick
Biomedical Informatics: A Data User’s Guide
Microbes and Society, Second Edition
Jules J. Berman
Benjamin S. Weeks & I. Edward Alcamo
Botany: An Introduction to Plant Biology, Fourth Edition
The Microbial Challenge: Science, Disease, and Public Health, Second Edition
James D. Mauseth
Robert I. Krasner
Case Studies for Understanding the Human Body
Microbial Genetics, Second Edition
Stanton Braude, Deena Goran, & Shelley Maxfield
Stanley R. Maloy, John E. Cronan, Jr., & David Freifelder
Clinical Information Systems: Overcoming Adverse Consequences
Microbiology Pearls of Wisdom, Second Edition
Dean F. Sittig & Joan S. Ash
S. James Booth
Defending Evolution: A Guide to the Evolution/Creation Controversy
Molecular Biology: Genes to Proteins, Third Edition
Brian J. Alters
Burton E. Tropp
The Ecology of Agroecosystems
Neoplasms: Principles of Development and Diversity
John H. Vandermeer
Jules J. Berman
Electron Microscopy, Second Edition
Perl Programming for Medicine and Biology
John J. Bozzola & Lonnie D. Russell
Jules J. Berman
Encounters in Microbiology, Volume 1, Second Edition
Plant Cell Biology
Jeffrey C. Pommerville
Brian E. S. Gunning & Martin W. Steer
Encounters in Microbiology, Volume 2
Plants, Genes, and Crop Biotechnology, Second Edition
Jeffrey C. Pommerville
Maarten J. Chrispeels & David E. Sadava
Equilibria and Kinetics of Biological Macromolecules
Plant Structure: A Color Guide, Second Edition
Jan Hermans & Barry R. Lentz
Bryan G. Bowes & James D. Mauseth
Essential Genetics: A Genomics Perspective, Fifth Edition
Precancer: The Beginning and the End of Cancer
Daniel L. Hartl
Jules J. Berman
Essentials of Molecular Biology, Fourth Edition
Principles of Modern Microbiology
George M. Malacinski
Mark Wheelis
Evolution: Principles and Processes
Protein Microarrays
Brian K. Hall
Mark Schena, ed.
Exploring Bioinformatics: A Project-Based Approach
Python for Bioinformatics
Caroline St. Clair & Jonathan E. Visick
Jason Kinser
Exploring the Way Life Works: The Science of Biology
R for Medicine and Biology
Mahlon Hoagland, Bert Dodson, & Judy Hauck
Paul D. Lewis
Genetics: Analysis of Genes and Genomes, Seventh Edition
Ruby Programming for Medicine and Biology
Daniel L. Hartl & Elizabeth W. Jones (late)
Jules J. Berman
Genetics of Populations, Fourth Edition
Strickberger’s Evolution, Fourth Edition
Philip W. Hedrick
Brian K. Hall & Benedikt Hallgrímsson
Guide to Infectious Diseases by Body System
Symbolic Systems Biology: Theory and Methods
Jeffrey C. Pommerville
M. Sriram Iyengar
Human Biology, Sixth Edition
Tropical Forests
Daniel D. Chiras
Bernard A. Marcus
Human Biology Laboratory Manual
20th Century Microbe Hunters
Charles Welsh
Robert I. Krasner
Introduction to the Biology of Marine Life, Ninth Edition
Understanding Viruses
John F. Morrissey & James L. Sumich
Teri Shors
62582_FMXX_i_xxx.pdf ii
2/10/10 12:26 PM
62582_FMXX_i_xxx.pdf iii
2/10/10 10:37 AM
World Headquarters Jones and Bartlett Publishers 40 Tall Pine Drive Sudbury, MA 01776 978-443-5000 [emailprotected] www.jbpub.com
Jones and Bartlett Publishers Canada 6339 Ormindale Way Mississauga, Ontario L5V 1J2 Canada
Jones and Bartlett Publishers International Barb House, Barb Mews London W6 7PA United Kingdom
Jones and Bartlett’s books and products are available through most bookstores and online booksellers. To contact Jones and Bartlett Publishers directly, call 800-832-0034, fax 978-443-8000, or visit our website www.jbpub.com. Substantial discounts on bulk quantities of Jones and Bartlett’s publications are available to corporations, professional associations, and other qualified organizations. For details and specific discount information, contact the special sales department at Jones and Bartlett via the above contact information or send an email to [emailprotected]. Copyright © 2011 by Jones and Bartlett Publishers, LLC All rights reserved. No part of the material protected by this copyright may be reproduced or utilized in any form, electronic or mechanical, including photocopying, recording, or by any information storage and retrieval system, without written permission from the copyright owner. Production Credits Chief Executive Officer: Clayton Jones Chief Operating Officer: Don W. Jones, Jr. President, Higher Education and Professional Publishing: Robert W. Holland, Jr. V.P., Sales: William J. Kane V.P., Design and Production: Anne Spencer V.P., Manufacturing and Inventory Control: Therese Connell Publisher, Higher Education: Cathleen Sether Acquisitions Editor: Molly Steinbach Senior Editorial Assistant: Jessica Acox
Editorial Assistant: Caroline Perry Associate Production Editor: Leah Corrigan Senior Marketing Manager: Andrea DeFronzo Composition: Shepherd, Inc. Cover Design: Scott Moden Senior Photo Researcher and Photographer: Christine Myaskovsky Cover Image: © Eye of Science/Photo Researchers, Inc. Printing and Binding: Courier Kendallville Cover Printing: Courier Kendallville
About the cover: A false-color transmission electron microscope image of the bacterium Escherichia coli. These rod-shaped cells are a common inhabitant in the human large intestine where they use the short whisker-like appendages to attach to the intestinal lining.
Library of Congress Cataloging-in-Publication Data Pommerville, Jeffrey C. Alcamo’s fundamentals of microbiology / Jeffrey C. Pommerville. — 9th ed. p. ; cm. Other title: Fundamentals of microbiology Includes bibliographical references and index. ISBN 978-0-7637-6258-2 (alk. paper) 1. Microbiology. 2. Medical microbiology. I. Alcamo, I. Edward. II. Title. III. Title: Fundamentals of microbiology. [DNLM: 1. Microbiology. QW 4 P787a 2011] QR41.2.A43 2011 616.9’041—dc22 6048 2010002117 Printed in the United States of America 14 13 12 11 10 10 9 8 7 6 5 4 3 2 1
62582_FMXX_i_xxx.pdf iv
2/10/10 10:37 AM
Brief Contents PART 1 FOUNDATIONS OF MICROBIOLOGY Chapter 1 Now 3
1
Microbiology: Then and
PART 4 VIRUSES AND EUKARYOTIC MICROORGANISMS 438 Chapter 14 The Viruses and Virus-Like Agents 440
Chapter 2 The Chemical Building Blocks of Life 35
Chapter 15 Viral Infections of the Respiratory Tract and Skin 474
Chapter 3 Concepts and Tools for Studying Microorganisms 64
Chapter 16 Viral Infections of the Blood, Lymphatic, Gastrointestinal, and Nervous Systems 508
Chapter 4 Cell Structure and Function in the Bacteria and Archaea 97 Chapter 5 Microbial Growth and Nutrition 131
Chapter 18 Eukaryotic Microorganisms: The Parasites 567
Chapter 6 Metabolism of Microorganisms 158 Chapter 7 Control of Microorganisms: Physical and Chemical Methods 189
PART 2 THE GENETICS OF MICROORGANISMS Chapter 8
222
Microbial Genetics 224
Chapter 9 Gene Transfer, Genetic Engineering, and Genomics 260
PART 3 BACTERIAL DISEASES OF HUMANS
Chapter 17 Eukaryotic Microorganisms: The Fungi 535
298
Chapter 10 Airborne Bacterial Diseases 300 Chapter 11 Foodborne and Waterborne Bacterial Diseases 334 Chapter 12 Soilborne and Arthropodborne Bacterial Diseases 371 Chapter 13 Sexually Transmitted and Contact Transmitted Bacterial Diseases 396
PART 5 DISEASE AND RESISTANCE
607
Chapter 19 Infection and Disease 609 Chapter 20 Resistance and the Immune System: Innate Immunity 646 Chapter 21 Resistance and the Immune System: Acquired Immunity 669 Chapter 22 Immunity and Serology 698 Chapter 23 Immune Disorders and AIDS 729 Chapter 24 Antimicrobial Drugs 767 Appendix A Metric Measurement A-1 Appendix B Temperature Conversion Chart A-1 Glossary Index
G-1
I-1
Photograph Acknowledgments
P-1
v
62582_FMXX_i_xxx.pdf v
2/17/10 2:17 PM
Contents Preface Acknowledgments About the Author To the Student—Study Smart A Tribute to I. Edward Alcamo
PART 1 FOUNDATIONS OF MICROBIOLOGY Chapter 1 Now 3
xvii xxi xxii xxiv xxx
1
Microbiology: Then and
1.1 The Beginnings of Microbiology 6 Microscopy—Discovery of the Very Small 6 Experimentation—Can Life Generate Itself Spontaneously? 8 1.2 Microorganisms and Disease Transmission 9 Epidemiology—Understanding Disease Transmission 9 Variolation and Vaccination—Prevention of Infectious Disease 14 The Stage Is Set 15 1.3 The Classical Golden Age of Microbiology (1854–1914) 15 Louis Pasteur Proposes That Germs Cause Infectious Disease 15 Pasteur’s Work Stimulates Disease Control and Reinforces Disease Causation 16 Robert Koch Formalizes Standards to Identify Germs with Infectious Disease 17 Koch Develops Pure Culture Techniques 18
Competition Fuels the Study of Infectious Disease 18 Other Global Pioneers Contribute to New Disciplines in Microbiology 20 1.4 Studying Microorganisms 22 The Spectrum of Microorganisms and Viruses Is Diverse 22 1.5 The Second Golden Age of Microbiology (1943–1970) 25 Molecular Biology Relies on Microorganisms 25 Two Types of Cellular Organization Are Realized 25 Antibiotics Are Used to Cure Infectious Disease 26 1.6 The Third Golden Age of Microbiology—Now 28 Microbiology Continues to Face Many Challenges 28 Microbial Ecology and Evolution Are Helping to Drive the New Golden Age 30 Chapter Review 31
Chapter 2 The Chemical Building Blocks of Life 35 2.1 The Elements of Life 37 Matter Is Composed of Atoms 37 Atoms Can Vary in the Number of Neutrons or Electrons 38 Electron Placement Determines Chemical Reactivity 38 2.2 Chemical Bonding 39 Ionic Bonds Form between Oppositely Charged Ions 40 Covalent Bonds Share Electrons 40 Hydrogen Bonds Form between Polar Groups or Molecules 42 Chemical Reactions Change Bonding Partners 43 2.3 Water, pH, and Buffers 44 Water Has Several Unique Properties 44 Acids and Bases Affect a Solution’s pH 44 Cell Chemistry Is Sensitive to pH Changes 46
vi
62582_FMXX_i_xxx.pdf vi
2/10/10 10:37 AM
Contents
2.4 Major Organic Compounds of Living Organisms 47 Functional Groups Define Molecular Behavior 47 Carbohydrates Consist of Sugars and Sugar Polymers 48 Lipids Are Water-Insoluble Compounds 48 Nucleic Acids Are Large, InformationContaining Polymers 50 Proteins Are the Workhorse Polymers in Cells 54 Chapter Review 60
Chapter 3 Concepts and Tools for Studying Microorganisms 64 3.1 The Bacteria/Eukaryote Paradigm 66 Bacterial Complexity: Homeostasis and Biofilm Development 66 Bacteria and Eukaryotes: The Similarities in Organizational Patterns 70 Bacteria and Eukaryotes: The Structural Distinctions 71
62582_FMXX_i_xxx.pdf vii
vii
3.2 Classifying Microorganisms 73 Classification Attempts to Catalog Organisms 73 Kingdoms and Domains: Trying to Make Sense of Taxonomic Relationships 73 Nomenclature Gives Scientific Names to Organisms 78 Classification Uses a Hierarchical System 78 Many Methods Are Available to Identify and Classify Microorganisms 79 3.3 Microscopy 83 Many Microbial Agents Are In the Micrometer Size Range 83 Light Microscopy Is Used to Observe Most Microorganisms 84 Staining Techniques Provide Contrast 84 Light Microscopy Has Other Optical Configurations 89 Electron Microscopy Provides Detailed Images of Cells, Cell Parts, and Viruses 91 Chapter Review 93
2/10/10 10:38 AM
viii
Contents
Other Subcompartments Exist in the Cell Cytoplasm 121 Many Bacterial/Archaeal Cells Have a “Cytoskeleton” 122 4.7 The Bacteria/Eukaryote Paradigm—Revisited 124 What Is a Prokaryote? 124 Chapter Review 127
Chapter 5 Microbial Growth and Nutrition 131 5.1 Microbial Reproduction 133 Most Bacteria Reproduce by Binary Fission 133 Bacterial and Archaeal Cells Reproduce Asexually 134
Chapter 4 Cell Structure and Function in the Bacteria and Archaea 97 4.1 Diversity among the Bacteria and Archaea 98 The Domain Bacteria Contains Some of the Most Studied Microbial Organisms 99 The Domain Archaea Contains Many Extremophiles 102 4.2 Cell Shapes and Arrangements 104 Variations in Cell Shape and Cell Arrangement Exist 104 4.3 An Overview to Bacterial and Archaeal Cell Structure 106 Cell Structure Organizes Cell Function 106 4.4 External Cell Structures 108 Pili Are Protein Fibers Extending from the Cell Surface 108 Flagella Are Long Appendages Extending from the Cell Surface 108 The Glycocalyx Is an Outer Layer External to the Cell Wall 110 4.5 The Cell Envelope 113 The Bacterial Cell Wall Is a Tough and Protective External Shell 113 The Archaeal Cell Wall Also Provides Mechanical Strength 117 The Cell Membrane Represents the Interface between the Cell Environment and the Cell Cytoplasm 117 The Archaeal Cell Membrane Differs from Bacterial and Eukaryal Membranes 119 4.6 The Cell Cytoplasm and Internal Structures 120 The Nucleoid Represents a Subcompartment Containing the Chromosome 120 Plasmids Are Found in Many Bacterial and Archaeal Cells 120
62582_FMXX_i_xxx.pdf viii
5.2 Microbial Growth 136 A Bacterial Growth Curve Illustrates the Dynamics of Growth 136 Endospores Are a Response to Nutrient Limitation 137 Optimal Microbial Growth Is Dependent on Several Physical Factors 141 5.3 Culture Media and Growth Measurements 146 Culture Media Are of Two Basic Types 146 Culture Media Can Be Devised to Select for or Differentiate between Microbial Species 148 Population Measurements Are Made Using Pure Cultures 152 Population Growth Can Be Measured in Several Ways 153 Chapter Review 155
Chapter 6 Metabolism of Microorganisms 158 6.1 Enzymes and Energy in Metabolism 159 Enzymes Catalyze All Chemical Reactions in Cells 160 Enzymes Act through Enzyme-Substrate Complexes 161 Enzymes Often Team Up in Metabolic Pathways 162 Enzyme Activity Can Be Inhibited 162 Energy in the Form of ATP Is Required for Metabolism 164 6.2 The Catabolism of Glucose 166 Glucose Contains Stored Energy That Can Be Extracted 166 Glycolysis Is the First Stage of Energy Extraction 167 The Citric Acid Cycle Extracts More Energy from Pyruvate 167 Oxidative Phosphorylation Is the Process by Which Most ATP Molecules Form 169
2/10/10 10:38 AM
Contents
6.3 Other Aspects of Catabolism 173 Other Nutrients Represent Potential Energy Sources 173 Anaerobic Respiration Produces ATP Using Other Final Electron Acceptors 177 Fermentation Produces ATP Using an Organic Final Electron Acceptor 177 6.4 The Anabolism of Carbohydrates 180 Photosynthesis Is a Process to Acquire Chemical Energy 180 6.5 Patterns of Metabolism 183 Autotrophs and Heterotrophs Get Their Energy and Carbon in Different Ways 183 Chapter Review 186
Chapter 7 Control of Microorganisms: Physical and Chemical Methods 189 7.1 General Principles of Microbial Control 191 Sterilization and Sanitization Are Key to Good Public Health 191 7.2 Physical Methods of Control 192 Heat Is One of the Most Common Physical Control Methods 192 Dry Heat Has Useful Applications 192 Moist Heat Is More Versatile Than Dry Heat 194 Filtration Traps Microorganisms 198 Ultraviolet Light Can Be Used to Control Microbial Growth 200 Other Types of Radiation Also Can Sterilize Materials 200 Preservation Methods Retard Spoilage by Microorganisms in Foods 202
PART 2 THE GENETICS OF MICROORGANISMS Chapter 8
ix
222
Microbial Genetics 224
8.1 DNA and Chromosomes 226 Bacterial and Archaeal DNA Is Organized within the Nucleoid 227 DNA within a Chromosome Is Highly Compacted 228 Many Microbial Cells also Contain Plasmids 228 8.2 DNA Replication 229 DNA Replication Occurs in “Replication Factories” 229 DNA Polymerase Only Reads in the 3⬘ to 5⬘ Direction 231 8.3 Protein Synthesis 232 Transcription Copies Genetic Information into Complementary RNA 232 The Genetic Code Consists of Three-Letter Words 234 Translation Is the Process of Making the Polypeptide 236 Antibiotics Interfere with Protein Synthesis 240 Protein Synthesis Can Be Controlled in Several Ways 240 Transcription and Translation Are Compartmentalized 240
7.3 General Principles of Chemical Control 204 Chemical Control Methods Are Dependent on the Object to Be Treated 205 Chemical Agents Are Important to Laboratory and Hospital Safety 206 Antiseptics and Disinfectants Can Be Evaluated for Effectiveness 207 7.4 Chemical Methods of Control 208 Halogens Oxidize Proteins 208 Phenol and Phenolic Compounds Denature Proteins 210 Heavy Metals Interfere with Microbial Metabolism 211 Alcohols Denature Proteins and Disrupt Membranes 211 Soaps and Detergents Act as Surface-Active Agents 212 Peroxides Damage Cellular Components 213 Some Chemical Agents Combine with Nucleic Acids and/or Cell Proteins 213 Chapter Review 218
62582_FMXX_i_xxx.pdf ix
2/10/10 10:38 AM
x
Contents
8.4 Mutations 244 Mutations Are the Result of Heritable Changes in a Genome 244 Point Mutations Can Be Spontaneous or Induced 245 Repair Mechanisms Attempt to Correct Mistakes or Damage in the DNA 247 Transposable Genetic Elements Can Cause Mutations 251 8.5 Identifying Mutants 252 Plating Techniques Select for Specific Mutants or Characteristics 252 The Ames Test Can Identify Potential Mutagens 253 Chapter Review 255
Chapter 9 Gene Transfer, Genetic Engineering, and Genomics 260 9.1 Genetic Recombination in Bacteria 262 Genetic Information Can Be Transferred Vertically and Horizontally 262 Transformation Is the Uptake and Expression of DNA in a Recipient Cell 263 Conjugation Involves Cell-to-Cell Contact for Horizontal Gene Transfer 266 Conjugation Also Can Transfer Chromosomal DNA 267 Transduction Involves Viruses as Agents for Horizontal Transfer of DNA 269 9.2 Genetic Engineering and Biotechnology 274 Genetic Engineering Was Born from Genetic Recombination 275
Genetic Engineering Has Many Commercial and Practical Applications 277 DNA Probes Can Identify a Cloned Gene or DNA Segment 282 9.3 Microbial Genomics 284 Many Microbial Genomes Have Been Sequenced 284 Segments of the Human Genome May Have “Microbial Ancestors” 289 Microbial Genomics Will Advance Our Understanding of the Microbial World 290 Comparative Genomics Brings a New Perspective to Defining Infectious Diseases and Studying Evolution 291 Metagenomics Is Identifying the Previously Unseen Microbial World 293 Chapter Review 295
PART 3 BACTERIAL DISEASES OF HUMANS
298
Chapter 10 Airborne Bacterial Diseases 300 10.1 Structure and Indigenous Microbiota of the Respiratory System 302 Upper Respiratory Tract Defenses Limit Microbe Colonization of the Lower Respiratory Tract 302 10.2 Bacterial Diseases Affecting the Upper Respiratory Tract 304 Pharyngitis Is an Inflammation of the Throat 304 Diphtheria Is a Life-Threatening Illness 305 The Epiglottis Is Subject to Infection, Especially in Children 307 The Nose Is the Most Commonly Infected Region of the Upper Respiratory Tract 307 Ear Infections Are Common Illnesses in Early Childhood 308 Acute Bacterial Meningitis Is a Rapidly Developing Inflammation 310 10.3 Bacterial Diseases of the Lower Respiratory Tract 312 Pertussis (Whooping Cough) Is Highly Contagious 312 Tuberculosis Is One of the Greatest Challenges to Global Health 314 Infectious Bronchitis Is an Inflammation of the Bronchi 320 Pneumonia Can Be Caused by Several Bacteria 321 Other Pneumonia-Causing Bacterial Species Are Obligate, Intracellular Parasites 327 Chapter Review 331
62582_FMXX_i_xxx.pdf x
2/10/10 10:38 AM
Contents
xi
Chapter 11 Foodborne and Waterborne Bacterial Diseases 334 11.1 The Structure and Indigenous Microbiota of the Digestive System 336 The Digestive System Is Composed of Two Separate Categories of Organs 336 The Human Intestinal Microbiome Has Not Been Well Studied 338 11.2 Bacterial Diseases of the Oral Cavity 340 Dental Caries Causes Pain and Tooth Loss in Affected Individuals 340 Periodontal Disease Can Arise from Bacteria in Dental Plaque 342 11.3 Introduction to Bacterial Diseases of the GI Tract 344 GI Tract Diseases May Arise from Intoxications or Infections 344 There Are Several Ways Foods or Water Become Contaminated 345 11.4 Foodborne Intoxications Caused by Bacteria 346 Food Poisoning Illnesses Are the Result of Enterotoxins 346 11.5 Foodborne and Waterborne Infections 349 Bacterial Gastroenteritis Often Produces an Inflammatory Condition 349 Several Bacterial Species Can Cause an Invasive Gastroenteritis 354 Gastric Ulcer Disease Can Be Spread Person to Person 360 Chapter Review 367
Chapter 12 Soilborne and Arthropodborne Bacterial Diseases 371 12.1 Soilborne Bacterial Diseases 373 Anthrax Is an Enzootic Disease 373 Tetanus Causes Hyperactive Muscle Contractions 375 Gas Gangrene Causes Massive Tissue Damage 375 Leptospirosis Is a Zoonotic Disease Found Worldwide 377 12.2 Arthropodborne Bacterial Diseases 379 Plague Can Be a Highly Fatal Disease 379 Tularemia Has More Than One Disease Presentation 381 Lyme Disease Can Be Divided into Three Stages 382 Relapsing Fever Is Carried by Ticks and Lice 384
62582_FMXX_i_xxx.pdf xi
12.3 Rickettsial and Ehrlichial Arthropodborne Diseases 386 Rickettsial Infections Are Transmitted by Arthropods 386 Ehrlichia and Anaplasma Infections Are Emerging Diseases in the United States 389 Chapter Review 392
Chapter 13 Sexually Transmitted and Contact Transmitted Bacterial Diseases 396 13.1 The Structure and Indigenous Microbiota of the Female and Male Reproductive Systems 398 The Male and Female Reproductive Systems Consist of Primary and Accessory Sex Organs 398 Portions of the Male and Female Reproductive Systems Have an Indigenous Microbiota 399 Common vagin*l Infections Come From Indigenous Microbiota 399 13.2 Sexually Transmitted Diseases Caused by Bacteria 400 Chlamydial Urethritis Is the Most Frequently Reported STD 400 Gonorrhea Can Be an Infection in Any Sexually Active Person 403 Syphilis Is a Chronic, Infectious Disease 406 Other Sexually Transmitted Diseases Also Exist 408
2/10/10 10:38 AM
xii
Contents
Many Scientists Contributed to the Early Understanding of Viruses 442 14.2 What Are Viruses? 444 Viruses Are Tiny Infectious Agents 444 Viruses Are Grouped by Their Shape 446 Viruses Have a Host Range and Tissue Specificity 447 14.3 The Classification of Viruses 448 Nomenclature and Classification Do Not Use Conventional Taxonomic Groups 448
13.3 The Structure, Indigenous Microbiota, and Illnesses of the Female and Male Urinary System 410 Part of the Urinary Tract Harbors an Indigenous Microbiota 410 Infections of the Urinary Tract Are the Second Most Common Type of Infection in the Body 411 13.4 Contact Diseases Caused by Indigenous Bacterial Species 414 The Skin Protects Underlying Tissues from Microbial Colonization 414 The Skin Harbors Indigenous Microbes 416 Acne Is the Most Common Skin Disease Worldwide 417 Indigenous Microbiota of the Skin Can Form Biofilms 419 13.5 Contact Diseases Caused by Exogenous Bacterial Species 419 Staphylococcal Contact Diseases Have Several Manifestations 419 Streptococcal Diseases Can Be Mild to Severe 421 Other Wounds Also Can Cause Skin Infections 424 Animal Bites Can Puncture the Skin 425 Leprosy (Hansen Disease) Is a Chronic, Systemic Infection 426 13.6 Contact Diseases Affecting the Eye 430 Some Bacterial Eye Infections Can Cause Blindness 430 Chapter Review 433
PART 4 VIRUSES AND EUKARYOTIC MICROORGANISMS 438 Chapter 14 The Viruses and Virus-Like Agents 440 14.1 Foundations of Virology 442
62582_FMXX_i_xxx.pdf xii
14.4 Viral Replication and Its Control 449 The Replication of Bacteriophages Is a Five-Step Process 449 Animal Virus Replication Often Results in a Productive Infection 452 Some Animal Viruses Produce a Latent Infection 455 14.5 The Cultivation and Detection of Viruses 457 Detection of Viruses Often Is Critical to Disease Identification 457 Cultivation and Detection of Viruses Most Often Uses Cells in Culture 458 14.6 Tumors and Viruses 459 Cancer Is an Uncontrolled Growth and Spread of Cells 459 Viruses Are Associated with About 20% of Human Tumors 461 Oncogenic Viruses Transform Infected Cells 462 14.7 Emerging Viruses and Virus Evolution 466 Emerging Viruses Usually Arise Through Natural Phenomena 466 There Are Three Hypotheses for the Origin of Viruses 468 14.8 Virus-Like Agents 468 Viroids Are Infectious RNA Particles 468 Prions Are Infectious Proteins 469 Chapter Review 470
Chapter 15 Viral Infections of the Respiratory Tract and Skin 474 15.1 Viral Infections of the Upper Respiratory Tract 476 Rhinovirus Infections Produce Inflammation in the Upper Respiratory Tract 476 Adenovirus Infections Also Produce Symptoms Typical of a Common Cold 478 15.2 Viral Infections of the Lower Respiratory Tract 479 Influenza Is a Highly Communicable Acute Respiratory Infection 479 Paramyxovirus Infections Affect the Lower Respiratory Tract 483
2/10/10 10:38 AM
Contents
xiii
Other Viruses Also Produce Pneumonia 484 15.3 Diseases of the Skin Caused by Herpesviruses 486 Human Herpes Simplex Infections Are Widespread and Often Recurrent 488 Chickenpox Is No Longer a Prevalent Disease in the United States 490 Human Herpesvirus 6 Infections Primarily Occur in Infancy 491 A Few Herpesvirus Infections Are Oncogenic 493 15.4 Other Viral Diseases of the Skin 493 Paramyxovirus Infections Can Cause Typical Childhood Diseases 493 Rubella (German Measles) Is an Acute, Mildly Infectious Disease 496 Fifth Disease (Erythema Infectiosum) Produces a Mild Rash 497 Some Human Papillomavirus Infections Cause Warts 498 Poxvirus Infections Have Had Great Medical Impacts on Populations 500 Chapter Review 505
Chapter 16 Viral Infections of the Blood, Lymphatic, Gastrointestinal, and Nervous Systems 508 16.1 Viral Diseases of the Blood and the Lymphatic Systems 510 Two Herpesviruses Cause Blood Diseases 510 Several Hepatitis Viruses Are Bloodborne 512 16.2 Viral Diseases Causing Hemorrhagic Fevers 514 Flaviviruses Can Cause a Terrifying and Severe Illness 514 Members of the Filoviridae Produce Severe Hemorrhagic Lesions of the Tissues 516 Members of the Arenaviridae Are Associated with Chronic Infections in Rodents 518 16.3 Viral Infections of the Gastrointestinal Tract 519 Hepatitis Viruses A and E Are Transmitted by the Gastrointestinal Tract 519 Viral Gastroenteritis Is Caused by Several Unrelated Viruses 522 16.4 Viral Diseases of the Nervous System 524 The Rabies Virus Is of Great Medical Importance Worldwide 524 The Polio Virus May Be the Next Infectious Disease Eradicated 526 Arboviral Encephalitis Is a Result of a Primary Viral Infection 528 Chapter Review 532
62582_FMXX_i_xxx.pdf xiii
Chapter 17 Eukaryotic Microorganisms: The Fungi 535 17.1 Characteristics of Fungi 537 Fungi Share a Combination of Characteristics 537 Fungal Growth Is Influenced by Several Factors 538 Reproduction in Fungi Involves Spore Formation 540 17.2 The Classification of Fungi 543 Fungi Can Be Classified into Five Different Phyla 543 Yeasts Represent a Term for Any Single-Celled Stage of a Fungus 551 17.3 Fungal Intoxications 552 Some Fungi Can Be Poisonous or Even Deadly When Consumed 552 Some Mushrooms Produce Mycotoxins 552 17.4 Fungal Diseases of the Skin 554 Dermatophytosis Is an Infection of the Skin, Hair, and Nails 554 Candidiasis Often Is a Mild, Superficial Infection 555 Sporotrichosis Is an Occupational Hazard 556 17.5 Fungal Diseases of the Lower Respiratory Tract 558 Cryptococcosis Usually Occurs in Immunocompromised Individuals 558 Histoplasmosis Can Produce a Systemic Disease 558 Blastomycosis Usually Is Acquired Via the Respiratory Route 559
2/10/10 10:38 AM
xiv
Contents
Coccidioidomycosis Can Become a Potentially Lethal Infection 560 Pneumocystis Pneumonia Can Cause a Lethal Pneumonia 560 Other Fungi Also Cause Mycoses 562 Chapter Review 563
Chapter 18 Eukaryotic Microorganisms: The Parasites 567 18.1 The Classification and Characteristics of the Protista 569 The Protista Are a Perplexing Group of Microorganisms 569 The Protozoa Encompass a Variety of Lifestyles 572 18.2 Protozoal Diseases of the Skin, and the Digestive and Urinary Tracts 576 Leishmania Can Cause a Cutaneous or Visceral Infection 576 Several Protozoal Parasites Cause Diseases of the Digestive System 578 A Protozoan Parasite Also Infects the Urinary Tract 581 18.3 Protozoal Diseases of the Blood and Nervous System 583 The Plasmodium Parasite Infects the Blood 583 The Trypanosoma Parasites Can Cause LifeThreatening Systemic Diseases 585 Babesia Is an Apicomplexan Parasite 586 Toxoplasma Causes a Relatively Common Blood Infection 587 Naegleria Can Infect the Central Nervous System 588 18.4 The Multicellular Helminths and Helminthic Infections 591 There Are Two Groups of Parasitic Helminths 591 Several Trematodes Can Cause Human Illness 592 Tapeworms Survive in the Human Intestines 594 Humans Are Hosts to at Least 50 Roundworm Species 595 Roundworms Also Infect the Lymphatic System 599 Chapter Review 602
PART 5 DISEASE AND RESISTANCE
607
Chapter 19 Infection and Disease 609 19.1 The Host–Microbe Relationship 611 The Human Body Maintains a Symbiosis with Microbes 611 Pathogens Differ in Their Ability to Cause Disease 615
62582_FMXX_i_xxx.pdf xiv
Several Events Must Occur for Disease to Develop in the Host 615 19.2 Establishment of Infection and Diseases 617 Diseases Progress through a Series of Stages 617 Pathogen Entry into the Host Depends on Cell Adhesion and the Infectious Dose 621 Breaching the Host Barriers Can Establish Infection and Disease 622 Successful Invasiveness Requires Pathogens to Have Virulence Factors 622 Pathogens Must Be Able to Leave the Host to Spread Disease 627 19.3 Infectious Disease Epidemiology 627 Epidemiologists Often Have to Identify the Reservoir of an Infectious Disease 627 Epidemiologists Have Several Terms that Apply to the Infectious Disease Process 628 Infectious Diseases Can Be Transmitted in Several Ways 628 Diseases Also Are Described by How They Occur Within a Population 630 Nosocomial Infections Are Serious Health Threats within the Health Care System 638 Infectious Diseases Continue to Challenge Public Health Organizations 640 Chapter Review 643
Chapter 20 Resistance and the Immune System: Innate Immunity 646 20.1 An Overview to Host Immune Defenses 648 Blood Cells Form an Important Defense for Innate and Acquired Immunity 648 The Lymphatic System Is Composed of Cells and Tissues Essential to Immune Function 649 Innate and Acquired Immunity Are Essential Components of a Fully Functional Human Immune System 650 20.2 The Innate Immune Response 652 Physical, Chemical, and Microbiological Barriers Limit Entry of Pathogens 652 Phagocytosis Is a Nonspecific Defense Mechanism to Clear Microbes from Infected Tissues 653 Inflammation Plays an Important Role in Fighting Infection 656 Moderate Fever Benefits Host Defenses 659 Natural Killer Cells Recognize and Kill Abnormal Cells 660 Complement Marks Pathogens for Destruction 660
2/10/10 10:38 AM
Contents
Innate Immunity Depends on Receptor Recognition of Common PathogenAssociated Molecules 661 Interferon Puts Cells in an Antiviral State 663 Chapter Review 666
Chapter 21 Resistance and the Immune System: Acquired Immunity 669 21.1 An Overview of the Acquired Immune Response 671 The Ability to Eliminate Pathogens Requires a Multifaceted Approach 671 Acquired Immunity Generates Two Complementary Responses to Most Pathogens 674 Clonal Selection Activates the Appropriate B and T Cells 674 The Immune System Originates from Groups of Stem Cells 677 21.2 Humoral Immunity 678 Humoral Immunity Is a Response Mediated by Antigen-Specific B Lymphocytes 678 There Are Five Immunoglobulin Classes 679 Antibody Responses to Pathogens Are of Two Types 680 Antibody Diversity Is a Result of Gene Rearrangements 681 Antibody Interactions Mediate the Disposal of Antigens (Pathogens) 681 21.3 Cell-Mediated Immunity 685 Cellular Immunity Relies on T Lymphocyte Receptors and Recognition 686 Naive T Cells Mature into Effector T Cells 687 Cytotoxic T Cells Recognize MHC-I Peptide Complexes 691 TH2 Cells Initiate the Cellular Response to Humoral Immunity 691 Chapter Review 695
Chapter 22 Immunity and Serology 698 22.1 Immunity to Disease 700 Acquired Immunity Can Result by Actively Producing Antibodies to an Antigen 700 There Are Several “Generations” of Vaccines 701 Acquired Immunity Also Can Result by Passively Receiving Antibodies to an Antigen 706 Herd Immunity Results from Effective Vaccination Programs 709 Do Vaccines Have Dangerous Side Effects? 709
62582_FMXX_i_xxx.pdf xv
xv
22.2 Serological Reactions 711 Serological Reactions Have Certain Characteristics 711 Neutralization Involves Antigen-Antibody Reactions 713 Precipitation Requires the Formation of a Lattice between Soluble Antigen and Antibody 713 Agglutination Involves the Clumping of Antigens 714 Complement Fixation Can Detect Antibodies to a Variety of Pathogens 717 Labeling Methods Are Used to Detect Antigen-Antibody Binding 718 22.3 Monoclonal Antibodies 721 Monoclonal Antibodies Are Becoming a “Magic Bullet” in Biomedicine 721 Chapter Review 725
Chapter 23 Immune Disorders and AIDS 729 23.1 Type 1 IgE-Mediated Hypersensitivity 730 Type I Hypersensitivity Is Induced by Allergens 731 Systemic Anaphylaxis Is the Most Dangerous Form of a Type I Hypersensitivity 733 Atopic Disorders Are the Most Common Form of a Type I Hypersensitivity 734 Allergic Reactions Also Are Responsible for Triggering Many Cases of Asthma 736 Why Do Only Some People Have IgE-Mediated Hypersensitivities? 737 Therapies Sometimes Can Control Type I Hypersensitivities 738 23.2 Other Types of Hypersensitivity 740 Type II Hypersensitivity Involves AntibodyMediated Cell Destruction 740 Type III Hypersensitivity Is Caused by Antigen-Antibody Aggregates 743 Type IV Hypersensitivity Is Mediated by Antigen-Specific T Cells 744 23.3 Autoimmune Disorders and Transplantation 748 An Autoimmune Disorder Is a Failure to Distinguish Self from Non-self 748 Transplantation of Tissues or Organs Is an Important Medical Therapy 750 Immunosuppressive Agents Prevent Allograft Rejection 753 23.4 Immunodeficiency Disorders 753 Immunodeficiencies Can Involve Any Aspect of the Immune System 754 The Human Immunodeficiency Virus (HIV) Is Responsible for HIV Disease and AIDS 755 Chapter Review 763
2/10/10 10:38 AM
xvi
Contents
Chapter 24 Antimicrobial Drugs 767 24.1 The History and Properties of Antimicrobial Agents 769 The History of Chemotherapy Originated with Paul Ehrlich 769 Fleming’s Observation of the Penicillin Effect Ushered in the Era of Antibiotics 770 Antimicrobial Agents Have a Number of Important Properties 771 Antibiotics Are Agents of Natural Biological Warfare 771 24.2 The Synthetic Antibacterial Agents 772 Sulfanilamide and Other Sulfonamides Target Specific Metabolic Reactions 772 Other Synthetic Antimicrobials Have Additional Bacterial Cell Targets 774 24.3 The Beta-Lactam Family of Antibiotics 775 Penicillin Has Remained the Most Widely Used Antibiotic 776 Other Beta-Lactam Antibiotics Also Inhibit Cell Wall Synthesis 777 24.4 Other Bacterially Produced Antibiotics 778 Vancomycin Also Inhibits Cell Wall Synthesis 778 Polypeptide Antibiotics Affect the Cell Membrane 778 Many Antibiotics Affect Protein Synthesis 779 Some Antibiotics Inhibit Nucleic Acid Synthesis 782 24.5 Antiviral, Antifungal, and Antiparasitic Drugs 782 Antiviral Drugs Can Be Used to Treat a Limited Number of Human Viral Diseases 784 Several Classes of Antifungal Drugs Cause Membrane Damage 785 The Goal of Antiprotozoal Agents Is to Eradicate the Parasite 786
62582_FMXX_i_xxx.pdf xvi
Antihelminthic Agents Are Targeted at Nondividing Helminths 788 24.6 Antibiotic Assays and Resistance 788 There Are Several Antibiotic Susceptibility Assays 788 There Are Four Major Mechanisms of Antibiotic Resistance 790 Antibiotic Resistance Is of Grave Concern in the Medical Community 795 New Approaches to Antibiotic Therapy Are Needed 797 Chapter Review 802
PART 6 ENVIRONMENTAL AND APPLIED MICROBIOLOGY Available online with access code Chapter 25 Microbiology of Foods Available online with access code Chapter 26 Environmental Microbiology Available online with access code Chapter 27 Industrial Microbiology and Biotechnology Available online with access code Appendix A Metric Measurement A-1 Appendix B Temperature Conversion Chart A-1 Appendix C Answers to EvenNumbered End-of-Chapter Questions Available online Appendix D Answers to Textbook Case and MicroInquiry Questions Available online Glossary Index
G-1
I-1
Photograph Acknowledgments
P-1
2/17/10 2:18 PM
Preface Do We Need to Know...? As you embark upon your studies of the microbial world—and a fascinating world it will be— you will wonder how important some topics are that will be covered. You may ask yourself—or your instructor—how important is this topic to my career? If it is nursing, obviously the material on infectious diseases, epidemiology (the scientific and medical study of the causes, transmission, and control of a disease within a population), and immunology (the study of how our bodies fight an infection or disease) are critical. If you are planning on pharmacy school, add antimicrobial drugs to that list. But what about some of the other “science” topics, like microbial metabolism and genetics? Are these important to a successful career? A few years ago, the forum section on a Web site called allnurses.com (“A Nursing Community for Nurses”) asked nurses “What [microbiology] topics keep resurfacing in your nursing classes?” Among the top responses were some obvious ones, such as antibiotics and antibiotic resistance, infectious diseases, and immunity. But also on that list was microbial genetics. Perhaps more revealing were the responses to a second question: “What do you wish that you had learned better in microbiology that you thought you would never see again [in your nursing classes]?” Among the answers submitted was metabolism. Another survey published in Focus on Microbiology Education in 2006 (Volume 12 No. 2, p. 7–9) asked nurse educators what they thought were important topics for their students to learn in a microbiology class. The top six in importance were: 1. Bacterial structures and their functions; 2. Viral structures and their functions; 3. Epidemiology and public heath issues;
4. Antibiotics; 5. Immunology; 6. Disinfection and antisepsis. Rounding out the top 10 were: 7. Bacterial metabolism; 8. Fungal structures and their functions; 9. Microbial genetics; 10. Biotechnology (production of vaccines, medicines, and diagnostic techniques). Notice that in both surveys, the topics of microbial metabolism and microbial genetics are among the top 10 concepts to master and understand. So, make sure you pay attention to what your instructor has to say and what “we need to know” (understand) about these topics. They are important—and they will show up again in your nursing courses! Besides metabolism and genetics, there is a substantial amount of other information you will need to learn and understand. To facilitate this understanding and coordinate it with class material, I developed a “learning design” format for the textbook (described below) to make reading easier, studying more efficient, and learning uncomplicated. Most importantly, the design allows you to better evaluate your learning and provides you with the tools needed to probe your understanding—that is, chapter learning aids and assessment drills to evaluate your progress. Realize, a prepared student knows her or his mastery before an exam—not as a result of the exam! The “learning design” format facilitates this need. I am excited that you are using and reading this new, ninth edition of Alcamo’s Fundamentals of Microbiology. I hope it is very useful in your studies and also enjoyable to read. Always take time to read many of the sidebars (MicroFocus boxes) whether they are assigned or not. They will help in your overall microbiology experience and the realization that microorganisms do rule the world!
xvii
62582_FMXX_i_xxx.pdf xvii
2/17/10 2:18 PM
xviii
Preface
Audience
What’s New and Important
Alcamo’s Fundamentals of Microbiology, Ninth Edition, is written for introductory microbiology courses having an emphasis on the biology of human disease. It is geared toward students in health and allied health science curricula such as nursing, dental hygiene, medical assistance, sanitary science, and medical laboratory technology. It also will be an asset to students studying pharmacy, food science, agriculture, environmental science, and health administration. In addition, the text provides a firm foundation for advanced programs in biological sciences, as well as medicine, dentistry, and other health professions.
Besides the continued emphasis on a global perspective on infection, this edition provides detailed updates to microbial structure and function, disease information and statistics, and the immune system.
Organization
Marginal Definition
62582_FMXX_i_xxx.pdf xviii
Alcamo’s Fundamentals of Microbiology, Ninth Edition, is divided into six major areas of concentration. These areas use basic principles as frameworks to provide the unity and diversity of microbiology. Among the principles explored are the variations in structure and growth of microorganisms, the basis for infectious disease and resistance, and the beneficial effects microorganisms have on our lives. Part 1 deals with the foundations of microbiology. It includes chapters on the origins of microbiology and the universal concepts of growth and metabolism that underpin the science. Part 2 then covers important material on the genetics of microorganisms, including genetic engineering and biotechnology. The discussions carry over to Part 3, where the spectrum of bacterial diseases is surveyed. Part 4 looks at the significance of other microorganisms, including viruses, fungi, and the protozoal and multicellular parasites. In Part 5 of the text, the emphasis turns to infectious disease and the body’s resistance through the immune system. Here, we study the reasons for disease and the means for surviving it. Antibiotics and antibiotic resistance are also covered. Part 6 closes the text with brief discussions of how public health measures interrupt epidemics. Some key insights also are given on the positive effects microorganisms exert through biotechnology.
Chapter Organization The chapter sequence and number remain the same as in the previous edition, with one exception: the material on physical and chemical control methods has been moved up to Chapter 7, supplying many applications to the more detailed material in the previous chapters. The “Learning Design” Concept The text format includes activities designed to encourage student interaction and assessment. These design elements form an integrated study and learning package (learning tools) for student understanding and assessment. • Chapter Introductions provide a stimulating thought or historical perspective to set the tone for the chapter. • Key Concepts present statements identifying the important concepts in the upcoming section and alert you to the significance of that written material. • Boldface Terms highlight important terms and ideas in the text. • Marginal Definitions present succinct definitions of notable terms as they enter the discussion. • Marginal Drawings provide visual images of bacterial shapes and cell arrangements and eukaryotic cells. • Marginal Chemical Structures present structural formulas for many of the antimicrobial drugs described in Chapter 24. • Concept and Reasoning Checks allow you to pause and either summarize the information presented in the previous section or critically reason through a question pertaining to the previous section. • MicroFocus Boxes explore interesting topics concerning microbiology or microorganisms. • MicroInquiry Boxes allow you to investigate (usually interactively) some important aspect of the chapter being studied.
2/10/10 10:38 AM
Preface
•
•
•
•
•
•
•
•
•
•
Textbook Cases are embedded in many chapters to help you understand pathogens by presenting contemporary disease outbreaks originally reported by the Centers for Disease Control and Prevention. Figure Questions further reinforce your understanding of microbiology concepts described in the text. Summary Tables pull together the similarities and differences of topics discussed in the chapter. Pronouncing Microorganism Names (inside front and back covers) helps you correctly pronounce those sometimes tongue-twisting microorganism names. Summaries of Key Concepts condense the major ideas discussed in the chapter. The “learning design” package also includes many useful and important end-of-chapter student assessments. Learning Objectives outline the important concepts in the chapters through Bloom’s Taxonomy, a classification of levels of intellectual skills important in learning. Self-Test questions (Step A) are multiplechoice questions focusing on concrete “facts” learned in the chapter. Let’s face it: there is information that needs to be memorized in order to reason critically. Chapter Review (Step B) contains questions of a somewhat unconventional type to assist review of the chapter contents. Questions for Thought and Discussion (Step C) encourage students to use the text to resolve thought-provoking problems with contemporary relevance. Applications (Step D) are questions requiring students to reason critically through a problem of practical significance.
Being Skeptical One of the seven types of essay boxes new to this edition is titled “Being Skeptical.” A good scientist is a skeptic and skepticism is an important part of science. Skepticism, unlike cynicism, is not unwilling to accept a claim or observation. Skepticism simply says “Prove it!” Science applies scientific reasoning as the method for proof. Thus, a scientist, such as a microbiologist,
62582_FMXX_i_xxx.pdf xix
xix
MicroFocus Box
must see the evidence and it must be compelling before the observation or statement is provisionally accepted. The claim is still open to further examination and experimentation. The “Being Skeptical” essays scattered through the textbook present an often-fantastic statement or claim. The essay then examines the claim using reasoning skills and the scientific process, which is sometimes called the scientific method.
Why Pathogens? Microorganisms perform many useful services for humans when they produce food products, manufacture organic materials in industrial plants, and recycle such elements as carbon and nitrogen. The emphasis of this book, however, is on the tiny, but significant percentage of microorganisms causing human disease, the so-called pathogens. Why do we emphasize pathogens? Here are several reasons: • Pathogens have regularly altered the course of human history. • Pathogens are familiar to audiences of microbiology. • Pathogens add drama to an invisible world of microorganisms.
2/10/10 10:38 AM
xx
Preface
•
Pathogens illustrate ecological relationships between humans and microorganisms. • Pathogens point up the diversity of microorganisms. Moreover, the study of pathogens makes basic science relevant and shows how microbiology interfaces with other disciplines such as sociology, economics, history, politics, and geography. Finally, the study of pathogens helps us to understand contemporary newspaper articles, magazine headlines, and stories on the news. And in the end, that makes us better citizens. Indeed, the famous essayist Thomas Mann once wrote, “All interest in disease is only another expression of interest in life.”
Additional Resources Jones and Bartlett offers an array of ancillaries to assist instructors and students in teaching and mastering the concepts in this text. Additional information and review copies of any of the following items are available through your Jones and Bartlett sales representative or by going to www.jbpub.com/biology. For the Student Part 6 of this book, “Environmental and Applied Microbiology,” is available online with the access code bound into every new copy of this text (in North America). Additional access codes are available for purchase separately. The Web site we developed exclusively for the ninth edition of this text, http://microbiology.jbpub.com/9e, offers a variety of resources to enhance understanding of microbiology. The site contains eLearning, a free on-line study guide with chapter outlines, chapter essay questions, key term reviews, and short study quizzes. The Study Guide to accompany this textbook contains important information to help you study, take effective class notes, prepare properly for exams, and even to manage your time effectively. The latter is the single most common reason for poor performance in college courses. The Study Guide also contains over 3,000 practice exercises and study questions of various types to help you learn and retain the information in the text. Laboratory Fundamentals of Microbiology, Ninth Edition, is a series of over 30 multipart laboratory exercises providing basic training in
62582_FMXX_i_xxx.pdf xx
the handling of microorganisms and reinforcing ideas and concepts described in the textbook. Guide to Infectious Diseases by Body Systems is an excellent tool for learning about microbial diseases. Each of the fifteen body systems units presents a brief introduction to the anatomical system and the bacterial, viral, fungal, or parasitic organism infecting the system. An anthology called Encounters in Microbiology (Volume I, Second Edition, and Volume II) brings together “Vital Signs” articles from Discover magazine in which health professionals use their knowledge of microbiology in their medical cases. For the Instructor Compatible with Windows® and Macintosh® platforms, the Instructor’s Media CD-ROM provides instructors with the following traditional ancillaries: • The PowerPoint® Image Bank provides the illustrations, photographs, and tables (to which Jones and Bartlett Publishers holds the copyright or has permission to reproduce digitally) inserted into PowerPoint slides. You can quickly and easily copy individual images or tables into your existing lecture slides. • The PowerPoint Lecture Outline Slides presentation package, prepared by Jean Revie of South Mountain Community College, provides lecture notes and images for each chapter of Alcamo’s Fundamentals of Microbiology. Instructors with the Microsoft PowerPoint software can customize the outlines, art, and order of presentation. The following materials are also available online, at http://www.jbpub.com/catalog/ 9780763762582. • The Instructor’s Manual, provided as a text file, includes chapter summaries and complete chapter lecture outlines and answers to all the end-of-chapter assessments. • Chapter Assessments Answers provide short answers to figure questions, Concept and Reasoning Checks, and all end-of-chapter materials. • The Test Bank is available as straight text files. It has been updated by Cindy Ault of Jamestown College, Jackie Reynolds of Richland College, and Sue Katz of Rogers State University.
2/10/10 12:27 PM
Acknowledgments It is always my pleasure to thank everyone at Jones and Bartlett Publishers who helped put together this new version of the textbook. Cathleen Sether has been a more-than-able publisher— just don’t cross international borders with her. Leah Corrigan, the production editor, has been a pleasure to work with, and Lou Bruno continues to display his mastery of the production process; Anne Spencer developed the new design format; Caroline Perry ably assisted everyone; Christine Myaskovsky tracked down many of the great photos that embellish these pages; Deborah Patton read every page and created the index; Shellie Newell was again the “eagle-eye” copy editor; and Elizabeth Morales provided much of the excellent art in this new edition. The book benefited from the expertise of several fellow microbiologists and biologists. I wish to thank my colleagues Philip Fernandez and Michael McKinley for their input during the
writing of this edition. I especially want to thank Brett Miller, a former microbiology student and a GCC biotech major who read every word of the eighth edition, making note of typographic errors, syntax and grammatical errors, and all unclear statements found in the text. After more than 25 years of university and college instruction, I must thank all my former students who keep me on my toes in the classroom and require me to always be prepared. Their suggestions and evaluations have encouraged me to continually assess my instruction so it can be easily understood. I salute you, and I hope those of you who read this text will let me know what works and what still needs improvement to make your learning efficient and still enjoyable. Jeff Pommerville Scottsdale, AZ
xxi
62582_FMXX_i_xxx.pdf xxi
2/10/10 10:38 AM
About the Author
Today I am a microbiologist, researcher, and science educator. My plans did not start with that intent. While in high school in Santa Barbara, California, I wanted to play professional baseball, study the stars, and own a ‘66 Corvette. None of these desires would come true—my batting average was miserable (but I was a good defensive fielder), I hated the astronomy correspondence course I took, and I never bought that Corvette. I found an interest in biology at Santa Barbara City College. After squeaking through college calculus, I transferred to the University of California at Santa Barbara (UCSB) where I received a B.S. in Biology and stayed on to pursue a Ph.D. degree in the lab of Ian Ross studying cell communication and sexual pheromones in a water mold. After receiving my doctorate in Cell and Organismal Biology, my graduation was written up in the local newspaper as a native son who was a fungal sex biologist—an image that was not lost on my three older brothers!
While in graduate school at UCSB, I rescued a secretary in distress from being licked to death by a German Shepherd. Within a year, we were married (the secretary and I). When I finished my doctoral thesis, I spent several years as a postdoctoral fellow at the University of Georgia. I worried that I was involved in too many research projects, but a faculty member told me something I will never forget. He said, “Jeff, it’s when you can’t think of a project or what to do that you need to worry.” Well, I have never had to worry! I then moved on to Texas A&M University, where I spent eight years in teaching and research—and telling Aggie jokes. Toward the end of this time, after publishing over 30 peerreviewed papers in national and international research journals, I realized I had a real interest in teaching and education. Leaving the sex biologist nomen behind, I headed farther west to Arizona to join the biology faculty at Glendale Community College, where I continue to teach introductory biology and microbiology. I have been lucky to be part of several educational research projects and have been honored, with two of my colleagues, with a Team Innovation of the Year Award by the League of Innovation in the Community Colleges. In 2000, I became project director and lead principal investigator for a National Science Foundation grant to improve student outcomes in science through changes in curriculum and pedagogy. I had a fascinating three years coordinating more than 60 science faculty members (who at times were harder to manage than students) in designing and field testing 18 interdisciplinary science units. This culminated with me being honored in 2003 with the Gustav Ohaus Award (College Division) for Innovations in Science Teaching from the National Science Teachers Association.
xxii
62582_FMXX_i_xxx.pdf xxii
2/10/10 10:38 AM
About the Author
I am an associate editor for the Journal of Microbiology and Biology Education, the education research journal of the American Society for Microbiology (ASM) and in 2004 was cochair for the ASM Conference for Undergraduate Educators. From 2006 to 2007, I was the chair of Undergraduate Education Division of ASM. In 2006, I was selected as one of four outstanding instructors at Glendale Community College. The culmination of my teaching career came in 2008 when I was nationally recognized by being awarded the Carski Foundation Distinguished Undergraduate Teaching Award for excellence in teaching microbiology to undergraduate students and encouraging them to subsequent achievement. I mention all this not to impress but to show how the road of life sometimes offers opportuni-
xxiii
ties in unexpected and unplanned ways. The key though is keeping your “hands on the wheel and your eyes on the prize”; then unlimited opportunities will come your way. With the untimely passing of my friend and professional colleague Ed Alcamo, also the Carski recipient in 2000, I was privileged in 2003 to be offered the opportunity to take over the authorship of Fundamentals of Microbiology. It is an undertaking I continue to relish as I (along with the wonderful folks at Jones and Bartlett) try to evolve a new breed of microbiology textbook reflecting the pedagogy change occurring in science classrooms today. And, hey, who knows—maybe that ‘66 Corvette could be in my garage yet.
DEDICATION I dedicate this edition of the book to my late mother and father. Their willingness to let me “explore” the natural world guided me to where I am today. I hope they are pleased with the outcome.
62582_FMXX_i_xxx.pdf xxiii
2/10/10 10:38 AM
To the Student— Study Smart CHAPTER AIDS Chapter Introduction
Boldface terms
What is this chapter about?
Marginal definitions Marginal drawings and chemical structures MicroFocus boxes Key Concepts What is important in the section I am about to read?
MicroInquiry boxes
Your success in microbiology and any college or university course will depend on your ability to study effectively and efficiently. Therefore, this textbook was designed with you, the student, in mind. The text’s organization will help you improve your learning and understanding and, ultimately, your grades. The learning design concept described in the Preface and illustrated below reflects this organization. Study it carefully, and, if you adopt the flow of study shown, you should be a big step ahead in your preparation and understanding of microbiology—and for that matter any subject you are taking.
Textbook cases Figure questions Concept and Reasoning Checks Have I understood what I just read?
Pronouncing organism names Summary tables
END-OF-CHAPTER STUDENT ASSESSMENTS Learning Objectives
Summary of Key Concepts Did I get the main idea?
Are there other materials that will help me master and retain the information?
Self-Test Questions for Thought and Discussion Applications Review
Student Study Guide (bundled or sold separately)
xxiv
62582_FMXX_i_xxx.pdf xxiv
2/10/10 10:38 AM
To the Student—Study Smart
When I was an undergraduate student, I hardly ever read the “To the Student” section (if indeed one existed) in my textbooks because the section rarely contained any information of importance. This one does, so please read on. In college, I was a mediocre student until my junior year. Why? Mainly because I did not know how to study properly, and, important here, I did not know how to read a textbook effectively. My textbooks were filled with underlined sentences (highlighters hadn’t been invented yet!) without any plan on how I would use this “emphasized” information. In fact, most textbooks assume you know how to read a textbook properly. I didn’t and you might not, either. Reading a textbook is difficult if you are not properly prepared. So you can take advantage of what I learned as a student and have learned from instructing thousands of students; I have worked hard to make this text user friendly with a reading style that is not threatening or complicated. Still, there is a substantial amount of information to learn and understand, so having the appropriate reading and comprehension skills is critical. Therefore, I encourage you to spend 30 minutes reading this section, as I am going to give you several tips and suggestions for acquiring those skills. Let me show you how to be an active reader. Note: the student Study Guide also contains similar information on how to take notes from the text, how to study, how to take class (lecture) notes, how to prepare for and take exams, and perhaps most important for you, how to manage your time effectively. It all is part of this “learning design,” my wish to make you a better student.
BE A PREPARED READER Before you jump into reading a section of a chapter in this text, prepare yourself by finding the place and time and having the tools for study. Place. Where are you right now as you read these lines? Are you in a quiet library or at home? If at home, are there any distractions, such as loud music, a blaring television, or screaming kids? Is the lighting adequate to read? Are you sitting at a desk or lounging on the living room sofa? Get where I am going? When you read for an educational purpose—that is, to learn and understand something—you need to maximize
62582_FMXX_i_xxx.pdf xxv
xxv
the environment for reading. Yes, it should be comfortable but not to the point that you will doze off. Time. All of us have different times during the day when we perform some skill, be it exercising or reading, the best. The last thing you want to do is read when you are tired or simply not “in tune” for the job that needs to be done. You cannot learn and understand the information if you fall asleep or lack a positive attitude. I have kept the chapters in this text to about the same length so you can estimate the time necessary for each and plan your reading accordingly. If you have done your preliminary survey of the chapter or chapter section, you can determine about how much time you will need. If 40 minutes is needed to read—and comprehend (see below)—a section of a chapter, find the place and time that will give you 40 minutes of uninterrupted study. Brain research suggests that most people’s brains cannot spend more than 45 minutes in concentrated, technical reading. Therefore, I have avoided lengthy presentations and instead have focused on smaller sections, each with its own heading. These should accommodate shorter reading periods. Reading Tools. Lastly, as you read this, what study tools do you have at your side? Do you have a highlighter or pen for emphasizing or underlining important words or phrases? Notice, the text has wide margins, which allow you to make notes or to indicate something that needs further clarification. Do you have a pencil or pen handy to make these notes? Or, if you do not want to “deface” the text, make your notes in a notebook. Lastly, some students find having a ruler is useful to prevent your eyes from wandering on the page and to read each line without distraction.
BE AN EXPLORER BEFORE YOU READ When you sit down to read a section of a chapter, do some preliminary exploring. Look at the section head and subheadings to get an idea of what is discussed. Preview any diagrams, photographs, tables, graphs, or other visuals used. They give you a better idea of what is going to occur. We have used a good deal of space in the text for these features, so use them to your advantage. They will help you learn the written
2/10/10 10:39 AM
xxvi
To the Student—Study Smart
information and comprehend its meaning. Do not try to understand all the visuals, but try to generate a mental “big picture” of what is to come. Familiarize yourself with any symbols or technical jargon that might be used in the visuals. The end of each chapter contains a Summary of Key Concepts for that chapter. It is a good idea to read the summary before delving into the chapter. That way you will have a framework for the chapter before filling in the nitty-gritty information.
memory. If you try to hold more, then something else needs to be removed—sort of like a full computer disk. So that you do not lose any of this important information, you need to transfer it to long-term memory—to the hard drive if you will. In reading and studying, this means retaining the term or concept; so, write it out in your notebook using your own words. Memorizing a term does not mean you have learned the term or understood the concept. By actively writing it out in your own words, you are forced to think and actively interact with the information. This repetition reinforces your learning.
BE A DETECTIVE AS YOU READ Reading a section of a textbook is not the same as reading a novel. With a textbook, you need to uncover the important information (the terms and concepts) from the forest of words on the page. So, the first thing to do is read the complete paragraph. When you have determined the main ideas, highlight or underline them. However, I have seen students highlighting the entire paragraph in yellow, including every a, the, and and. This is an example of highlighting before knowing what is important. So, I have helped you out somewhat. Important terms and concepts are in bold face followed by the definition (or the definition might be in the margin). So only highlight or underline with a pen essential ideas and key phrases—not complete sentences, if possible. By the way, the important microbiological terms and major concepts also are in the Glossary at the back of the text. What if a paragraph or section has no boldfaced words? How do you find what is important here? From an English course, you may know that often the most important information is mentioned first in the paragraph. If it is followed by one or more examples, then you can backtrack and know what was important in the paragraph. In addition, I have added section “speed bumps” (called Concept and Reasoning Checks) to let you test your learning and understanding before getting too far ahead in the material. These checks also are clues to what was important in the section you just read.
BE A REPETITIOUS STUDENT Brain research has shown that each individual can only hold so much information in short-term
62582_FMXX_i_xxx.pdf xxvi
BE A PATIENT STUDENT In textbooks, you cannot read at the speed that you read your e-mail or a magazine story. There are unfamiliar details to be learned and understood—and this requires being a patient, slower reader. Actually, if you are not a fast reader to begin with, as I am, it may be an advantage in your learning process. Identifying the important information from a textbook chapter requires you to slow down your reading speed. Speedreading is of no value here.
KNOW THE WHAT, WHY, AND HOW Have you ever read something only to say, “I have no idea what I read!” As I’ve already mentioned, reading a microbiology text is not the same as reading Sports Illustrated or People magazine. In these entertainment magazines, you read passively for leisure or perhaps amusem*nt. In Alcamo’s Fundamentals of Microbiology, you must read actively for learning and understanding—that is, for comprehension. This can quickly lead to boredom unless you engage your brain as you read—that is, be an active reader. Do this by knowing the what, why, and how of your reading. • What is the general topic or idea being discussed? This often is easy to determine because the section heading might tell you. If not, then it will appear in the first sentence or beginning part of the paragraph. • Why is this information important? If I have done my job, the text section will tell you why it is important or the examples provided will drive the importance home. These sur-
2/10/10 10:39 AM
To the Student—Study Smart
•
rounding clues further explain why the main idea was important. How do I “mine” the information presented? This was discussed under being a detective.
A MARKED UP READING EXAMPLE So let’s put words into action. Below is a passage from the text. I have marked up the passage as if I were a student reading it for the first time. It uses many of the hints and suggestions I have provided. Remember, it is important to read the passage slowly, and concentrate on the main idea (concept) and the special terms that apply.
62582_FMXX_i_xxx.pdf xxvii
xxvii
HAVE A DEBRIEFING STRATEGY After reading the material, be ready to debrief. Verbally summarize what you have learned. This will start moving the short-term information into the long-term memory storage—that is, retention. Any notes you made concerning confusing material should be discussed as soon as possible with your instructor. For microbiology, allow time to draw out diagrams. Again, repetition makes for easier learning and better retention. In many professions, such as sports or the theater, the name of the game is practice, practice, practice. The hints and suggestions I have given you form a skill that requires practice to
2/10/10 10:39 AM
xxviii
To the Student—Study Smart
perfect and use efficiently. Be patient, things will not happen overnight; perseverance and willingness though will pay off with practice. You might also check with your college or university academic (or learning) resource center. These folks will have more ways to help you to read a textbook better and to study well overall.
CONCEPT MAPS In science as well as in other subjects you take at the college or university, there often are concepts that appear abstract or simply so complex they are difficult to understand. A concept map is one tool to help you enhance your abilities to think and learn. Critical reasoning and the ability to make connections between complex, nonlinear information are essential to your studies and career. Concept maps are a learning tool designed to represent complex or abstract information visually. Neurobiologists and psychologists tell us that the brain’s primary function is to take incoming information and interpret it in a meaningful or practical way. They also have found that the brain has an easier time making sense of information when it is presented in a visual format. Importantly, concept maps not only present the information in “visual sentences” but also take paragraphs of material and present it in an “at-a-glance” format. Therefore, you can use concept maps to • Communicate and organize complex ideas in a meaningful way • Aid your learning by seeing connections within or between concepts and knowledge • Assess your understanding or diagnose misunderstanding There are many different types of concept maps. The two most used in this textbook are the process map or flow chart and the hierarchical map. The hierarchical map starts with a general concept (the most inclusive word or phrase) at the top of the map and descends downward using more specific, less general words or terms. In several chapters in this textbook process or hierarchical maps are drawn—and you have the opportunity to construct your own hierarchical maps as well.
62582_FMXX_i_xxx.pdf xxviii
Concept mapping is the strategy used to produce a concept map. So, let’s see how one makes a hierarchical map. How to Construct a Concept Map 1. Print the central idea (concept or question to be mapped) in a box at the top center of a blank, unlined piece of paper. Use uppercase letters to identify the central idea. 2. Once the concept has been selected, identify the key terms (words or short phrases) that apply to or stem from the concept. Often these may be given to you as a list. If you have read a section of a text, you can extract the terms from that material, as the words are usually boldfaced or italicized. 3. Now, from this list, try to create a hierarchy for the terms you have identified; that is, list them from the most general, most inclusive to the least general, most specific. This ranking may only be approximate and subject to change as you begin mapping. 4. Construct a preliminary concept map. This can be done by writing all of the terms on Post-its®, which can be moved around easily on a large piece of paper. This is necessary as one begins to struggle with the process of building a good hierarchical organization. 5. The concept map connects terms associated with a concept in the following way: • The relationship between the concept and the first term(s), and between terms, is connected by an arrow pointing in the direction of the relationship (usually downward or horizontal if connecting related terms). • Each arrow should have a label, a very short phrase that explains the relationship with the next term. In the end, each link with a label reads like a sentence. 6. Once you have your map completed, redraw it in a more permanent form. Box in all terms that were on the sticky notes. Remember there may be more than one way to draw a good concept map, and don’t be scared off if at first you have some problems mapping; mapping will become more apparent to you after you have practiced this technique a few times using the opportunities given to you in the early chapters of the textbook.
2/10/10 10:39 AM
To the Student—Study Smart
xxix
7. Now look at the map and see if it answers the following. Does it: • Define clearly the central idea by positioning it in the center of the page? • Place all the terms in a logical hierarchy and indicate clearly the relative importance of each term? • Allow you to figure out the relationships among the key ideas more easily? • Permit you to see all the information visually on one page? • Allow you to visualize complex relationships more easily? • Make recall and review more efficient? Example After reading the section in Chapter 8 on “Protein Synthesis,” a student makes a list of the terms used and maps the concept. Using the steps outlined above, the student produces the following hierarchical map. Does it satisfy all the questions asked in (8)? Practical Uses for Mapping •
•
•
•
Summarizing textbook readings. Use mapping
to summarize a chapter section or a whole chapter in a textbook. This purpose for mapping is used many times in this text. Summarizing lectures. Although producing a concept map during the classroom period may not be the best use of the time, making a concept map or maps from the material after class will help you remember the important points and encourage high-level, critical reasoning, which is so important in university and college studies. Reviewing for an exam. Having concept maps made ahead of time can be a very useful and productive way to study for an exam, particularly if the emphasis of the course is on understanding and applying abstract, theoretical material, rather than on simply reproducing memorized information. Working on an essay. Mapping also is a powerful tool to use during the early stages of writing a course essay or term paper. Making a
62582_FMXX_i_xxx.pdf xxix
concept map before you write the first rough draft can help you see and ensure you have the important points and information you will want to make.
SEND ME A NOTE In closing, I would like to invite you to write me and let me know what is good about this textbook so I can build on it and what may need improvement so I can revise it. Also, I would be pleased to hear about any news of microbiology in your community, and I’d be happy to help you locate any information not covered in the text. I can be reached at the Department of Biology, Glendale Community College, 6000 W. Olive Avenue, Glendale, Arizona 85302. Feel free to e-mail me at: [emailprotected]. I wish you great success in your microbiology course. Welcome! Let’s now plunge into the wonderful and sometimes awesome world of microorganisms. —Dr. P. Web site: http://gccaz.edu/~jpommerv/
2/10/10 10:39 AM
xxx
CHAPTER XX
Title goes here
A Tribute to I. Edward Alcamo
Dr. Ignazio Edward Alcamo was a long-time Professor of Microbiology at the State University of New York at Farmingdale and the author of numerous textbooks, lab kits, and educational materials. He was the 2000 recipient of the Carski Foundation Distinguished Undergraduate Teaching Award, the highest honor bestowed upon microbiology educators by the American Society for Microbiology. Dr. Alcamo was educated at Iona College and St. John’s University and held a deep belief in the partnership between research scientists and allied health educators. He sought to teach the scientific basis of microbiology in an accessible manner as well as to inspire students with a sense of topical relevance. Michael Vinciguerra, Provost at the SUNY Farmingdale wrote, “In 1970, when I joined the
faculty as a chemistry professor, Ed’s reputation as an excellent biology educator was already well known.” A prolific author, Dr. Alcamo produced a broad array of publications including several learning guides and textbooks—Fundamentals of Microbiology, now in its ninth edition, and the recently published Microbes and Society, Second Edition. He also prepared the Encarta encyclopedia entry entitled “Procaryotes,” as well as The Microbiology Coloring Book, and Schaum’s Outline of Microbiology. His other books published within the past several years include AIDS: The Biological Basis, DNA Technology: The Awesome Skill, The Biology Coloring Workbook, and Anatomy and Physiology the Easy Way. In December 2002, after a six-month illness, Dr. Alcamo died of acute myeloid leukemia. Dr. Alcamo’s teaching career was dedicated to the proposition that emphasizing quality in education is central to turning back the tide of fear and uncertainty and enabling doctors to find cures for disease. In the early 1980s, when the early cases of an unknown acquired immunodeficiency syndrome were turning into a mysterious and intractable epidemic, Dr. Alcamo told this to his class: One afternoon, about 350 years ago, in the countryside near London, a clergyman happened to meet Plague. “Where are you going?” asked the clergyman. “To London,” responded Plague, “to kill a thousand.” They chatted for another few moments, and each went his separate way. Some time later, they chanced to meet again. The clergyman said, “I see you decided to show no mercy in London. I heard that 10,000 died there.” “Ah, yes,” Plague replied, “but I only killed a thousand. Fear killed the rest.”
xxx
62582_FMXX_i_xxx.pdf xxx
2/10/10 10:39 AM
PART
1
Foundations of Microbiology CHAPTER 1
Microbiology: Then and Now
CHAPTER 2
The Chemical Building Blocks of Life
CHAPTER 3
Concepts and Tools for Studying Microorganisms
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
CHAPTER 5
Microbial Growth and Nutrition
CHAPTER 6
Metabolism of Microorganisms
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
n 1676, a century before the Declaration of Independence, a Dutch merchant named Antony van Leeuwenhoek sent a noteworthy letter to the Royal Society of London. Writing in the vernacular of his home in the United Netherlands, Leeuwenhoek described how he used a simple microscope to observe vast populations of minute, living creatures. His reports opened a chapter of science that would evolve into the study of microscopic organisms and the discipline of microbiology. At that time, few people, including Leeuwenhoek, attached any practical significance to the microorganisms, but during the next three centuries, scientists would discover how profoundly these organisms influence the quality of our lives and the environment around us. Cells of Vibrio cholerae, transmitted to We begin our study of the microorganisms by exploring the grassroot develhumans in contaminated water and food, are the cause of cholera. opments that led to the establishment of microbiology as a science. These developments are surveyed in Chapter 1, where we focus on some of the individuals who stood at the forefront of discovery. Today we are in the midst of a third Golden Age of microbiology and our understanding of microorganisms continues to grow even as you read this book. Chapter 1, therefore, is an important introduction to microbiology then and now. Part 1 also contains a chapter on basic chemistry, inasmuch as microbial growth, metabolism, and diversity are grounded in the molecules and macromolecules these organisms contain and in the biological processes they undergo. The third chapter in Part 1 sets down some basic concepts and describes one of the major tools for studying microorganisms. Much as the alphabet applies to word development, in succeeding chapters we will formulate words into sentences and sentences into ideas as we survey the different groups of microorganisms and concentrate on their importance to public health and human welfare. Although most microorganisms are harmless—or even beneficial, some cause infectious disease. We will concentrate on the bacterial organisms in Chapter 4, where we survey their structural frameworks. In Chapter 5, we build on these frameworks by examining microbial growth patterns and nutritional requirements. Chapter 6 describes the metabolism of microbial cells, including those chemical reactions that produce energy and use energy. Part 1 concludes by considering the physical and chemical methods used to control microbial growth and metabolism (Chapter 7). 1
I
62582_CH01_001_034.pdf 1
2/4/10 2:03 PM
MICROBIOLOGY
PATHWAYS
Being a Scientist Science may not seem like the most glamorous profession. So, as you read many of the chapters in this text, you might wonder why many scientists have the good fortune to make key discoveries. At times, it might seem like it is the luck of the draw, but actually many scientists have a set of characteristics that put them on the trail to success. Robert S. Root-Bernstein, a physiology professor at Michigan State University, points out that many prominent scientists like to goof around, play games, and surround themselves with a type of chaos aimed at revealing the unexpected. Their labs may appear to be in disorder, but they know exactly where every tube or bottle belongs. Scientists also identify intimately with the organisms or creatures they study (it is said that Louis Pasteur actually dreamed about microorganisms), and this identification brings on an intuition—a “feeling for the organism.” In addition, there is the ability to recognize patterns that might bring a breakthrough. (Pasteur had studied art as a teenager and, therefore, he had an appreciation of patterns.) The geneticist and Nobel laureate Barbara McClintock once remarked, “I was just so interested in what I was doing I could hardly wait to get up in the morning and get at it. One of my friends, a geneticist, said I was a child, because only children can’t wait to get up in the morning to get at what they want to do.” Clearly, another characteristic of a scientist is having a child-like curiosity for the unknown. Professor Alcamo once received a letter from a student, asking why he became a microbiologist. “It was because I enjoyed my undergraduate microbiology course” he said, “and when I needed to select a graduate major, microbiology seemed like a good idea. I also think I had some of the characteristics described by Root-Bernstein: I loved to try out different projects; my corner of the world qualified as a disaster area; still I was a nut on organization, insisting that all the square pegs fit into the square holes.” For this author, science has been an extraordinary opportunity to discover and understand something never before known. Science is fun, yet challenging—and at times arduous, tedious, and frustrating. As with most of us, we will not make the headlines for a breakthrough discovery or find a cure for a disease. However, as scientists we all hope our research will contribute to a better understanding of a biological (or microbiological) phenomenon and will push back the frontiers of knowledge. For me, the opportunity of doing something I love far outweighs the difficulties along the way. Like any profession, being a scientist is not for everyone. Besides having a bachelor’s or higher degree in biology or microbiology, you should be well read in the sciences and capable of working as part of an interdisciplinary team. Of course, you should have good quantitative and communication skills, have an inquisitive mind, and be goal oriented. If all this sounds interesting, then maybe you fit the mold of a scientist. Why not consider pursuing a career in microbiology? Some possibilities are described in other Microbiology Pathways included in this book, but you should also visit with your instructor. Simply stop by the student union, buy two cups of coffee, and you are on your way.
2
62582_CH01_001_034.pdf 2
2/4/10 2:03 PM
1 Chapter Preview and Key Concepts
Microbiology: Then and Now In the field of observation, chance favors only the prepared mind. —Louis Pasteur (1822–1895)
Space. The final frontier! Really? The final frontier? There are an estimated 350 billion large galaxies and more than 1022 stars in the visible universe. However, the microbial universe consists of more than 1031 microorganisms scattered among an estimated 2 to 3 billion species. So, could understanding these organisms on Earth be as important as studying galaxies in space? In 1990, microbiologist Stephen Giovannoni of Oregon State University identified in the Sargasso Sea off the southeast United States what is perhaps the most abundant and successful organism on the planet. Called SAR11 (SAR for Sargasso), this bacterial organism, which now goes by the scientific name Pelagibacter ubique, has been identified across the oceans of the world. What makes it significant is its population size. Estimated to be 2.4 ⫻ 1028 cells, SAR11 alone accounts for 20% of all oceanic bacterial species—and 50% of the bacterial species in the surface waters of temperate oceans in the summer! SAR11’s success story suggests the organism must have a significant impact on the planet. Although such roles remain to be identified and understood, Giovannoni believes SAR11 is responsible for up to 10% of all nutrient recycling on the planet, influencing the cycling of carbon and even affecting climate change. Also sailing the Sargasso Sea near Bermuda is Craig Venter and his team at the J. Craig Venter Institute. Fresh from his success with the private sector effort to sequence the human genome, Venter’s team in 2004 reported the discovery of over 1,800 new microbial species in Sargasso seawater and from them isolated 1.2 million new gene sequences. Then between 2003 and 2007, Venter’s team sailed the world’s oceans— á la Charles Darwin—to sample seawater and evaluate the diversity of microorganisms in these waters. For the emerging field of marine molecular
1.11.1 TheThe Beginnings of Microbiology Beginnings of Microbiology 1. • 1. The discovery The discovery of microorganisms of microorganisms was was dependent observationsmade madewith withthe dependent on observations the microscope microscope. 2. • 2. The emergence The emergence of experimental of experimental science science provided a means to test long held provided a means to test long-held beliefs beliefs and resolve controversies and resolve controversies. 3. MicroInquiry 1: Experimentation and and MICROINQUIRY 1: Experimentation Scientific Inquiry Scientific Inquiry 1.21.2 Microorganisms andand Disease Transmission Microorganisms Disease Transmission 4. • 3. Early epidemiology Early epidemiology studies studies suggested how suggested howcould diseases could and be spread and diseases be spread be controlled. be4.controlled Resistance to a disease can come from 5. • exposure Resistance to a disease comeform of to and recovery fromcan a mild from (or exposure and recovery a very to similar) disease.from a mild form Classical of (or a very similar) disease 1.3 The Golden Age of Microbiology 1.3 The(1854–1914) Classical Golden Age of Microbiology 6. (1854-1914) 5. The germ theory was based on the 7. • observations The germ theory was based on the that different microorganisms observations that different microorganisms have distinctive and specific roles in nature. have distinctiveand andidentification specific roles of in the nature 6. Antisepsis cause of 8. • animalAntisepsis and identification the diseases reinforced the germoftheory. cause of animal diseases reinforced thetogerm 7. Koch’s postulates provided a way identify theory a specific microorganism as causing a 9. • specific Koch's postulates provided a way to infectious disease. identify a specific microorganism as stimulated causing a the 8. Laboratory science and teamwork specific infectious disease infectious disease agents. discovery of additional 10. • 9. Viruses Laboratory science and teamwork also can cause disease. stimulated the discovery of additional 10. Many beneficial bacterial species recycle infectious disease agents nutrients in the environment. 11. • Viruses also can cause disease 1.4 Studying Microorganisms 12. • Many beneficial bacteria recycle 11. The organisms and agents studied in nutrients in the environment microbiology represent diverse groups. 1.5 The Second Golden Age of Microbiology
(1943–1970) 12. Microorganisms and viruses can be used as model systems to study phenomena common to all life. 13. All microorganisms have a characteristic cell structure. 14. Antimicrobial chemicals can be effective in treating infectious diseases. 1.6 The Third Golden Age of Microbiology—Now 15. Infectious disease (natural and intentional) preoccupies much of microbiology. 16. Microbial ecology and evolution are dominant themes in modern microbiology.
3
62582_CH01_001_034.pdf 3
2/4/10 2:03 PM
4
CHAPTER 1
Genome: The complete set of genetic information in a cell, organism, or virus.
Biomass: The total weight of living organisms within a defined environment.
(A)
Microbiology: Then and Now
microbiology, Venter believes the sequencing of marine microorganisms will provide examples of novel metabolic pathways, identify species that use alternative energy sources, and perhaps help solve critical environmental problems, including climate change. Giovannoni and Venter are just two of many microbiologists trying to understand the role of microorganisms in the ocean’s ecosystems and their dominant role on this planet. But most of all, as “Being a Scientist” identified, Giovannoni’s and Venter’s primary goal is a voyage of discovery. Since only about 1% of the marine microorganisms have been identified, the microbial universe does represent an inner final frontier! The science of microbiology embraces a biologically diverse group of usually small life forms, encompassing primarily microorganisms (bacteria, fungi, algae, and protozoa) and viruses. Microorganisms (or microbes for short) are present in vast numbers in nearly every environment and habitat on Earth, not just the Sargasso Sea. They survive in Antarctica, on top of the tallest mountains, near thermal vents in the deepest parts of the oceans, in the deepest, darkest caves, and even miles down within the crust of the earth. In all, microbes make up more than half of Earth’s biomass.
The rich diversity of microorganisms is reflected in their profound influence on all aspects of life. Most are harmless or indeed beneficial. For example, they are essential to the recycling of nutrients that form the bodies of all organisms and sustaining all the metabolic cycles of life. They affect our climate and, as a group, produce about 50% of the oxygen gas we breathe and many other organisms use. They have influenced the evolution of life on Earth and actually have outpaced that of the more familiar plants and animals. Microorganisms survive in, or are purposely put in, many of the foods we eat. Microorganisms and viruses also are in the air we breathe and, at times, in the water we drink. Even closer to home, some 100 billion microorganisms colonize our skin and grow in our mouth, ears, nose, throat, and digestive tract ( FIGURE 1.1A ). Fortunately, the majority of these microbes, called our natural microbiota, are actually beneficial in helping us resist disease, and regulating development and nutrition. To be human, we must be “infected.” When most of us hear the word “bacterium” or “virus” though, we think infection or disease. Although such pathogens (disease-causing agents) are rare, they periodically have carved out great swatches of humanity as epidemics passed over the land. Some diseases—such as plague, cholera, and smallpox—have become known histori-
(B)
Microbes Are Key to Health and Illness. (A) Large numbers of bacteria are found on and in parts of the human body. On the tongue, most are harmless or even beneficial, while a few in our mouth can cause throat infections or lead to tooth decay. (Bar ⫽ 5 µm.) (B) During the 2009 pandemic of swine flu, people in affected areas such as Mexico wore masks in an attempt to avoid being infected with the virus. FIGURE 1.1
62582_CH01_001_034.pdf 4
2/4/10 2:03 PM
CHAPTER 1 Microbiology: Then and Now
cally as “slate-wipers,” a reference to the barren towns they left in their wake (MICROFOCUS 1.1). Even today, with antibiotics and vaccines to cure and prevent many infectious diseases, pathogens still bring concern and sometimes panic. Just think about the scares that AIDS, severe acquired respiratory syndrome (SARS), and most recently avian and swine influenzas have caused worldwide ( FIGURE 1.1B ). Still, if microbes were solely agents of disease, none of us would be here today. Rather “infection” is a way of life—we, all life, and our planet are dependent on microbes!
5
A major focus of this introductory chapter is to give you an introspective “first look” at microbiology—then and now. We will see how microbes were first discovered and how those that cause infectious disease preoccupied the minds and efforts of so many. Along the way, we continue to see how curiosity and scientific inquiry stimulated the quest for understanding. Although the study of microorganisms began in earnest with the work of Pasteur and Koch, they were not the first to report microorganisms. To begin our story, we reach back to the 1600s, where we encounter some equally inquisitive individuals.
1.1: History
The Tragedy of Eyam On the last Sunday in August (Plague Sunday), English pilgrims gather in the English countryside outside the village of Eyam, to pay homage to the townsfolk who in 1665–1666 gave their lives so that others might live. The pilgrims pause, bow their heads, and remember. In 1665, bubonic plague was raging in London. In late August, a traveling tailor arrived in the village of Eyam, about 140 miles north of London. Unknown to him, cloth arriving from London was infected with plague-carrying fleas. Within a few days, plague began to spread throughout Eyam and villagers debated whether they should flee north. The village rector realized that if Mompesson’s well at Eyam in Derbyshire Peak in Great Britain. This village is best known for being the “plague the villagers left, they could spread the plague to village” that chose to isolate itself when the plague other towns and villages. So, he made a passionate plea that they stay. After some deep soul-searching, was discovered there in August 1665, rather than let the infection spread. most townsfolk resolved to remain, even though they knew that meant many would die (see figure). The villagers marked off a circle of stones outside the village limits, and people from the adjacent towns brought food and supplies to the barrier, leaving them there for the self-quarantined villagers. Finally, in late 1666, the plague subsided. The rector recorded, “Now, blessed be God, all our fears are over for none have died of the plague since the eleventh of October and the pest-houses have long been empty. In the end, 260 of the town’s 350 residents succumbed to the plague. Some have suggested this selfsacrificing incident is commemorated in a familiar children’s nursery rhyme, one version of which is: A ring-a-ring of rosies A pocketful of posies A tishoo! A tishoo! We all fall down. The ring of rosies refers to the rose-shaped splotches on the chest and armpits of plague victims. Posies were tiny flowers the people hoped would sweeten the air and ward off the foul smell associated with the disease. “A tishoo!” refers to the fits of sneezing that accompanied the disease. The last line, the saddest of all, suggests the deaths that befell so many.
62582_CH01_001_034.pdf 5
2/4/10 2:03 PM
6
CHAPTER 1
Microbiology: Then and Now
1.1
Convex: Referring to a surface that curves outward.
The Beginnings of Microbiology
As the 17th century arrived, an observational revolution was about to begin: Dutch spectacle maker, Zacharias Janssen, was one of several individuals who discovered that if two convex lenses were put together, small objects would appear larger. Many individuals in Holland, England, and Italy further developed the two-lens system. In fact, it was in 1625 that the Italian Francesco Stelluti or Giovanni Faber used the term microscopio or “microscope” to refer to this new invention, which Galileo had suggested be called, “the small glass for spying things up close.” This combination of lenses, or “compound microscope,” would be the forerunner of the modern microscope. Microscopy—Discovery of the Very Small KEY CONCEPT
1.
The discovery of microorganisms was dependent on observations made with the microscope.
Robert Hooke, an English natural philosopher (the term scientist was not coined until 1833), was one of the most inventive and ingenious minds in the history of science. As the Curator of Experiments for the Royal Society of London, Hooke was the first to take advantage of the magnification abilities of the compound microscope. Although these microscopes only magnified about 25 times (25⫻), Hooke made detailed studies of many small living objects. In 1665, the Royal Society published his Micrographia, which contained descriptions of microscopes and stunning hand-drawn illustrations, including the anatomy of many insects and the structure of cork, where he used the word cella to describe the “great many little boxes” he observed and from which today we have the word “cell” ( FIGURE 1.2A ). Importantly, Hooke was the first person to describe and draw a microorganism, a mold he found growing on the sheepskin cover of a book ( FIGURE 1.2B ). Micrographia represents one of the most important books in science history because it awakened the learned and general population of Europe to the world of the very small, revolutionized the art of scientific investigation, and showed that the microscope was an important tool for unlocking the secrets of nature.
62582_CH01_001_034.pdf 6
Antony van Leeuwenhoek, a contemporary of Hooke, was a successful tradesman and dry goods dealer in Delft, Holland. As a cloth merchant, he used hand lenses to inspect the quality of cloth. After seeing Hooke’s Micrographia, and without much education, Leeuwenhoek became skilled at grinding single pieces of glass into fine lenses, which he placed between two silver or brass plates riveted together ( FIGURE 1.2C, D ). Using only a single lens, no larger than the head of a pin, his “simple microscope” could magnify objects more than 200⫻. The process of “observation” is an important skill for all scientists, including microbiologists— and Leeuwenhoek believed only sound observation and experimentation could be trusted—a requirement that remains a cornerstone of all science inquiry today. Leeuwenhoek chose to communicate his observations through letters to England’s Royal Society. In 1674, one letter described a sample of cloudy surface water from a marshy lake. Placing the sample before his lens, he described hundreds of what he thought were tiny, living animals (probably protozoa and algae), which he called animalcules. His curiosity aroused, Leeuwenhoek soon located even smaller animalcules in rainwater, which, reported in his 18th letter in 1676, likely represent the first description of bacteria. In 1683, he sent his 39th letter to the Royal Society in which he described and illustrated for the first time what almost certainly were swimming bacterial cells taken from dental plaque ( FIGURE 1.2E ). Leeuwenhoek wrote: “I then most always saw, with great wonder, that in the said matter there were many very little living animalcules, very prettily a-moving. The biggest sort . . . had a very strong and swift motion, and shot through the water (or spittle) like a pike does through the water. The second sort . . . oft-times spun round like a top . . . and these were far more in number.” Leeuwenhoek’s sketches were elegant in detail and clarity. Among the 165 letters sent to the Royal Society, he outlined structural details of protozoa
2/4/10 2:03 PM
1.1 The Beginnings of Microbiology
(A)
7
(B)
Lens Specimen mount Screw plate
Focusing screw
Elevating screw (C)
(D)
(E)
The First Observations and Drawings of Microorganisms. In his Micrographia, Robert Hooke included a drawing of thin shavings of cork that he saw with his microscope (A). He also described and drew the structure of a fungal mold (B). (C) Leeuwenhoek looking through one of his simple microscopes. (D) For viewing, he placed an object on the tip of the specimen mount, which was attached to a screw plate. An elevating screw moved the specimen up and down while the focusing screw pushed against the metal plate, moving the specimen toward or away from the lens. (E) Leeuwenhoek’s drawings of animalcules (bacterial cells) were included in a letter sent to the Royal Society in 1683. He found many of these organisms between his teeth and those of others. FIGURE 1.2
62582_CH01_001_034.pdf 7
2/4/10 2:03 PM
8
CHAPTER 1
Microbiology: Then and Now
and yeast, and described thread-like fungi and microscopic algae. Unfortunately, Leeuwenhoek invited no one to work with him, nor did he show anyone how he ground his lenses. Without these lenses, naturalists could not repeat his observations or verify his results, which are key components of scientific inquiry. Still, Leeuwenhoek’s observations on the presence and diversity of his “marvelous beasties” and Hooke’s Micrographia opened the door to a completely new world: the world of the microbe. CONCEPT AND REASONING CHECKS
1.1 If you were alive in Leeuwenhoek’s time, how would you explain the origin for the animalcules he found in materials such as lake water and dental plaque?
Experimentation—Can Life Generate Itself Spontaneously? KEY CONCEPT
2.
The emergence of experimental science provided a means to test long-held beliefs and resolve controversies.
In the early 1600s, most naturalists were “vitalists,” individuals who thought life depended on a mysterious “vital force” that pervaded all organisms. This force provided the basis for the doctrine of spontaneous generation, which suggested that organisms could arise from non-living matter; that is, where there was putrefaction and decay. Common people embraced the idea, for they too witnessed what appeared to be slime that produced toads and decomposing wheat grains that generated wormlike maggots. Regarding the latter, Leeuwenhoek suggested that maggots did not arise from wheat grains, but rather from tiny eggs laid in the grain that he could see with his microscope. Such divergent observations concerning spontaneous generation required a new form of investigation—“experimentation”— and a new generation of experimental naturalists arose. Noting Leeuwenhoek’s descriptions, the Italian naturalist Francesco Redi performed one of history’s first controlled biological experiments to see if maggots could arise from rotting meat. In 1668, he covered some jars of rotting meat with paper or gauze, thereby preventing the entry of flies, while leaving other jars uncovered. If flies were prevented from entering and landing
62582_CH01_001_034.pdf 8
on pieces of exposed meat, Redi predicted they could not lay their invisible eggs and no maggots would hatch ( FIGURE 1.3 ). Indeed, that is exactly what Redi observed and the idea that spontaneous generation could produce larger living creatures soon subsided. However, what about the mysterious and minute animalcules that appeared to straddle the boundary between the nonliving and living world? In 1748, a British clergyman and naturalist, John Needham, suggested that the spontaneous generation of animalcules resulted from a vital force that reorganized the decaying matter from more complex organisms. To prove this, Needham boiled several tubes of mutton broth and sealed the tubes with corks. After several days, Needham proclaimed that the “gravy swarm’d with life, with microscopical animals of most dimensions.” He was convinced that putrefaction could generate the vital force needed for spontaneous generation. Because experiments almost always are subject to varying interpretations, the Italian cleric and naturalist Lazzaro Spallanzani challenged Needham’s conclusions and suggested that the duration of heating might not have been long enough. In 1765, he repeated Needham’s experiments by boiling the tubes for longer periods. As control experiments, he left some tubes open to the air and stoppered others loosely with corks.
Open jar–maggots appear on meat
Covered jar– no maggots
FIGURE 1.3 Redi’s Experiments Refute Spontaneous Generation. Francesco Redi carried out one of the first biological experiments by placing a piece of meat in an open jar and another in a jar covered with gauze. Maggots arose only in the open jar because flies had access to the meat where they laid their eggs.
2/4/10 2:03 PM
1.2 Microorganisms and Disease Transmission
After two days, the open tubes were swarming with animalcules, but the stoppered ones had many fewer—and the sealed ones contained none. Spallanzani proclaimed, “the number of animalcula developed is proportional to the communication with the external air.” Needham and others countered that Spallanzani’s experiments had destroyed the vital force of life with excessive heating and excluded the air necessary for life. The controversy over spontaneous generation of animalcules continued into the mid-1800s. To solve the problem, a new experimental strategy would be needed. To get at a resolution, the French Academy of Sciences sponsored a contest for the best experiment to prove or disprove spontaneous generation. Louis Pasteur took up the challenge and, through an elegant series of experiments that were a varia-
1.2
9
tion of the methods of Needham and Spallanzani, discredited the idea in 1861. MICROINQUIRY 1 outlines the process of scientific inquiry and Pasteur’s winning experiments. Although Pasteur’s experiments generated considerable debate for several years, his exacting and carefully designed experiments marked the end of the long and tenacious clashes over spontaneous generation that had begun two centuries earlier. However, today there is another form of “spontaneous generation”—this time occurring in the laboratory (MICROFOCUS 1.2). CONCEPT AND REASONING CHECKS
1.2 Evaluate the role of experimentation as an important skill to the eventual rejection of spontaneous generation.
Microorganisms and Disease Transmission
In the 13th century, people knew diseases could be contagious, so quarantines were used to combat disease spread. In 1546, the Italian poet and naturalist Girolamo Fracostoro suggested that transmission could occur by direct human contact, from lifeless objects like clothing and eating utensils, or through the air. By the mid-1700s, the prevalent belief among naturalists and common people was that disease resulted from an altered chemical quality of the atmosphere or from tiny poisonous particles of decomposed matter in the air, an entity called miasma (the word malaria comes from mala aria, meaning “bad air”). To protect oneself from the black plague in Europe, for example, plague doctors often wore an elaborate costume they thought would protect them from the plague miasma ( FIGURE 1.4 ). However, as the 19th century unfolded, more scientists relied on keen observations and experimentation as a way of knowing and explaining divergent observations, including contagion and disease. Epidemiology—Understanding Disease Transmission
Epidemiology, as applied to infectious diseases, is the scientific study from which the source, cause, and mode of transmission of disease can be identified. The first scientific epidemiological studies, carried out by Ignaz Semmelweis and John Snow, were instrumental in suggesting how diseases were transmitted—and how simple measures could interrupt transmission.
Contagious: Capable of being transmitted between individuals through contact.
Leather hat (indicating a doctor) Mask with glass eyes and beak containing a “protective” perfumed sponge Stick to remove clothes of a plague victim Gloves Waxed gown Boots
KEY CONCEPT
3.
Early epidemiology studies suggested how diseases could be spread and be controlled.
62582_CH01_001_034.pdf 9
FIGURE 1.4 Dressed for Protection. This dress was thought to protect a plague doctor from the air (miasma) that caused the plague.
2/4/10 2:03 PM
10
CHAPTER 1
Microbiology: Then and Now
INQUIRY 1
Experimentation and Scientific Inquiry Science certainly is a body of knowledge as you can see from the thickness of this textbook! However, science also is a process—a way of learning. Often we accept and integrate into our understanding new information because it appears consistent with what we believe is true. But, are we confident our beliefs are always in line with what is actually true? To test or challenge current beliefs, scientists must present logical arguments supported by well-designed and carefully executed experiments. The Components of Scientific Inquiry There are many ways of finding out the answer to a problem. In science, scientific inquiry—or what has been called the “scientific method”—is the way problems are investigated. Let’s understand how scientific inquiry works by following the logic of the experiments Louis Pasteur published in 1861 to refute the idea of spontaneous generation. When studying a problem, the inquiry process usually begins with observations. For spontaneous generation, Pasteur’s earlier observations suggested that organisms do not appear from nonliving matter (see text discussion of the early observations supporting spontaneous generation). Next comes the question, which can be asked in many ways but usually as a “what,” “why,” or “how” question. For example, “What accounts for the generation of microorganisms in the beef broth?” From the question, various hypotheses are proposed that might answer the question. A hypothesis is a provisional but testable explanation for an observed phenomenon. In almost any scientific question, several hypotheses can be proposed to account for the same observation. However, previous work or observations usually bias which hypothesis looks most
62582_CH01_001_034.pdf 10
promising, and scientists then put their “pet hypothesis” to the test first. Pasteur’s previous work suggested that the purported examples of life arising spontaneously in meat or vegetable broths were simply cases of airborne microorganisms landing on a suitable substance and then multiplying in such profusion that they could be seen as a cloudy liquid. Pasteur’s Experiments Pasteur set up a series of experiments to test the hypothesis that “Life only arises from other life” (see facing page). Experiment 1A and 1B: Pasteur sterilized a meat broth in glass flasks by heating. He then either left the neck open to the air (A) or sealed the glass neck (B). Organisms only appeared (turned the broth cloudy) in the open flask. Experiment 2A and 2B: Pasteur sterilized a meat broth in swan-neck flasks (A), so named because their S-shaped necks resembled a swan’s neck. No organisms appeared, even after many days. However, if the neck was snapped off or the broth tipped to come in contact with the neck (B), organisms (cloudy broth) soon appeared. Analysis of Pasteur’s Experiments Let’s analyze the experiments. Pasteur had a preconceived notion of the truth and designed experiments to test his hypothesis. In his experiments, only one variable (an adjustable condition) changed. In experiment 1, the flask was open or sealed; in experiment 2, the neck was left intact, broken, or allowed to come in contact with the sterile broth. Pasteur kept all other factors the same; that is, the broth was the same in each experiment; it was heated the same length of time; and similar flasks were used. Thus, the experiments had rigorous
controls (the comparative condition). For example, in experiment 1, the control was the flask left open. Such controls are pivotal when explaining an experimental result. Pasteur’s finding that no life appeared in the sealed flask (experiment 2A) is interesting, but tells us very little by itself. We only learn something by comparing this to the broken neck (or tipped flask) where life quickly appeared. Also note that the idea of spontaneous generation could not be dismissed by just one experiment (see “His critics” on facing page). Pasteur’s experiments required the accumulation of many experiments, all of which pointed to the same conclusion. Hypothesis and Theory When does a hypothesis become a theory? The answer is that there is no set time or amount of evidence that specifies the change from hypothesis to theory. A theory is defined as a hypothesis that has been tested and shown to be correct every time by many separate investigators. So, at some point, sufficient evidence exists to say a hypothesis is now a theory. However, theories are not written in stone. They are open to further experimentation and so can be refuted. As a side note, today a theory often is used incorrectly in everyday speech and in the news media. In these cases, a theory is equated incorrectly with a hunch or belief—whether or not there is evidence to support it. In science, a theory is a general set of principles supported by large amounts of experimental evidence. Discussion Point Based on Pasteur’s experiments, could one still argue that spontaneous generation could occur? Explain.
2/4/10 2:04 PM
1.2 Microorganisms and Disease Transmission
11
Pasteur: The broth provides nutrients for the growth of unseen organisms in the air: life comes from other life.
Flask open to air
Time passes
(A)
Organisms appear
Sterile broth Flask sealed
Experiment 1
Each experiment begins with sterilized broth. Any living things the broth may have contained have been destroyed by heat.
His critics: The decomposed products in the broth give rise to life through spontaneous generation.
Pasteur: The heat has killed the microorganisms in the air. Time passes
(B)
His critics: Sealing the flask prevents entry of the "life force” needed for spontaneous generation. No organisms appear
Sterile broth
Swan-neck flask Air enters Time passes
Dust and microorganisms are trapped
(A)
Experiment 2
e m es Ti ass Sterile broth p
No organisms appear Flask tilted so broth enters neck Time passes
(B)
Organisms appear
Pasteur and the Spontaneous Generation Controversy. (1A) When a flask of sterilized broth is left open to the air, organisms appear. (1B) When a flask of sterilized broth is boiled and sealed, no living things appear. (2A) Broth sterilized in a swan-neck flask is left open to the air. The curvature of the neck traps dust particles and microorganisms, preventing them from reaching the broth. (2B) If the neck is snapped off to allow in air or the flask is tipped so broth enters the neck, organisms soon appear.
62582_CH01_001_034.pdf 11
Organisms appear
Pasteur: No life will appear in the flask because microorganisms will not be able to reach the broth. His critics: If the “life force” has free access to the flask, life will appear, given enough time. Many days later the intact flask is still free of any life. Pasteur has refuted the doctrine of spontaneous generation.
2/4/10 2:04 PM
12
CHAPTER 1
Microbiology: Then and Now
1.2: Biotechnology
Generating Life—Today (Part I) Spontaneous generation proposed that animalcules arose from the rearrangement of molecules coming from decayed organisms. Today, a different kind of rearrangement of molecules is occurring. The field, called synthetic biology, aims to rebuild or create new “life forms” (such as viruses or bacterial cells) from scratch by recombining molecules taken from different species. It is like fashioning a new car by taking various parts from a Ford, Chevy, and Toyota. In 2002, scientists at the State University of New York, Stony Brook, reconstructed a poliovirus by assembling separate poliovirus genes and proteins (see figure A). A year later, Craig Venter and his group assembled a bacteriophage—a virus that infects bacterial cells—from “off-the-shelf” biomolecules. Although many might not consider viruses to be “living” microbes, these constructions showed the feasibility of the idea. Then in 2004, researchers at Rockefeller University created small “vesicle bioreactors” that resembled crude biological cells (see figure B). The vesicle walls were made of egg white and the cell contents, stripped of any genetic material, were derived from a bacterial cell. The researchers then added genetic material and viral enzymes, which resulted in the cell making proteins, just as in a live cell. Importantly, these steps toward synthetic life have more uses than simply trying to build something like a bacterial cell from scratch. Design and construction of novel organisms or viruses can help solve problems that cannot be solved using traditional organisms; that is, synthetic biology represents the opportunity to expand evolution’s repertoire by designing cells or organisms that are better at doing certain jobs. Can we, for example, design bacterial cells that are better at degrading toxic wastes, providing alternative energy sources, or helping eliminate greenhouse gases from the atmosphere? These and many other positive benefits are envisioned as outcomes of synthetic biology. Part II of Generating Life appears in Chapter 2 (page 58).
(A)
(B)
(A) This image shows naturally occurring polioviruses, similar to those assembled from the individual parts. (Bar = 100 nm.) (B) A “vesicle bioreactor” that simulates a crude cell was assembled from various parts of several organisms. The green fluorescence is a protein produced by the genetic material added to the vesicle.
Ignaz Semmelweis was a Hungarian obstetrician who was shocked by the numbers of pregnant women in his hospital who were dying of puerperal fever (a type of blood poisoning also called childbed fever) during labor. He determined the disease was more prevalent in the ward handled by medi-
62582_CH01_001_034.pdf 12
cal students (29% deaths) than in the ward run by midwifery students (3% deaths). This comparative study suggested to Semmelweis that the mode of transmission must involve his medical students. He deduced that the source of contagion must be from cadavers on which the medical students previously
2/4/10 2:04 PM
1.2 Microorganisms and Disease Transmission
13
(A)
(B)
FIGURE 1.5 Blocking Disease Transmission. (A) Semmelweis (background, center-left) believed if hospital staff washed their hands, cases of puerperal fever would be reduced by preventing its spread from staff to patients. (B) John Snow (inset) produced a map plotting all the cholera cases in the London Soho district and observed a cluster near to the Broad Street pump (circle).
had been performing autopsies because midwifery students did not work on cadavers. So, in 1847, Semmelweis directed his staff to wash their hands in chlorine water before entering the maternity ward ( FIGURE 1.5A ). Deaths from childbed fever dropped, showing that disease spread could be interrupted. Unfortunately, few physicians initially heeded Semmelweis’ recommendations. In 1854, a cholera epidemic hit London, including the Soho district. With residents dying, English surgeon John Snow set out to discover the reason for cholera’s spread. He carried out one of the first thorough epidemiological studies by interviewing sick and healthy Londoners and plotting the location of each cholera case on a district map ( FIGURE 1.5B ). The results indicated most cholera cases clustered to a sewage-contaminated street pump from which local residents obtained their drinking water. Snow then instituted the first known example of a public health measure to interrupt disease transmission—he requested the parish Board of Guardians to remove the street
62582_CH01_001_034.pdf 13
pump handle! Again, disease spread was broken by a simple procedure. Snow went on to propose that cholera was not spread by a miasma but rather was waterborne. In fact, he asserted that “organized particles” caused cholera—an educated guess that proved to be correct even though the causative agent would not be identified for another 29 years. It is important to realize that although the miasma premise was incorrect, the fact that disease was associated with bad air and filth led to new hygiene measures, such as cleaning streets, laying new sewer lines in cities, and improving working conditions. These changes helped usher in the Sanitary Movement and create the infrastructure for the public health systems we have today (MICROFOCUS 1.3). CONCEPT AND REASONING CHECKS
1.3 Contrast the importance of the observations and studies by Semmelweis and Snow toward providing a better understanding of disease transmission.
2/4/10 2:04 PM
14
CHAPTER 1
Microbiology: Then and Now
1.3: Public Health
Epidemiology Today Today, we have a good grasp of disease transmission mechanisms, as we will discuss in Chapter 19. However, even with the advances in sanitation and public health, cholera remains a public health threat in parts of the developing world. In addition, almost 160 years after Semmelweis’ suggestions, a lack of hand washing by hospital staff, even in developed nations, remains a major mechanism for disease transmission (see figure). The simple process of washing one’s hands still could reduce substantially disease transmission among the public and in hospitals. Two of the most important epidemiological organizations today are the Centers for Disease Control and Prevention (CDC) in Atlanta, Georgia, and, on a global perspective, the World Health Organization (WHO) in Geneva, Switzerland. Both employ numerous epidemiologists, popularly called “disease detectives,” who, like Snow (but with more expertise), systematically gather information about disease outbreaks in an effort to discover how the disease agent is introduced, how it is spread in a community or population, and how the spread can be stopped. For example, in 2008 more than 1,400 people in 43 states developed similar gastrointestinal symptoms, which CDC investigators traced to bacterial contamination in imported jalapeño peppers. Warnings to not purchase or eat these peppers halted the outbreak and prevented further transmission. And to think, it all started with the seminal work of Semmelweis and Snow.
Variolation and Vaccination— Prevention of Infectious Disease KEY CONCEPT
4.
Resistance to a disease can come from exposure to and recovery from a mild form of (or a very similar) disease.
Besides the controversies over the mechanism of disease transmission, ways to prevent disease from occurring were being considered. In the 1700s, smallpox was prevalent throughout Europe. In England, for example, smallpox epidemics were so severe that one third of the children died before reaching the age of three. Many victims who recovered were blinded from corneal infections and most were left pockmarked. Significantly, survivors were protected from suffering the disease a second time. These observations suggested that if one contracted a weakened or mild form of the disease, perhaps such individuals would have lifelong resistance. In the 14th century, the Chinese knew that smallpox survivors would not get re-infected. Spreading from China to India and Africa, the practice of variolation developed, which involved blowing a ground smallpox powder into the individual’s nose. Europeans followed by inoculating
62582_CH01_001_034.pdf 14
dried smallpox scabs under the skin. Although some individuals did get smallpox, most contracted a mild form of the disease and, upon recovery, were resistant to future smallpox infections. As an English country surgeon, Edward Jenner learned that milkmaids who occasionally contracted cowpox, a disease of the udders of cows, would subsequently be protected from deadly smallpox. Jenner wondered if intentionally giving cowpox to people would protect them against smallpox and be an effective alternative to variolation. In 1796, he put the matter to the test. A dairy maid named Sarah Nelmes came to his office, the lesions of cowpox evident on her hand. Jenner took material from the lesions and scratched it into the skin of a boy named James Phipps ( FIGURE 1.6 ). The boy soon developed a slight fever, but recovered. Six weeks later Jenner inoculated young Phipps with material from a smallpox lesion. Within days, the boy developed a reaction at the site but failed to show any sign of smallpox. Jenner repeated his experiments with other children, including his own son. His therapeutic technique of vaccination (vacca = “cow”) worked in all cases and eliminated the risks associated with variolation. In 1798, he published a pamphlet on his work that generated considerable interest.
2/4/10 2:04 PM
1.3 The Classical Golden Age of Microbiology (1854–1914)
15
did. Again, hallmarks of a scientist—keen observational skills and insight—led to a therapeutic intervention against disease. CONCEPT AND REASONING CHECKS
1.4 Evaluate the effectiveness of variolation and vaccination as ways to produce disease resistance.
FIGURE 1.6 The First Vaccination against Smallpox. Edward Jenner performed the first vaccination against smallpox. On May 14, 1796, material from a cowpox lesion was scratched into the arm of eight-yearold James Phipps. The vaccination protected him from smallpox.
Prominent physicians confirmed his findings, and within a few years, Jenner’s method of vaccination spread through Europe and abroad. By 1801, some 100,000 people in England had been vaccinated. President Thomas Jefferson wrote to Jenner, “You have erased from the calendar of human afflictions one of its greatest. Yours is the comfortable reflection that mankind can never forget that you have lived.” A hundred years would pass before scientists discovered the milder cowpox virus was triggering a defensive mechanism by the body’s immune system against the deadlier smallpox virus. It is remarkable that without any knowledge of viruses or disease causation, Jenner accomplished what he
1.3
The Classical Golden Age of Microbiology (1854–1914)
Beginning around 1854, microbiology blossomed and continued until the advent of World War I. During these 60 years, many branches of microbiology were established, and the foundations were laid for the maturing process that has led to modern microbiology. We refer to this period as the first, or classical, Golden Age of microbiology. Louis Pasteur Proposes That Germs Cause Infectious Disease KEY CONCEPT
5.
The germ theory was based on the observations that different microorganisms have distinctive and specific roles in nature.
62582_CH01_001_034.pdf 15
The Stage Is Set During the early years of the 1800s, several events occurred that helped set the stage for the coming “germ revolution.” In the 1830s, advances were made in microscope optics that allowed better resolution of objects. This resulted in improved and more widespread observations of tiny living organisms, many of which resembled short sticks. In fact, in 1838 the German biologist Christian Ehrenberg suggested these “rod-like” looking organisms be called bacteria (bakterion = “little rod”). The Swiss physician Jacob Henle reported in 1840 that living organisms could cause disease. This was strengthened in 1854 by Filippo Pacini’s discovery of rod-shaped cholera bacteria in stool samples from cholera patients. Still, scientists debated whether bacterial organisms could cause disease because such living organisms sometimes were found in healthy people. Therefore, how could these bacterial cells possibly cause disease? To understand clearly the nature of infectious disease, a new conception of disease had to emerge. In doing so, it would be necessary to demonstrate that a specific bacterial species was associated with a specific infectious disease. This would require some very insightful work, guided by Louis Pasteur in France and Robert Koch in Germany.
Born in 1822 in Dôle, France, Louis Pasteur studied chemistry at the École Normale Supérieure in Paris and, in 1854, was appointed Professor of Chemistry at the University of Lille in northern France ( FIGURE 1.7A ). Pasteur was among the first scientists who believed that problems in science could be solved in the laboratory with the results having practical applications. Always one to tackle big problems, Pasteur soon set out to understand the process of fermentation and the other processes that can accompany it. The prevailing theory held that fermentation resulted from the chemical breakdown of grape juice. No living agent seemed to be involved. However, Pasteur’s microscope observations
Fermentation: A splitting of sugar molecules into simpler products, including alcohol, acid, and gas (CO2).
2/4/10 2:04 PM
16
CHAPTER 1
Microbiology: Then and Now
(A)
Pasteur also demonstrated that wines, beers, and vinegar each contained different and specific types of microorganisms. For example, in studying a local problem of wine souring, he observed that only soured wines contained populations of bacterial cells. These cells must have contaminated a batch of yeast and produced the acids that caused the souring. In addition, Pasteur discovered the process occurred in the absence of oxygen gas ( FIGURE 1.7B ). Pasteur recommended a practical solution for the “wine disease” problem: heat the wine to 55°C after fermentation but before aging. His controlled heating technique, known as pasteurization, soon was applied to other products, especially milk. Pasteur’s experiments demonstrated that yeast and bacterial cells are tiny, living factories in which important chemical changes take place. Therefore, if microorganisms represented agents of change, perhaps human infections could be caused by those microorganisms that cause disease—germs. In 1857, Pasteur published a short paper on wine souring by bacterial cells in which he implied that germs (bacteria) also could be related to human illness. Five years later, after he disproved spontaneous generation, he formulated the germ theory of disease, which holds that some microorganisms are responsible for infectious disease. CONCEPT AND REASONING CHECKS
1.5 Describe how wine fermentation and souring led Pasteur to propose the germ theory.
(B)
Louis Pasteur and Fermentation Bacteria. (A) Louis Pasteur as a 46-year-old professor of chemistry at the University of Paris. (B) The following is part of a description of the living bacterial cells he observed. “A most beautiful object: vibrios all in motion, advancing or undulating. They have grown considerably in bulk and length since the 11th; many of them are joined together in long sinuous chains . . . ” Pasteur concluded these bacterial cells can live without air or free oxygen; in fact, “the presence of gaseous oxygen operates prejudicially against the movements and activity of those vibrios.” FIGURE 1.7
consistently revealed large numbers of tiny yeast cells in the juice that were overlooked by other scientists. When he mixed yeast in a sugar-water solution, the yeast grew and the quantity of yeast increased. Yeast must be living organisms and one of the living “ferments” responsible for the fermentation process.
62582_CH01_001_034.pdf 16
Pasteur’s Work Stimulates Disease Control and Reinforces Disease Causation KEY CONCEPT
6.
Antisepsis and identification of the cause of animal diseases reinforced the germ theory.
Pasteur had reasoned that if microorganisms were acquired from the environment, their spread could be controlled and the chain of disease transmission broken. Joseph Lister was Professor of Surgery at Glasgow Royal Infirmary in Scotland, where more than half his amputation patients died— not from the surgery—but rather from postoperative infections. Hearing of Pasteur’s germ theory, Lister argued that these surgical infections resulted
2/4/10 2:04 PM
1.3 The Classical Golden Age of Microbiology (1854–1914)
from living organisms in the air. Knowing that carbolic acid had been effective on sewage control, in 1865 he used a carbolic acid spray in surgery and on surgical wounds ( FIGURE 1.8 ). The result was spectacular—the wounds healed without infection. His technique would soon not only revolutionize medicine and the practice of surgery, but also lead to the practice of antisepsis, the use of chemical methods for disinfection of external living surfaces, such as the skin (Chapter 7). Once again, practical applications from the laboratory triumphed. In an effort to familiarize himself with biological problems, Pasteur turned his attention to pébrine, a disease of silkworms. By 1870, he identified a protozoan as the infectious agent in silkworms and the mulberry leaves fed to the worms. By separating the healthy silkworms from the diseased silkworms and their food, he managed to quell the spread of disease. The identification of the protozoan was crucial to supporting the germ theory and Pasteur would never again doubt the ability of microorganisms to cause infectious disease. Now infectious disease would be his only interest. In 1865, cholera engulfed Paris, killing 200 people a day. Pasteur tried to capture the responsible pathogen by filtering the hospital air and trapping the bacterial cells in cotton. Unfortunately, Pasteur could not grow or separate one bacterial species apart from the others because his broth cultures allowed the organisms to mix freely. Although Pasteur demonstrated that bacterial inoculations made animals ill, he could not pinpoint an exact cause. To completely validate the germ theory, what was missing was the ability to isolate a specific bacterial species from a diseased individual and demonstrate the isolated organism caused the same disease. CONCEPT AND REASONING CHECKS
1.6 Assess Lister’s antisepsis procedures and Pasteur’s work on pébrine toward supporting the germ theory.
Robert Koch Formalizes Standards to Identify Germs with Infectious Disease KEY CONCEPT
7.
Koch’s postulates provided a way to identify a specific microorganism as causing a specific infectious disease.
62582_CH01_001_034.pdf 17
17
FIGURE 1.8 Lister and Antisepsis. By 1870, Joseph Lister (inset) and his students were using a carbolic acid spray in surgery and on surgical wounds to prevent postoperative infections.
Robert Koch ( FIGURE 1.9A ) was a German country doctor who was well aware of anthrax, a deadly disease that periodically ravaged cattle and sheep, and could cause disease in humans. In 1875, Koch injected mice with the blood from such diseased sheep and cattle. He then performed meticulous autopsies and noted the same symptoms in the mice that had appeared in the sheep and cattle. Next, he isolated from the blood a few rod-shaped bacterial cells (called bacilli) and grew them in the aqueous humor of an ox’s eye. With his microscope, Koch watched for hours as the bacilli multiplied, formed tangled threads, and finally reverted to highly resistant spores. He then took several spores on a sliver of wood and injected them into healthy mice. The symptoms of anthrax appeared within hours. Koch autopsied the animals and found their blood swarming with anthrax bacilli. He reisolated the bacilli in fresh aqueous humor. The cycle was now complete. The bacilli definitely were the causative agent of anthrax. When Koch presented his work, scientists were astonished. Here was the verification of the germ theory that had eluded Pasteur. Koch’s procedures became known as Koch’s postulates and were quickly adopted as the formalized standards for relating a specific organism to a specific disease ( FIGURE 1.9B ).
Broth: A liquid containing nutrients for microbial growth.
2/4/10 2:04 PM
18
CHAPTER 1
Microbiology: Then and Now
Postulate 1 The same microorganisms are present in every case of the disease.
Anthrax bacilli
Spore
Postulate 2 The microorganisms are isolated from the tissues of a dead animal, and a pure culture is prepared. Postulate 4 The identical microorganisms are isolated and recultivated from the tissue specimens of the experimental animal.
Postulate 3 Microorganisms from the pure culture are inoculated into a healthy, susceptible animal. The disease is reproduced.
(A)
(B)
A Demonstration of Koch’s Postulates. Robert Koch (A) developed what became known as Koch’s postulates (B) that were used to relate a single microorganism to a single disease. The insert (in the upper right) is a photo of the rod-shaped anthrax bacteria. Many rods are swollen with spores (white ovals). FIGURE 1.9
Agar: A complex polysaccharide derived from marine algae.
62582_CH01_001_034.pdf 18
Koch Develops Pure Culture Techniques In 1877, Koch developed methods for staining bacterial cells and preparing permanent visual records. Then, in 1880, Koch accepted an appointment to the Imperial Health Office, and while there, he observed a slice of potato on which small masses of bacterial cells, which he termed colonies, were growing and multiplying. So, Koch tried adding gelatin to his broth to prepare a solid culture surface. He then inoculated bacterial cells on the surface and set the dish aside to incubate. Within 24 hours, visible colonies would be growing on the surface. By 1884, agar replaced gelatin as the preferred solidifying agent (MICROFOCUS 1.4). Koch now could inoculate laboratory animals with a pure culture of bacterial cells and be certain that only one bacterial species was involved.
CONCEPT AND REASONING CHECKS
1.7 Why was pure culture crucial to Koch’s postulates and the germ theory?
Competition Fuels the Study of Infectious Disease KEY CONCEPT
8.
Laboratory science and teamwork stimulated the discovery of additional infectious disease agents.
The period of the 1860s took a toll on Pasteur. His father and three of his five children died, and a stroke in 1868 left him partially paralyzed in his left arm and leg. However, he soon wrote that the work on silkworms was “a good preparation for the investigations that we are about to undertake.” Research studies conducted in a laboratory were becoming the normal method of work.
2/4/10 2:04 PM
1.3 The Classical Golden Age of Microbiology (1854–1914)
19
1.4: History
Jams, Jellies, and Microorganisms One of the major developments in microbiology was Robert Koch’s use of a solid culture surface on which bacterial colonies would grow. He accomplished this by solidifying beef broth with gelatin. When inoculated onto the surface of the nutritious medium, bacterial cells grew vigorously at room temperature and produced discrete, visible colonies. On occasion, however, Koch was dismayed to find that the gelatin turned to liquid. It appeared that certain bacterial species were producing a chemical substance to digest the gelatin. Moreover, gelatin liquefied at the warm incubator temperatures commonly used to cultivate certain bacterial species. Walther Hesse, an associate of Koch’s, mentioned the problem to his wife and laboratory assistant, Fanny Eilshemius Hesse. She had a possible solution. For years, she had been using a seaweedderived powder called agar (pronounced ah’gar) to solidify her jams and jellies. Agar was valuable because it mixed easily with most liquids and once gelled, it did not liquefy, even at the warm incubator Fanny Hesse. temperatures. In 1880, Hesse was sufficiently impressed to recommend agar to Koch. Soon Koch was using it routinely to grow bacterial species, and in 1884 he first mentioned agar in his paper on the isolation of the bacterial organism responsible for tuberculosis. It is noteworthy that Fanny Hesse may have been among the first Americans (she was originally from New Jersey) to make a significant contribution to microbiology. Another point of interest: The common petri dish (plate) also was invented about this time (1887) by Julius Petri, another of Koch’s assistants.
Pasteur’s lab and coworkers now were primarily interested in the mechanism of infection and immunity, and the practical applications that could be derived, while Koch’s lab focused on procedural methods such as isolation, cultivation, and identification of specific pathogens. A competition arose that would last into the next century. The Pasteur Lab. Pasteur continued work with anthrax and found that the bacilli were “filterable.” When passed through a filter, only the clear fluid from the broth passed through; it could not trigger disease in rabbits. The anthrax bacteria were trapped on the filter and just a small drop was sufficient to kill the animals. These and other experiments further validated the germ theory. One of Pasteur’s more remarkable discoveries was made in 1881. For months, he and his coworker Charles Chamberland had been working on ways to attenuate the bacterial cells of chicken cholera using heat, different growth conditions,
62582_CH01_001_034.pdf 19
successive inoculations in animals, and virtually anything that might damage the cells. Finally, they developed a weak strain by suspending the bacterial cells in a mildly acidic medium and allowing the culture to remain undisturbed for a long period. When the bacterial cells were inoculated into chickens and later followed by a dose of lethal pathogen, the animals did not develop cholera. This attenuation principle is the basis for many vaccines today. Pasteur also applied the principle to anthrax in 1881 and, in a public demonstration, found he could protect sheep against this disease as well ( FIGURE 1.10 ). Pasteur reached the zenith of his career in 1885 when he successfully immunized a young boy against the dreaded disease rabies. Although he never could culture the causative agent of rabies, Pasteur could cultivate it in spinal cord tissue of experimental animals. After his coworker Émile Roux tested the vaccine with success in
Attenuate: To reduce or weaken.
2/4/10 2:04 PM
20
CHAPTER 1
Microbiology: Then and Now
on a spectacular career. Still, his TB studies were significant and ultimately gained him the 1905 Nobel Prize in Physiology or Medicine. He died of a stroke in 1910. The germ theory set a new course for studying and treating infectious disease. The studies carried out by Pasteur and Koch made the discipline of bacteriology, the study of bacterial organisms, a well-respected field of study. In fact, a new generation of international scientists, including several from the Pasteur and Koch labs, stepped in to expand the work on infectious disease ( TABLE 1.1 ). CONCEPT AND REASONING CHECKS
1.8 Assess the importance of the science laboratory and teamwork to the increasing identification of pathogenic bacteria.
The Anthrax Bacillus. A photomicrograph of the anthrax bacillus taken by Louis Pasteur in 1885. Pasteur circled the bacilli (the tiny rods) in tissue and annotated the photograph, “the parasite of Charbonneuse.” (“Charbonneuse” is the French equivalent of anthrax.) FIGURE 1.10
dogs—all immunized animals survived a rabies exposure—the ultimate test arrived. A 9-year-old boy, Joseph Meister, had been bitten and mauled by a rabid dog. Pasteur gave the boy the untested (in humans) rabies vaccine (MICROFOCUS 1.5). The treatment lasted 10 days and the boy recovered and remained healthy. The rabies vaccine was a triumph because it fulfilled his dream of applying the principles of science to practical problems. Such successes helped establish the Pasteur Institute in Paris, one of the world’s foremost scientific establishments. Pasteur presided over the Institute until his death in 1895. The Koch Lab. Koch also reached the height of his influence in the 1880s. In 1882, he identified and grew the bacterium responsible for tuberculosis (TB) in pure culture. In 1883, he interrupted his work on TB to lead a group of German scientists studying cholera in Egypt and India. In both countries, Koch isolated a comma-shaped bacillus and confirmed John Snow’s suspicion that water is the key to transmission. In 1891, as director of Berlin’s Institute for Infectious Diseases, Koch returned to his work on TB. Unfortunately, his supposed cure was a total failure—the only tarnish
62582_CH01_001_034.pdf 20
Other Global Pioneers Contribute to New Disciplines in Microbiology KEY CONCEPTS
9. Viruses also can cause disease. 10. Many beneficial bacterial species recycle nutrients in the environment.
Although the list of identified microbes was growing, the agents responsible for diseases such as measles, mumps, smallpox, and yellow fever continued to elude identification. In 1892, a Russian scientist, Dimitri Ivanowsky, used a filter developed by Pasteur’s group to trap what he thought were bacterial cells responsible for tobacco mosaic disease, which produces mottled and stunted tobacco leaves. Surprisingly, Ivanowsky discovered that when he applied the liquid that passed through the filter to healthy tobacco plants, the leaves became mottled and stunted. Ivanowsky assumed bacterial cells somehow had slipped through the filter. Unaware of Ivanowsky’s work, Martinus Beijerinck, a Dutch investigator, did similar experiments in 1899 and suggested tobacco mosaic disease was a “contagious, living liquid” that acted like a poison or virus (virus = “poison”). In 1898, the first “filterable virus” responsible for an animal disease—hoof-and-mouth disease—was discovered, and in 1901 American Walter Reed concluded that the agent responsible for yellow fever in humans also was a filterable agent. With these discoveries, the discipline of virology, the study of viruses, was launched.
2/4/10 2:04 PM
1.3 The Classical Golden Age of Microbiology (1854–1914)
21
TABLE
1.1
Other International Scientists and Their Accomplishments during the Classical Golden Age of Microbiology
Investigator (Year)
Country
Accomplishment
Otto Obermeier (1868) Ferdinand Cohn (1872)
Germany Germany
Gerhard Hansen (1873) Albert Neisser (1879) *Charles Laveran (1880) Hans Christian Gram (1884) Pasteur Lab Elie Metchnikoff (1884) Emile Roux and Alexandre Yersin (1888) Koch Lab Friedrich Löeffler (1883) Georg Gaffky (1884) *Paul Ehrlich (1885)
Norway Germany France Denmark
Observed bacterial cells in relapsing fever patients Established bacteriology as a science; produced the first bacterial taxonomy scheme Observed bacterial cells in leprosy patients Discovered the bacterium that causes gonorrhea Discovered that malaria is caused by a protozoan Introduced staining system to identify bacterial cells
Ukraine France
Described phagocytosis Identified the diphtheria toxin
Germany Germany Germany
Shibasaburo Kitasato (1889) Emil von Behring (1890) Theodore Escherich (1885)
Japan Germany Germany
Daniel E. Salmon (1886) Richard Pfeiffer (1892) William Welch and George Nuttall (1892) Theobald Smith and F. Kilbourne (1893) S. Kitasato and A. Yersin (1894) Emile van Ermengem (1896) *Ronald Ross (1898) Kiyoshi Shiga (1898) Walter Reed (1901) David Bruce (1903) Fritz Schaudinn and Erich Hoffman (1903) *Jules Bordet and Octave Gengou (1906) Albert Calmette and Camille Guèrin (1906) Howard Ricketts (1906)
United States Germany United States
Isolated the diphtheria bacillus Cultivated the typhoid bacillus Suggested some dyes might control bacterial infections Isolated the tetanus bacillus Developed the diphtheria antitoxin Described the bacterium responsible for infant diarrhea Developed the first heat-killed vaccine Identified a bacterial cause of meningitis Isolated the gas gangrene bacillus
United States
Proved that ticks transmit Texas cattle fever
Japan France Belgium Great Britain Japan United States Great Britain Germany
Independently discovered the bacterium causing plague Identified the bacterium causing botulism Showed mosquitoes transmit malaria to birds Isolated a cause of bacterial dysentery Studied mosquito transmission of yellow fever Proved that tsetse flies transmit sleeping sickness Discovered the bacterium responsible for syphilis
France
Cultivated the pertussis bacillus
France
Developed immunization process for tuberculosis
United States
Proved that ticks transmit Rocky Mountain spotted fever Proved that lice transmit typhus fever Discovered the bacterial cause of tularemia
Charles Nicolle (1909) George McCoy and Charles Chapin (1911)
France United States
*Nobel Prize winners in Physiology or Medicine.
62582_CH01_001_034.pdf 21
2/4/10 2:04 PM
22
CHAPTER 1
Microbiology: Then and Now
1.5: History
The Private Pasteur The notebooks of Louis Pasteur had been an enduring mystery of science ever since the scientist himself requested his family not to show them to anyone. But in 1964, Pasteur’s last surviving grandson donated the notebooks to the National Library in Paris, and after soul-searching for a decade, the directors made them available to a select group of scholars. Among the group was Gerald Geison of Princeton University. What Geison found stripped away part of the veneration conferred on Pasteur and showed another side to his work. In 1881, Pasteur conducted a trial of his new anthrax vaccine by inoculating half a flock of animals with the vaccine, then exposing the entire flock to the disease. When the vaccinated half survived, Pasteur was showered with accolades. However, Pasteur’s notebooks, according to Geison, reveal that he had prepared the vaccine not by his own method, but by a competitor’s. (Coincidentally, the competitor suffered a nervous breakdown and died a month after the experiment ended.) Pasteur also apparently sidestepped established protocols when he inoculated two boys with a rabies vaccine before it was tested on animals. Fortunately, the two boys survived, possibly because they were not actually infected or because the vaccine was, indeed, safe and effective. Nevertheless, the untested treatment should not have been used, says Geison. His book, The Private Science of Louis Pasteur (Princeton University Press, 1995) places the scientist in a more realistic light and shows that today’s pressures to succeed in research are little different than they were more than a century ago.
While many scientists were advancing medical microbiology, others devoted their research to the environmental importance of microorganisms. The Russian scientist Sergei Winogradsky discovered bacterial cells that metabolized sulfur and developed the concept of nitrogen fixation, where bacterial cells convert nitrogen gas (N2) into ammonia (NH3). Beijerinck was the first to obtain pure cultures of microorganisms from the soil and water by enriching the growth conditions. Together with Winogradsky, he developed many of the laboratory materials essential to the study of environmental microbiology, while adding to the understanding of the essential roles microorganisms play in the environment.
1.4
CONCEPT AND REASONING CHECKS
1.9 Describe how viruses were discovered as diseasecausing agents. 1.10 Judge the significance of the work pioneered by Winogradsky and Beijerinck.
Studying Microorganisms
Besides bacteriology and virology, other disciplines also were developing at the beginning of the 20th century. This included mycology, the study of fungi; protozoology, the study of the protozoa; and phycology, the study of algae ( FIGURE 1.11 ). The applications of microbiological knowledge also were important to the development of epidemiology, infection control, and immunology, which is the study of bodily defenses against microorganisms and other agents.
62582_CH01_001_034.pdf 22
Today, along with Giovannoni and Venter, many microbiologists continue to search for and understand the roles of microorganisms. In fact, with less than 2% of all microorganisms on Earth having been identified and many fewer cultured, there is still a lot to be discovered in the microbial world!
The Spectrum of Microorganisms and Viruses Is Diverse KEY CONCEPT
11. The organisms and agents studied in microbiology represent diverse groups.
By the end of the classical Golden Age of microbiology, the diversity of microbes included more than just bacterial species. Let’s briefly survey what we know about these groups today.
2/4/10 2:04 PM
1.4 Studying Microorganisms
23
MICROBIOLOGY includes the disciplines of
Bacteriology
Virology
Mycology
Parasitology
Protozoology
Phycology
FIGURE 1.11 Microbiology Disciplines by Organism or Agent Studied. This simple concept map shows the relationship between microbiology and the organisms or agents that make up the various disciplines. Parasitology is the study of animal parasites. Some of these parasites cause disease in humans, which is why parasitology is included with the other disciplines of microbiology.
Bacteria. It is estimated that there may be more than 10 million bacterial species. Most are very small, single-celled (unicellular) organisms (although some form filaments, and many associate in a bacterial mass called a “biofilm”). The cells may be spherical, spiral, or rod-shaped ( FIGURE 1.12A ), and they lack the cell nucleus and most of the typical cellular compartments typical of other microbes and multicellular organisms. Some bacterial species, like the cyanobacteria, carry out photosynthesis ( FIGURE 1.12B ). Besides the disease-causing members, some are responsible for food spoilage while others are useful in the food industry. Many bacterial species, along with several fungi, are decomposers, organisms that recycle nutrients from dead organisms. Archaea. Based on recent biochemical and molecular studies, many bacterial species have been reassigned into another group, called the Archaea. Many archaeal species can be found in environments that are extremely hot (such as the Yellowstone hot springs), extremely salty (such as the Dead Sea), or in areas of extremely low pH (such as acid mine drainage). Adaptations to these environments are partly why they have been collected into their own unique group. Most bacterial and archaeal species absorb their food from the environment. Viruses. Although not correctly labeled as microorganisms, currently there are more than 3,600 known types of viruses. Viruses are not cellular and cannot be grown in pure culture. They have a core of nucleic acid (DNA or RNA) surrounded by a protein coat. Among the features
62582_CH01_001_034.pdf 23
used to identify viruses are morphology (size, shape), genetic material (RNA, DNA), and biological properties (organism or tissue infected). Viruses infect organisms for one reason only—to replicate. Viruses in the air or water, for example, cannot replicate because they need the metabolic machinery inside a cell. Of the known viruses, only a small percentage causes disease in humans. Polio, the flu, measles, AIDS, and smallpox are examples ( FIGURE 1.12C ). The other group of microbes has a cell nucleus and a variety of internal cellular compartments. Many of the organisms are familiar to us. Fungi. The fungi include the unicellular yeasts and the multicellular mushrooms and molds ( FIGURE 1.12D ). About 100,000 species of fungi have been described; however, there may be as many as 1.5 million species in nature. Most fungi grow best in warm, moist places and secrete digestive enzymes that break down nutrients into smaller bits that can be absorbed easily. Fungi thus live in their own food supply. If that food supply is a human, disease may result. Some fungi provide useful products including antibiotics, such as penicillin. Others are used in the food industry to impart distinctive flavors in foods such as Roquefort cheeses. Together with many bacterial species, numerous molds play a major role as decomposers. Protista. The protista consist of single-celled protozoa and algae. Some are free living while others live in association with plants or animals. Locomotion may be achieved by flagella or cilia, or by a crawling movement.
2/4/10 2:04 PM
24
CHAPTER 1
Microbiology: Then and Now
(A)
(B)
(C)
(D)
(E)
(F)
Groups of Microorganisms. (A) A bacterial smear showing the rod shaped cells of Bacillus cereus (stained blue), a normal inhabitant of the soil. (Bar = 10 µm.) (B) Filamentous strands of Anabaena, a cyanobacterium that carries out photosynthesis. (Bar = 100 µm.) (C) Smallpox viruses. (Bar = 100 nm.) (D) A typical blue-gray Penicillium mold growing on a loaf of bread. (E) The colonial green alga, Volvox. (Bar = 300 µm.) (F) The ribbon-like cells of the protozoan Trypanosoma, the causative agent of African sleeping sickness. (Bar = 10 µm.) FIGURE 1.12
Different protista obtain nutrients in different ways. Protozoa either absorb nutrients from the surrounding environment or ingest algae and bacterial cells. The unicellular, colonial, or filamentous algae carry out photosynthesis ( FIGURE 1.12E ). Most protozoa are helpful in that they are important in lower levels of the food chain, providing food for living organisms such as snails, clams,
62582_CH01_001_034.pdf 24
and sponges. Some protozoa are capable of causing diseases in animals, including humans; these include malaria, several types of diarrhea, and sleeping sickness ( FIGURE 1.12F ). CONCEPT AND REASONING CHECKS
1.11 Why have microorganisms been separated into a variety of different groups?
2/4/10 2:04 PM
1.5 The Second Golden Age of Microbiology (1943–1970)
1.5
The Second Golden Age of Microbiology (1943–1970)
The 1940s brought the birth of molecular genetics to biology. Many biologists focused on understanding the genetics of organisms, including the nature of the genetic material and its regulation. Molecular Biology Relies on Microorganisms KEY CONCEPT
12. Microorganisms and viruses can be used as model systems to study phenomena common to all life.
In 1943, the Italian-born microbiologist Salvador Luria and the German physicist Max Dulbrück carried out a series of experiments with bacterial cells and viruses that marked the second Golden Age of microbiology. They used a common gutinhabiting bacterium, Escherichia coli, to address a basic question regarding evolutionary biology: Do mutations occur spontaneously or does the environment induce them? Luria and Dulbrück showed that bacterial cells could develop spontaneous mutations that generate resistance to viral infection. Besides the significance of their findings to microbial genetics, the use of E. coli as a microbial model system showed to other researchers that microorganisms could be used to study general principles of biology. Biologists were quick to jump on the “microbial bandwagon.” Experiments carried out by Americans George Beadle and Edward Tatum in the 1940s ushered in the field of molecular biology by using the fungus Neurospora to show that “one gene codes for one enzyme.” Oswald Avery, Colin MacLeod, and Maclyn McCarty, working with the bacterial species Streptococcus pneumoniae, suggested in 1944 that deoxyribonucleic acid (DNA) is the genetic material in cells. In 1953, American biochemist Alfred Hershey and geneticist Martha Chase, using a virus that infects bacterial cells, provided irrefutable evidence that DNA is the substance of the genetic material. These experiments and discoveries, which will be discussed in more detail in Chapter 8, placed microbiology in the middle of the molecular biology revolution.
Two Types of Cellular Organization Are Realized KEY CONCEPT
13. All microorganisms have a characteristic cell structure.
The small size of bacterial cells hindered scientists’ abilities to confirm that these cells were “cellular” in organization. In the 1940s and 1950s, a new type of microscope—the electron microscope— was being developed that could magnify objects and cells thousands of times better than typical light microscopes. With the electron microscope, for the first time bacterial cells were seen as being cellular like all other microbes, plants, and animals. However, studies showed that they were organized in a fundamentally different way from other organisms. It was known that animal and plant cells contained a cell nucleus that houses the genetic instructions in the form of chromosomes and was separated physically from other cell structures by a membrane envelope ( FIGURE 1.13A ). This type of cellular organization is called eukaryotic (eu = “true”; karyon = “nucleus”). Microscope observations of the protista and fungi had revealed that these organisms also have a eukaryotic organization. Thus, not only are all plants and animals eukaryotes, so are the microorganisms that comprise the fungi and protista. Studies with the electron microscope revealed that bacterial (and archaeal) cells had few of the cellular compartments typical of eukaryotic cells. They lacked a cell nucleus, indicating the bacterial chromosome (DNA) was not surrounded by a membrane envelope ( FIGURE 1.13B ). Therefore, members of the Bacteria and Archaea have a prokaryotic (pro = “before”) type of cellular organization and represent prokaryotes. (By the way, because viruses lack a cellular organization, they are neither prokaryotes nor eukaryotes.) As we will see in Chapter 4, there are many differences between bacterial and archaeal cells, blurring the use of the term “prokaryote.”
CONCEPT AND REASONING CHECKS
CONCEPT AND REASONING CHECKS
1.12 What roles did microorganisms and viruses play in understanding general principles of biology?
1.13 Distinguish between prokaryotic and eukaryotic cells.
62582_CH01_001_034.pdf 25
25
Mutations: Permanent alterations in DNA base sequences.
2/4/10 2:04 PM
26
CHAPTER 1
Microbiology: Then and Now
DNA DNA in cell nucleus
Membrane envelope
(A)
(B)
False Color Images of Eukaryotic and Prokaryotic Cells. (A) A scanning electron microscope image of a eukaryotic cell. All eukaryotes, including the protozoa, algae, and fungi, have their DNA (pink) enclosed in a cell nucleus with a membrane envelope. (Bar = 3 µm.) (B) A false-color transmission electron microscope image of a dividing Escherichia coli cell. The DNA (orange) is not surrounded by a membrane. (Bar = 0.5 µm.) FIGURE 1.13
Antibiotics Are Used to Cure Infectious Disease KEY CONCEPT
14. Antimicrobial chemicals can be effective in treating infectious diseases.
In 1910, another coworker of Koch’s, Paul Ehrlich, synthesized the first “magic bullet”— a chemical that could kill pathogens. Called salvarsan, Ehrlich showed that this arseniccontaining compound cured syphilis, a sexually transmitted disease. Antibacterial chemotherapy, the use of antimicrobial chemicals to kill microbes, was born. In 1929, Alexander Fleming, a Scottish scientist, discovered a mold growing in one of his bacterial cultures ( FIGURE 1.14A, B ). His curiosity aroused, Fleming observed that the mold, a species of Penicillium, killed the bacterial cells and colonies that were near the mold. He named the antimicrobial substance penicillin and developed an assay for its production. In 1940, British biochemists Howard Florey and Ernst Chain purified penicillin and carried out clinical trials that showed the antimicrobial potential of the natural drug (MICROFOCUS 1.6). Additional magic bullets also were being discovered. The German chemist Gerhard Domagk discovered a synthetic chemical dye, called prontosil, which was effective in treating
62582_CH01_001_034.pdf 26
Streptococcus infections. Examination of soil bacteria led Selman Waksman to the discovery of actinomycin and streptomycin, the latter being the first effective agent against tuberculosis. He coined the term antibiotic to refer to those antimicrobial substances naturally produced by mold and bacterial species that inhibit growth or kill other microorganisms. The push to market effective antibiotics was stimulated by a need to treat deadly infections in casualties of World War II ( FIGURE 1.14C ). By the 1950s, penicillin and several additional antibiotics were established treatments in medical practice. In fact, the growing arsenal of antibiotics convinced many that the age of infectious disease was waning. In fact, by the mid-1960s, many believed all major infections would soon disappear due to antibiotic chemotherapy. Partly due to the perceived benefits of antibiotics, interest in microbes was waning by the end of the 1960s as the knowledge gained from bacterial studies was being applied to eukaryotic organisms, especially animals. What was ignored was the mounting evidence that bacterial species were becoming resistant to antibiotics. CONCEPT AND REASONING CHECKS
1.14 Contrast Ehrlich’s salvarsan and Domagk’s prontosil from those drugs developed by Fleming, Florey and Chain, and Waksman.
2/4/10 2:04 PM
1.5 The Second Golden Age of Microbiology (1943–1970)
27
(A)
(C) FIGURE 1.14 Fleming and Penicillin. (A) Fleming in his laboratory. (B) Fleming’s notes on the inhibition of bacterial growth by the fungus Penicillium. (C) A World War II poster touting the benefits of penicillin and illustrating the great enthusiasm in the United States for treating infectious diseases in war casualties.
(B)
1.6: History
Hiding a Treasure Their timing could not have been worse. Howard Florey, Ernest Chain, Norman Heatley, and others of the team had rediscovered penicillin, refined it, and proved it useful in infected patients. But it was 1939, and German bombs were falling on London. This was a dangerous time to be doing research into new drugs and medicines. What would they do if there was a German invasion of England? If the enemy were to learn the secret of penicillin, the team would have to destroy all their work. So, how could they preserve the vital fungus yet keep it from falling into enemy hands? Heatley made a suggestion. Each team member would rub the mold on the inside lining of his coat. The Penicillium mold spores would cling to the rough coat surface where the spores could survive for years (if necessary) in a dormant form. If an invasion did occur, hopefully at least one team member would make it to safety along with his “moldy coat.” Then, in a safe country the spores would be used to start new cultures and the research could continue. Of course, a German invasion of England did not occur, but the plan was an ingenious way to hide the treasured organism. The whole penicillin story is well told in The Mold in Dr. Flory’s Coat by Eric Lax (Henry Holt Publishers, 2004).
62582_CH01_001_034.pdf 27
2/4/10 2:05 PM
28
CHAPTER 1
Microbiology: Then and Now
1.6
The Third Golden Age of Microbiology—Now
Microbiology finds itself on the world stage again, in part from the biotechnology advances made in the latter part of the 20th century. Biotechnology frequently uses the natural and genetically engineered abilities of microbial agents to carry out biological processes for industrial/commercial/ medical applications. It has revolutionized the way microorganisms are genetically manipulated to act as tiny factories producing human proteins, such as insulin, or new synthetic vaccines, such as the hepatitis B vaccine. In the latest Golden Age, microbiology again is making important contributions to the life sciences and humanity. Microbiology Continues to Face Many Challenges KEY CONCEPT
15. Infectious disease (natural and intentional) preoccupies much of microbiology.
The third Golden Age of microbiology faces several challenges, many of which still concern the infectious diseases that are responsible for 26% of all deaths globally ( FIGURE 1.15 ). A New Infectious Disease Paradigm. Infectious disease remains a major concern worldwide. Even in the United States, more than 100,000 people die each year from bacterial infections, making them the fourth leading cause of death. In fact, on a global scale, infectious diseases are
spreading geographically faster than at any time in history. It is estimated that more than 2.5 billion people will be traveling by air in 2010, making an outbreak or epidemic in any one part of the world only a few airline hours away from becoming a potentially dangerous threat in another part of the world. It is a sobering thought to realize that since 2002, the World Health Organization (WHO) has verified more than 1,100 epidemic events worldwide. So, unlike past generations, today’s highly mobile, interdependent, and interconnected world provides potential opportunities for the rapid spread of infectious diseases. Today, our view of infectious diseases also has changed. In Pasteur and Koch’s time, it was mainly a problem of finding the germ that caused a specific disease. Today, new pathogens are being discovered that were never known to be associated with infectious disease and some of these agents actually cause more than one disease. In addition, there are polymicrobial diseases; that is, diseases caused by more than one infectious agent. Even some noninfectious diseases, such as heart disease, may have a microbial component that heightens the illness. Emerging and Reemerging Infectious Diseases. Infectious diseases are not only spreading faster, they appear to be emerging more quickly than ever before. Since the 1970s, new diseases have been identified at the unprecedented rate of
Noninfectious causes HIV/AIDS Diarrheal diseases Respiratory infections Tuberculosis Malaria Measles Other infectious diseases
FIGURE 1.15 Global Mortality—All Ages. On a global scale, infectious diseases account for about 26% of all deaths. Noninfectious causes include chronic diseases, injuries, nutritional deficiencies, and maternal and perinatal conditions. Source: World Health Statistics 2008: World Health Organization.
62582_CH01_001_034.pdf 28
2/4/10 2:05 PM
1.6 The Third Golden Age of Microbiology—Now
one or more per year. There are now nearly 40 diseases that were unknown a generation ago. For example, the food chain has undergone considerable and rapid changes over the last 50 years, becoming highly sophisticated and international. Although the safety of food has dramatically improved overall, progress is uneven and foodborne outbreaks from microbial contamination are common in many countries. The trading of contaminated food between countries increases the potential that outbreaks will spread. Emerging infectious diseases are those that have recently surfaced in a population. Among the more newsworthy have been AIDS, hantavirus pulmonary syndrome, Lyme disease, mad cow disease, and most recently, SARS, and swine flu. There is no cure for any of these. Reemerging infectious diseases are ones that have existed in the past but are now showing a resurgence in incidence or a spread in geographic range. Among the more prominent reemerging diseases are cholera, tuberculosis, dengue fever, and, for the first time in the Western Hemisphere, West Nile virus disease ( FIGURE 1.16A ). The cause for the reemergence may be antibiotic resistance or a population of susceptible individuals. Climate change also may become implicated in the upsurge and spread of disease as more moderate temperatures advance to more northern and southern latitudes. Increased Antibiotic Resistance. Another challenge concerns our increasing inability to fight infectious disease because most pathogens are now resistant to one or more antibiotics and antibiotic resistance is developing faster than new antibiotics are being discovered. Ever since it was recognized that pathogens could mutate into “superbugs” that are resistant to many drugs, a crusade has been waged to restrain the inappropriate use of these drugs by doctors and to educate patients not to demand them in uncalled-for situations. The challenge facing microbiologists and drug companies is to find new and effective antibiotics to which pathogens will not quickly develop resistance before the current arsenal is completely useless. Unfortunately, the growing threat of antibiotic resistance has been accompanied by a decline in new drug discovery and an increase in the time to develop a drug from discovery to market. Thus, antibiotic resistance is a major challenge for microbiology today. If actions are not taken to
62582_CH01_001_034.pdf 29
29
(A)
(B) FIGURE 1.16 Emerging Disease Threats: Natural and Intentional. (A) There have been and will continue to be natural disease outbreaks. West Nile virus (WNV) is just one of several agents responsible for emerging or reemerging diseases. Methods have been designed that individuals can use to protect themselves from mosquitoes that spread the WNV. (B) Combating the threat of bioterrorism often requires special equipment and protection because many agents seen as possible bioweapons could be spread through the air.
contain and reverse resistance, the world could be faced with previously treatable diseases that have again become untreatable, as in the days before antibiotics were developed. Bioterrorism. Perhaps it is the potential misuse of microbiology that has brought microbiology to the attention of the life science community and the public. Bioterrorism involves the intentional or threatened use of biological agents to cause fear in or actually inflict death or disease
2/4/10 2:05 PM
30
CHAPTER 1
Bioremediation: The use of microorganisms to remove or decontaminate toxic materials in the environment.
Microbiology: Then and Now
upon a large population. Most of the recognized biological agents are microorganisms, viruses, or microbial toxins that are bringing diseases like anthrax, smallpox, and plague back into the human psyche ( FIGURE 1.16B ). To minimize the use of these agents to inflict mass casualties, the challenge to the scientific community and microbiologists is to improve the ways that bioterror agents are detected, discover effective measures to protect the public, and develop new and effective treatments for individuals or whole populations. If there is anything good to come out of such challenges, it is that we will be better prepared
(A)
(B) FIGURE 1.17 Microbial Ecology—Biofilms and Bioremediation. (A) The slimy, and often smelly, film seen in a flower vase is an example of a biofilm. (B) Microbes can be used to clean up toxic spills. A shoreline coated with oil from an oil spill can be sprayed with microorganisms that, along with other measures, help degrade oil.
62582_CH01_001_034.pdf 30
for potential natural emerging infectious disease outbreaks, which initially might be difficult to tell apart from a bioterrorist attack. CONCEPT AND REASONING CHECKS
1.15 Describe the natural and intentional disease threats challenging microbiology.
Microbial Ecology and Evolution Are Helping to Drive the New Golden Age KEY CONCEPT
16. Microbial ecology and evolution are dominant themes in modern microbiology.
Since the time of Pasteur, microbiologists have wanted to know how a microbe interacts, survives, and thrives in the environment. Today, microbiology is less concerned with a specific microbe and more concerned with the process and mechanisms that link microbial agents. Microbial Ecology. Traditional methods of microbial ecology require organisms from an environment be cultivated in the laboratory so that they can be characterized and identified. However, up to 99% of microorganisms do not grow well in the lab (if at all) and therefore could not be studied. Today, many microbiologists, armed with genetic, molecular, and biotechnological tools, can study and characterize these unculturable microbes. Such investigations are producing a new understanding of microbial communities and their influence on the ecology of all organisms. SAR11 and the plans of Craig Venter, mentioned in the chapter’s opening piece, are but two examples. Today we are learning that most microbes do not act as individual entities; rather, in nature they survive in complex communities called a biofilm ( FIGURE 1.17A ). Microbes in biofilms act very differently than individual cells and can be difficult to treat when biofilms cause infectious disease. If you or someone you know has had a middle ear infection, the cause was a bacterial biofilm. The discovered versatility of many bacterial and archaeal species is being applied to problems that have the potential to benefit humankind. Bioremediation is one example where the understanding of microbial ecology has produced a useful outcome ( FIGURE 1.17B ). Other microbes hold potential to solve ecological impacts caused by toxic wastes, fertilizers, and pesticides released into the environment.
2/4/10 2:05 PM
Summary of Key Concepts
Microbial Evolution. It was Charles Darwin— another of the scientists in this chapter who combined observation with a “prepared mind”—who first described the principles of evolution, which represents the foundation for all biology and medicine. Like all life, microorganisms evolve. Because most have relatively short generation times, they represent experimental (model) systems in which evolutionary processes can be observed directly; microbial evolution is an experimental science. That makes it possible today to “replay history” by following the accumulation of unpredictable, chance events that lead to evolutionary novelty. For example, when considering the challenges facing microbiology today, current research is putting together a better understanding of the superfast evolution and spread of antibiotic resistance. It is also helping us better understand the mechanisms and evolution of emerging infectious diseases. Researchers once thought that they would not be able to work out the evolutionary his-
31
tory of microbes. Today, thanks to the availability of sequenced genomes for groups of related and unrelated microbes, and new analytical approaches, researchers are constructing a family tree that more clearly illustrates evolutionary relationships (Chapter 3). Then, by comparing the genomes of different microorganisms, they can better understand why there are so many strains of certain bacterial species and how these new strains evolved. Microbial evolution today is providing the means to more accurately understand what happens in real world evolution. Indeed, microbial evolution represents the organization for the biological and microbiological knowledge contained within this text. CONCEPT AND REASONING CHECKS
1.16 Give some examples of how microbial ecology and evolution are helping drive the new golden age of microbiology.
SUMMARY OF KEY CONCEPTS 1.1 The Beginnings of Microbiology 1. The observations with the microscope made by Hooke and especially Leeuwenhoek, who reported the existence of animalcules (microorganisms), sparked interest in an unknown world of microscopic life. 2. The controversy over spontaneous generation initiated the need for accurate scientific experimentation, which then provided the means to refute the concept. 1.2 Microorganisms and Disease Transmission 3. Semmelweis and Snow believed that infectious disease could be caused by something transmitted from the environment and that the transmission could be interrupted. 4. Edward Jenner determined that disease (smallpox) could be prevented through vaccination with a similar but milder disease-causing agent. 1.3 The Classical Golden Age of Microbiology (1854–1914) 5. Pasteur’s fermentation experiments indicated that microorganisms could induce chemical changes. He proposed the germ theory of disease, which stated that human disease could be due to chemical changes brought about by microorganisms in the body. 6. Lister’s use of antisepsis techniques and Pasteur’s studies of pébrine supported the germ theory and showed how diseases can be controlled. 7. Koch’s work with anthrax allowed him to formalize the methods (Koch’s postulates) for relating a single microorganism to a single disease. These postulates were only valid after he discovered how to make pure cultures of bacterial species. 8. Laboratory science arose as Pasteur and Koch hunted down the microorganisms of infectious disease. Pasteur’s lab studied the mechanisms for infection and developed vaccines for chicken
62582_CH01_001_034.pdf 31
cholera, animal anthrax, and human rabies. Koch’s lab focused on isolation, cultivation, and identification of pathogens such as those responsible for cholera and tuberculosis. 9. Ivanowsky and Beijerinck provided the first evidence for viruses as infectious agents. 10. Winogradsky and Beijerinck examined the beneficial roles of noninfectious microorganisms in the environment. 1.4 Studying Microorganisms 11. Microbes include the “bacteria” (Bacteria and Archaea), viruses, fungi (yeasts and molds), and protista (protozoa and algae). 1.5 The Second Golden Age of Microbiology (1943–1970) 12. Many of the advances toward understanding molecular biology and general principles in biology were based on experiments using microbial model systems. 13. With the advent of the electron microscope, microbiologists realized that there were two basic types of cellular organization: eukaryotic and prokaryotic. 14. Following from the initial work by Ehrlich, antibiotics were developed as “magic bullets” to cure many infectious diseases. 1.6 The Third Golden Age of Microbiology—Now 15. In the 21st century, fighting infectious disease, identifying emerging and reemerging infectious diseases, combating increasing antibiotic resistance, and countering the bioterrorism threat are challenges facing microbiology, health care systems, and society. 16. Microbial ecology is providing new clues to the roles of microorganisms in the environment. The understanding of microbial evolution has advanced with the use of genomic technologies and has expanded our understanding of microorganism relationships.
2/4/10 2:05 PM
32
CHAPTER 1
Microbiology: Then and Now
LEARNING OBJECTIVES After understanding the textbook reading, you should be capable of writing a paragraph that includes the appropriate terms and pertinent information to answer the objective. 1. Identify the significant contributions made by Hooke and Leeuwenhoek that foreshadowed the beginnings of microbiology. 2. Discuss spontaneous generation and compare the experiments that led to its downfall. 3. Assess the importance of the work carried out by Semmelweis and by Snow that went against the miasma idea and established the field of epidemiology. 4. Explain how Jenner’s work differs from earlier practices for preventing infectious disease. 5. Discuss Pasteur’s early studies suggesting that germs could cause disease. 6. Describe how Lister’s surgical work and Pasteur’s studies of pébrine further strengthen the germ theory of disease. 7. Judge the importance of (a) the germ theory of disease and (b) Koch’s postulates to the identification of microbes as agents of infectious disease.
8. Identify several discoveries made in the laboratories of Pasteur and Koch. 9. Describe how viruses were discovered. 10. Describe the contributions Winogradsky and Beijerinck made to environmental microbiology. 11. Provide several reasons why the “microbial agents” are placed in different groups. 12. Illustrate how microorganisms and viruses make good model systems. 13. Explain why Bacteria and Archaea are prokaryotic cells and all other organisms are eukaryotic cells. 14. Define chemotherapy and explain why antibiotics were referrd to as “magic bullets.” 15. Outline the major challenges facing microbiology today. 16. Assess the importance of microbial ecology and microbial evolution to the current golden age of microbiology.
STEP A: SELF-TEST Each of the following questions is designed to assess your ability to remember or recall factual or conceptual knowledge related to this chapter. Read each question carefully, then select the one answer that best fits the question or statement. Answers to the even-numbered questions can be found in Appendix C. 1. Who was the first person to see bacterial cells with the microscope? A. Pasteur B. Koch C. Leeuwenhoek D. Hooke 2. What process was studied by Redi and Spallanzani? A. Spontaneous generation B. Fermentation C. Variolation D. Antisepsis 3. What is the name for the field of study established by Semmelweis and Snow in the mid 1800s? A. Immunology B. Bacteriology C. Virology D. Epidemiology 4. The process of _____ involved the inoculation of dried smallpox scabs under the skin. A. vaccination B. antisepsis C. variolation D. immunization 5. The process of controlled heating, called _____, was used to keep wine from spoiling. A. curdling B. fermentation C. pasteurization D. variolation
62582_CH01_001_034.pdf 32
6. What surgical practice was established by Lister? A. Antisepsis B. Chemotherapy C. Variolation D. Sterilization 7. Which one of the following statements is NOT part of Koch’s postulates? A. The microorganism must be isolated from a dead animal and pure cultured. B. The microorganism and disease can be identified from a mixed culture. C. The pure cultured organism is inoculated into a healthy, susceptible animal. D. The same microorganism must be present in every case of the disease. 8. Match the lab with the correct set of identified diseases. A. Pasteur: tetanus and tuberculosis B. Koch: anthrax and rabies C. Koch: cholera and tuberculosis D. Pasteur: diphtheria and typhoid 9. What group of microbial agents would eventually be identified from the work of Ivanowsky and Beijerinck? A. Viruses B. Fungi C. Protozoa D. Bacteria 10. What microbiological field was established by Winogradsky and Beijerinck? A. Virology B. Microbial ecology C. Bacteriology D. Mycology
2/4/10 2:05 PM
Step C: Applications
11. What group of microorganisms has a variety of internal cell compartments and acts as decomposers? A. Bacteria B. Viruses C. Archaea D. Fungi 12. Which one of the following organisms was NOT a model organism related to the birth of molecular genetics? A. Streptococcus B. Penicillium C. Escherichia D. Neurospora 13. Which group of microbial agents is eukaryotic? A. Bacteria B. Viruses C. Archaea D. Algae
33
14. The term antibiotic was coined by _____ to refer to antimicrobial substances naturally derived from _____. A. Waksman; bacteria and fungi B. Domagk; other living organisms C. Fleming; fungi and bacteria D. Ehrlich; bacteria 15. Which one of the following is NOT considered an emerging infectious disease? A. Polio B. Hantavirus pulmonary disease C. Lyme disease D. AIDS 16. A _____ is a mixture of _____ that form as a complex community. A. genome; genes B. biofilm; microbes C. biofilm; chemicals D. miasma; microbes
STEP B: REVIEW The answers to even-numbered quesitons or statements can be found in Appendix C. 17. Construct a concept map for Microbial Agents using the following terms. algae fungi viruses Archaea microorganisms cyanobacteria nucleated cells decomposers protista Bacteria protozoa On completing your study of these pages, test your understanding of their contents by deciding whether the following statements are true (T) or false (F). If the statement is false, substitute a word or phrase for the underlined word or phrase to make the statement true. 18. _____ Leeuwenhoek was a vitalist who believed mice could spontaneously generate from putrefaction and decay.
19. _____ Pasteur proposed that “wine disease” was a souring of wine caused by yeast cells. 20. _____ Antisepsis is the use of chemical methods for disinfecting living surfaces. 21. _____ Separate bacterial colonies can be observed in a broth culture. 22. _____ Semmelweis proposed that cholera was a waterborne disease. 23. _____ Some bacterial species can convert nitrogen gas (N2) into ammonia (NH3). 24. _____ Fungi are eukaryotic microorganisms. 25. _____ Robert Koch was a French country doctor. 26. _____ Variolation involved inoculating individuals with smallpox scabs. 27. _____ Mycology is the scientific study of viruses.
STEP C: APPLICATIONS Answers to the even-numbered questions can be found in Appendix C. 28. As a microbiologist in the 1940s, you are interested in discovering new antibiotics that will kill bacterial pathogens. You have been given a liquid sample of a chemical substance to test in order to determine if it kills bacterial cells. Drawing on the culture techniques of Robert Koch, design an experiment that would allow you to determine the killing properties of the sample substance.
62582_CH01_001_034.pdf 33
29. As an environmental microbiologist, you discover a new species of microbe. How could you determine if it has a prokaryotic or eukaryotic cell structure? Suppose it has a eukaryotic structure. What information would be needed to determine if it is a member of the protista or fungi? 30. On the front page of this chapter there is a quote from Louis Pasteur. How does this quote apply to the work done by (a) Semmelweis, (b) Snow, and (c) Fleming?
2/4/10 2:05 PM
34
CHAPTER 1
Microbiology: Then and Now
STEP D: QUESTIONS FOR THOUGHT AND DISCUSSION Answers to the even-numbered questions can be found in Appendix C. 31. Many people are fond of pinpointing events that alter the course of history. In your mind, which single event described in this chapter had the greatest influence on the development of microbiology? What event would be in second place? 32. One of the foundations of scientific inquiry is proper experimental design involving the use of controls. What is the role of a control in an experiment? For each of the experiments described in the section on spontaneous generation, identify the control(s) and explain how the interpretation of the experimental results would change without such controls. 33. One reason for the rapid advance in knowledge concerning molecular biology during the second Golden Age of microbiology was because
many researchers used microorganisms as model systems. Why would bacterial cells be more advantageous to use for research than, say, rats or guinea pigs? 34. When you tell a friend that you are taking microbiology this semester, she asks, “Exactly what is microbiology?” How do you answer her? 35. As microbiologists continue to explore the microbial universe, it is becoming more apparent that microbes are “invisible emperors” that rule the world. Now that you have completed Chapter 1, provide examples to support the statement: Microbes Rule! 36. Who would you select as the “father of microbiology?” (a) Leeuwenhoek or (b) Pasteur and Koch. Support your decision.
HTTP://MICROBIOLOGY.JBPUB.COM/9E The site features eLearning, an online review area that provides quizzes and other tools to help you study for your class. You can also follow useful links for in-depth information, read more MicroFocus stories, or just find out the latest microbiology news.
62582_CH01_001_034.pdf 34
2/4/10 2:05 PM
2 2 Chapter P Chapte Cha Chapter Preview Prev review iiew an and d K Key ey C Concep Con Concepts cepts ts t
The Chemical Building Blocks of Life The significant chemicals in living tissue are rickety and unstable, which is exactly what is needed for life. —Isaac Asimov (1920–1992) The origin of life is one of the great unsolved problems of science. We are fairly certain that microbial life established itself on Earth about three and a half billion years ago, although no one can definitely say how or where life originated. In fact, there are many hypotheses. About all that is known is that a common primitive life form gave rise to bacterial and archaeal cells. But even this is not certain. Assuming that life did arise here on Earth, did such life arise but once or was there opportunity for “life” arising more than once—and in a different form? Paul Davies is a theoretical physicist and astrobiologist and director of BEYOND: Center for Fundamental Concepts in Science at Arizona State University. One of the “big questions” he and others are pursuing is whether “alien” life may be hiding right in front of our noses. His hypothesis is that perhaps life formed several times on planet Earth and still exists here today in a so-called “shadow biosphere.” To pursue this controversial idea, scientists have begun searching high and low (literally in the air and deep in the crust of the earth among other places) for evidence of “alien” life-forms—organisms that as the result of a “second genesis” would differ fundamentally from all known microbial life because they arose independently. Most likely, such organisms would be microbial-like. Davies believes what might make them different is an alternate and distinctive chemistry, the topic of this chapter. Microbes and all known life essentially use the same cellular chemistry—be it quite diverse—and work with an almost identical genetic code. Perhaps these undiscovered life forms would look like bacterial or archaeal cells, but their biochemistry might single them out as “alien.”
2.1 The Elements of Life 1. Atoms are composed of charged and uncharged particles. 2. Isotopes and ions are atoms of an element with varying mass numbers or electrical charges. 3. The chemical properties of atoms are strongly governed by the number of electrons in their outermost electron shell.
2.2 Chemical Bonding 4. Unstable atoms can be linked through ionic interactions. 5. Unstable atoms can interact through the sharing of outer shell electron pairs. 6. Hydrogen bonding is a weak electrostatic attraction between atoms. 7. Chemical reactions convert reactants into products.
2.3 Water, pH, and Buffers 8. Water is the solvent of life. 9. The concentration of hydrogen ions is expressed in pH units. 10. Buffers prevent pH shifts.
2.4 Major Organic Compounds of Living Organisms 11. Functional groups represent the set of atoms involved in chemical reactions. 12. Carbohydrates provide energy and structural materials. 13. Lipids store energy and are components of membranes. 14. Nucleic acids store, transport, and control hereditary information. 15. Proteins fold into diverse three-dimensional shapes. MICROINQUIRY 2: Is Protein or DNA the Genetic Material?
Biosphere: That part of the earth— including the air, soil, and water—where life occurs.
35
62582_CH02_035_063.pdf 35
2/4/10 2:01 PM
36
CHAPTER 2
The Chemical Building Blocks of Life
Some potential markers for detecting this shadow life include: (a) proteins—perhaps there are life forms that make proteins from more than, or in addition to, the 20 amino acids commonly used as building blocks for known life; (b) biomolecules—research suggests that arsenic, although poisonous to life as we know it but present in ocean vents and hot springs, can mimic the behavior of phosphorus and thus could replace phosphorus in building important biomolecules including DNA and membranes; and (c) silicon— many scientists have proposed, and science fiction writers written stories about, using silicon instead of carbon as the backbone of biological molecules. As mentioned in the opening chapter, microbiologists have identified but a miniscule fraction of the organisms forming the microbial universe here on Earth. Because we know so little about the diversity of these microbes, is it possible there is or are other “alien” forms yet to be discovered? Importantly, that is what science is all about—the field of study that based on evidence tries to describe and comprehend the nature of the universe in whole or part, wherever that might take us. In Chapter 1, you learned that microorganisms are found in most, if not all, habitats on Earth and perhaps “signatures” of other “alien” forms are out there as well. You now know that some
(A)
microbes can survive high temperatures of a hot spring, the acidic runoff from a mine, or alkaline, hypersaline conditions of some lakes ( FIGURE 2.1 ). In these cases, as with all habitats where microbes exist, their survival depends on cellular chemistry, the chemical reactions between atoms and molecules that provide for the unique metabolism found in microbial cells. The basic principles of chemistry also permit microbiologists to understand how pathogens make a living in the human body and how the body responds. For example, studying microbial chemistry means determining: • How microbes cause disease. • How the immune system attempts to combat infections. • How antibiotics and vaccines can eliminate or protect against infections. This chapter serves as a primer or review of the fundamental concepts of chemistry that form a foundation for the chapters ahead. We will identify the elements making up all known substances and show how these elements combine to form the major groups of organic compounds found in all “known” forms of life. Realize the time invested now to understand or refresh your memory about chemistry will make subsequent chapters easier and prepare you for a rewarding learning experience as you continue your study of microbiology.
(B)
FIGURE 2.1 Cellular Chemistry Allows Microbes to Colonize and Survive in Earth’s Extreme Environments. (A) Yellowstone’s Grand Prismatic Spring. The gentle flow of heated water spreads out in terraces, with green and red algae thriving in the warm, shallow water toward the edge. (B) Microbial communities can thrive in extremely alkaline and salty waters, such as Mono Lake in California. »» What other extreme environments can you identify where microbes might survive?
62582_CH02_035_063.pdf 36
2/4/10 2:02 PM
2.1
Matter Is Composed of Atoms KEY CONCEPT
Atoms are composed of charged and uncharged particles.
An atom is the smallest unit of an element having the properties of that element; it cannot be broken down further without losing the quality of the element. Simply stated, carbon consists of carbon atoms, oxygen of oxygen atoms, and so forth. If you split a carbon atom into simpler parts, it no longer has the properties of carbon. An atom consists of a positively charged core, the atomic nucleus ( FIGURE 2.2A ). The atomic nucleus contains most of the atom’s mass and two kinds of tightly packed particles called protons
62582_CH02_035_063.pdf 37
37
and neutrons. Although protons and neutrons have about the same mass, protons bear a positive electrical charge (value = +1), while neutrons have no charge. The number of protons in an atom defines each element. For example, carbon atoms always have six protons. If there are seven protons, it is no longer carbon but rather the element nitrogen. The number of protons also represents the atomic number of the atom. As shown in Table 2.1, carbon with six protons has an atomic number of 6. The mass number is the number of protons and neutrons combined. Because carbon atoms have six protons and usually six neutrons in the atomic nucleus, the mass number of carbon is 12. Surrounding the atomic nucleus is a negatively charged cloud of electrons (value = –1). In any uncharged atom, the number of electrons is equal to the number of protons; that is, an atom has no net electrical charge. Although it is impossible to predict at any moment where a particular electron might be located, we can identify
Matter: Anything that occupies space and has mass.
The Elements of Life
As far as scientists know, all matter in the physical universe—be it a rock, a tree, or a microbe— is built of substances called chemical elements. Chemical elements are the most basic forms of matter and they cannot be broken down into other substances by ordinary chemical means. Ninety-two naturally occurring elements have been discovered, while additional elements have been made in the laboratory or nuclear reactor. One or two letters, many standing for its English, Latin, or Greek name, designate each element. For example, H is the symbol for hydrogen, O for oxygen, Cl for chlorine, and Mg for magnesium. Some Latin abbreviations include Na (natrium = “sodium”), K (kalium = “potassium”), and Fe (ferrum = “iron”). Only about 25 of the 92 naturally occurring elements are essential to the survival of living organisms. Many of these are major elements needed in relatively large amounts ( TABLE 2.1 ). Note that just six of these elements—carbon, hydrogen, nitrogen, oxygen, phosphorus, and sulfur—make up 98% of the weight in both human and bacterial cells. (The acronym CHNOPS is helpful in remembering these six important elements.) In addition, there are a number of elements needed in much smaller amounts. These elements vary from organism to organism, but often include such elements as sodium (Na), calcium (Ca), manganese (Mn), iron (Fe), copper (Cu), and zinc (Zn).
1.
2.1 The Elements of Life
Mass: The quantity of matter in a sample.
TABLE
2.1
Some of the Major Elements of Humans and Bacteria
Human Cell Element
Oxygen Carbon Hydrogen Nitrogen Phosphorus Sulfur Sodium Magnesium Chlorine Potassium
Symbol
Percentage by Weight
Atomic Number
Mass Number
O C H N P S Na Mg Cl K
65 18 10 3 1 0.9 0.2 0.1 0.2 0.4
8 6 1 7 15 16 11 12 17 19
16 12 1 14 31 32 23 24 36 39
O C H N P S
72 12 10 3 0.6 0.3
Bacterial Cell
Oxygen Carbon Hydrogen Nitrogen Phosphorus Sulfur
2/4/10 2:02 PM
38
CHAPTER 2
The Chemical Building Blocks of Life
Electron (e–) p+ n
Atomic nucleus Electron shells
(A) (A)
1p+
(B) (B)
6p+ 6n
8p+ 8n
15p+ 16n
2e– 8e– 5e–
1e– 6e–
Hydrogen (H) Atomic number: 1 Mass number: 1
8e–
Carbon (C) 6 12
Oxygen (O) 8 16
15e– Phosphorus (P) 15 31
FIGURE 2.2 The Atomic Structure of an Atom and the Electron Configurations for Four Biologically Important Elements. (A) The atom is composed of protons and neutrons in the atomic nucleus, and electrons that move about the nucleus in electron shells. (B) The atomic structure of four biologically essential elements illustrates that the number of protons equals the number of electrons (though not necessarily equal to the number of neutrons). »» Knowing the mass number for an element, what does that tell you about the mass of an electron?
the spaces within the atom where electrons are usually located. These spaces are called electron shells, each shell representing a different energy level. FIGURE 2.2B provides a simple diagram of the structures, atomic numbers, and mass numbers of four atoms essential to life. CONCEPT AND REASONING CHECKS
2.1 How does the atomic number differ from the mass number?
Atoms Can Vary in the Number of Neutrons or Electrons KEY CONCEPT
2.
Isotopes and ions are atoms of an element with varying mass numbers or electrical charges.
other elements can be used as radioactive tracers to follow the fate of the substance, as MicroInquiry 2 demonstrates (see page 59). Atoms are uncharged when they contain equal numbers of electrons and protons. Should an atom acquire an electrostatic charge, it is called an ion ( FIGURE 2.3 ). The addition of one or more electrons to an atom means there is/are more negatively charged electrons than positively charged protons. Such a negatively charged ion is called an anion. By contrast, the loss of one or more electrons leaves the atom with extra protons and yields a positively charged ion, called a cation. As we will see, ion formation is important to some forms of chemical bonding. CONCEPT AND REASONING CHECKS
Although the number of protons is the same for all atoms in an element, the number of neutrons in an element may vary, altering its mass number. Most carbon atoms, for example, have a mass number of 12, but some carbon atoms have eight neutrons, rather than six, in the atomic nucleus and, hence, a mass number of 14. Atoms of the same element that have different numbers of neutrons are called isotopes. Therefore, carbon-12 and carbon-14 (symbolized as 12C and 14C) are isotopes of carbon. Some isotopes are unstable and give off energy in the form of radiation. Such radioisotopes are useful in research and medicine. 14C can be incorporated into an organic substance and isotopes of
62582_CH02_035_063.pdf 38
2.2 How does an isotope differ from an ion?
Electron Placement Determines Chemical Reactivity KEY CONCEPT
3.
The chemical properties of atoms are strongly governed by the number of electrons in their outermost electron shell.
As shown in Figure 2.2B, each shell can hold a maximum number of electrons. The shell closest to the nucleus can accommodate two electrons, while the second and third shells each can hold eight. Other shells also have maximum numbers but usually no more than 18 are present in those outer shells. Because the 25 essential elements are
2/4/10 2:02 PM
2.2 Chemical Bonding
Mg
Mg+2
39
ATOMIC STRUCTURE involves
12p+ 12n
Atoms
12p+ 12n
that consist of the
Atomic nucleus
Lost electrons FIGURE 2.3 Formation of an Ion. Ions can be formed by the loss or gain of one or more electrons. Here, a magnesium (Mg) atom has lost two electrons to become a magnesium ion (Mg+2). »» For Mg, what does the superscript denote?
of lower mass number, only the first few shells are of significance to life. Inner shells are filled first and, if there are not enough electrons to completely fill the shell, the outermost shell is left incompletely filled. Atoms with an unfilled outer electron shell are unstable but can become stable by interacting with another unstable atom. A carbon atom, with six electrons, has two electrons in its first shell and only four in the second (see Figure 2.2B). For this reason, carbon is extremely reactive in “finding” four more electrons and, as we will see, forms innumerable combinations with other elements. Therefore, only atoms with unfilled outer shells will participate in a chemical reaction. The shells of a few elements normally are filled completely. Each of these elements, called an inert gas, are chemically stable and exist as separate atoms in nature. Helium (atomic number 2) and
2.2
which contain negatively charged
positively charged
uncharged
Protons
Neutrons
Electrons
the loss or gain of which forms a
the loss or gain of which forms an
the loss or gain of which forms an
Different element
Isotope of the same element
Ion of the same element
FIGURE 2.4 A Concept Map for Atomic Structure. The map shows the relationships between atoms, elements, isotopes, and ions. »» Give three examples of how a loss or gain of protons gives rise to a different element.
neon (atomic number 10) are examples, as each has its outermost electron shell filled. FIGURE 2.4 summarizes atomic structure. CONCEPT AND REASONING CHECKS
2.3 Looking at Figure 2.2B, do these atoms have filled outer electron shells? Explain.
Chemical Bonding
Isaac Asimov’s opening quote that chemicals are “rickety and unstable” applies to how atoms interact. When the electron shells of two unstable atoms come close, the electron shells overlap, an energy exchange takes place, and each of the participating atoms assumes an electron configuration more stable than its original unstable configuration. When two or more atoms are linked together, the force holding them is called
62582_CH02_035_063.pdf 39
which is composed of
Electron shells
a chemical bond. Chemical bonds are the result of these rickety, unstable atoms filling their outer electron shells. The rearrangement of atoms through chemical bonding can occur in one of two major ways: atoms, as ions, can interact electrostatically; or, each uncharged atom can share electrons with one or more other atoms. In both cases, the result is atoms having full electron shells.
2/4/10 2:02 PM
40
CHAPTER 2
The Chemical Building Blocks of Life
Ionic Bonds Form between Oppositely Charged Ions KEY CONCEPT
4.
Unstable atoms can be linked through ionic interactions.
In the formation of an ionic bond, one atom gives up its outermost electrons to another. The reaction between sodium and chlorine is illustrative of how these atoms become ions and then form ionic bonds ( FIGURE 2.5 ). Both atoms now have their outermost shell filled. Because opposite electrical charges attract each other, the chloride ions and sodium ions come together to form stable sodium chloride (NaCl). Salts are typically formed through ionic bonding. Besides sodium and chloride, important salts are formed from other ions, including calcium
(Ca+2), potassium (K+2), magnesium (Mg+2), and iron (Fe+2 or Fe+3). Although ionic bonds are relatively weak, they play important roles in protein structure and the reactions between antigens and antibodies in the immune response (Chapter 21). When two or more different elements interact with one another to achieve stability, they form a compound. Each compound, like each element, has a definite formula and set of properties that distinguish it from its components. For example, sodium (Na) is an explosive metal and chlorine (Cl) is a poisonous gas, but the compound they form is crystals of edible table salt (NaCl). CONCEPT AND REASONING CHECKS
2.4 Construct a diagram to show how the salt calcium chloride (CaCl2) is formed.
Covalent Bonds Share Electrons KEY CONCEPT
5.
Electron transfer
1. Sodium gives up its outer shell electron to chlorine, resulting in sodium and chloride ions.
11p 12n
17p 18n
Sodium atom (Na)
Chlorine atom (Cl)
Ionic attraction
2. The stable outer shells bring about the attraction of opposite electrical charges.
11p 12n
+
17p 18n
–
Sodium ion (Na+)
Chloride ion (Cl–) Ionic bond
3. The attraction of opposite charges is the ionic bond, forming the salt sodium chloride (NaCl).
11p 12n
17p 18n
Sodium chloride (NaCl) FIGURE 2.5 Ion Formation and Ionic Bonding. The transfer of an electron from sodium to chlorine generates oppositely charged ions that are attracted to one another by forming an ionic bond. »» Explain why the sodium ion has a net positive charge and the chloride ion has a net negative charge.
62582_CH02_035_063.pdf 40
Unstable atoms can interact through the sharing of outer shell electron pairs.
Atoms also can achieve stability by sharing electrons between atoms, the sharing producing a covalent bond. Such strong bonds are very important in biology because the CHNOPS elements of life usually enter into covalent bonds with themselves or one another. Covalent bonding occurs frequently in carbon because this element has four electrons in its outer shell. The carbon atom is not strong enough to acquire four additional electrons, but it is sufficiently strong to retain the four it has. It therefore enters into a variety of covalent bonds with other atoms or groups of atoms. The vast array of carbon compounds that can be formed is responsible for the chemistry of life. Many of the microbes residing in the ruminant stomach of a cow produce methane or natural gas (CH4) as a by-product of cellulose digestion. This gas is a good example to illustrate covalent bonding between carbon and hydrogen ( FIGURE 2.6A ). A carbon atom shares each of its four outer shell electrons with the electron of a hydrogen atom, forming four single covalent bonds. Scientists often draw chemical structures as structural formulas; that is, chemical diagrams showing the order and arrangement of atoms. In Figure 2.6, each line between carbon and hydro-
2/4/10 2:02 PM
2.2 Chemical Bonding
6p 6n
Hydrogen atom
Nonpolar covalent bond
2
Carbon atom
1p
1p
Hydrogen atom
+
Shared electron pair
1p
– –
1p
1p
O-
+H
–
1p
Water (H2O)
Methane (CH4) (A) (A) NONPOLAR MOLECULE
+H
8p 8n
+
H–C–H H
Oxygen atom Polar covalent bond
6p 6n
H
8p 8n
+
1p
–
+
1p
–
4
41
(B) (B)
POLAR MOLECULE
FIGURE 2.6 Chemical Bonding. (A) A nonpolar covalent bond involves the equal sharing of electron pairs between atoms, the example shown here being the simple organic compound methane. (B) A polar covalent bond involves the unequal sharing of electron pairs between hydrogen and oxygen (or nitrogen) atoms, such as in this molecule of water. »» How does a nonpolar covalent bond differ from a polar covalent bond?
gen (C—H) represents a single covalent bond between a pair of shared electrons. Other molecules, such as carbon dioxide (CO2), share two pairs of electrons and therefore two lines are used to indicate the double covalent bond: O=C=O. However, in all cases, the atoms now are stable because the outer electron shell of each atom is filled through this sharing. A molecule is two or more atoms held together by covalent bonds. Molecules may be composed of only one kind of atom, as in oxygen gas (O2), or they may consist of different kinds of atoms in substances such as water (H2O), carbon dioxide (CO2), and the simple sugar glucose (C6H12O6). As shown by these examples, the kinds and amounts of atoms (the subscript) in a molecule is called the molecular formula. (Note that the presence of one atom is represented without the subscript “1”.) The simplest derivatives of carbon are the hydrocarbons, molecules consisting solely of hydrogen and carbon. Methane is the most fundamental hydrocarbon (MICROFOCUS 2.1). Other hydrocarbons consist of chains of carbon atoms and, in some cases, the chains may be closed to form a ring.
62582_CH02_035_063.pdf 41
H H
C
H
H
H Methane (CH4)
H
H
H
C
C
C
H
H H H Propane (C3H8) H C
H C C H
H C C
C
H
H Benzene (C6H6)
When atoms bond together to form a molecule, they establish a geometric relationship determined largely by the electron configuration. Notice in the hydrocarbons drawn that the covalent bonds are distributed equally around each carbon atom. Each of these examples of the “equal sharing” of electron pairs represents a nonpolar molecule—there are no electrical charges (poles) and the bonds are called nonpolar covalent bonds.
2/4/10 2:02 PM
42
CHAPTER 2
The Chemical Building Blocks of Life
2.1: Evolution
Earth’s Early Microbial Chemistry In 2005, NASA’s Cassini spacecraft made several flybys of Saturn’s largest moon, Titan, and deployed a probe that landed on the moon’s surface. (see figure). Although the presence of methane gas (CH4) in the upper atmosphere was no surprise, the detection of several types of complex organic materials was surprising. In many ways, these conditions are similar to those that might have existed on Earth early in its history when life was first getting started. Many scientists believe that long before oxygen gas (O2) dominated the atmosphere, methane was a major component, giving the atmosphere a pinkish-orange color similar to Titan’s today. If so, then the first organisms to evolve on Earth might have been oxygen-intolerant methane-producers called “methanogens.” These microbes sustained the atmosphere for perhaps a billion years before the oxygen-producing microbes, the cyanobacteria, took hold some 2.7 billion years ago (see MicroFocus 5.4). In the previous billion years, methanogens thrived in many of the very warm environments where hydrogen gas (H2) dominated and could use H2 with CO2 for energy production. Methane gas would be a byproduct. The continued accumulation of methane would warm up the planet. But with the increasing concentration of methane, sunlight would link methane molecules together and produce hydrocarbons. Hydrocarbons would condense as a haze of atmospheric particles. Importantly, the haze would have a cooling effect on the atmosphere and shift life to those methanogens that preferred cooler temperatures. The changing chemistry also may have given oxygen-producing microbes a foothold and, along with the hydrocarbon haze, led to the first ice age about 2.3 billion years ago. Eventually, methanogens either died out or “retreated” to oxygen-free environments where methane still dominated. Today, methanogens make up about half of all the archaeal species, further supporting their ancestors as being among the first life to evolve. On Earth, we may never be able to verify any hypothesis concerning the pre-biological chemistry or origins of life; perhaps we can by exploring other worlds, such as Mars or Saturn’s moon Titan.
An artist’s rendering of Huygens, the probe carried by Cassini and sent through Titan’s atmosphere to land on the moon’s surface; an event that occurred on January 14, 2005.
Not all molecules are nonpolar. Indeed, one of the most important molecules to life, water, is a polar molecule—it has electrically charged poles ( FIGURE 2.6B ). Here the adjacent atoms do not equally share the electron pairs. Rather, oxygen has a stronger “pull” on the electrons and thus has a slight negative charge. The hydrogen atoms are then left with a slight positive charge. The water molecule therefore consists of polar covalent bonds. CONCEPT AND REASONING CHECKS
2.5 Why do atoms share electron pairs?
62582_CH02_035_063.pdf 42
Hydrogen Bonds Form between Polar Groups or Molecules KEY CONCEPT
6.
Hydrogen bonding is a weak electrostatic attraction between atoms.
A hydrogen bond involves the attraction of a partially positive hydrogen atom that is covalently bonded to one polar molecule toward another polar molecule having either a partially negative oxygen atom (H+–O–) or nitrogen atom (H+–N–). Although hydrogen bonds are much weaker
2/4/10 2:02 PM
2.2 Chemical Bonding
– Hydrogen bond
+
H
+ H +
–
O –
– +
FIGURE 2.7 Hydrogen Bonding between Water Molecules. The charged regions of each polar water molecule are attracted to oppositely charged regions of neighboring molecules through hydrogen bond formation. »» What is the origin of the (+) and (-) charges on hydrogen and oxygen in a water molecule?
than covalent bonds, hydrogen bonds provide the “glue” to hold water molecules together ( FIGURE 2.7 ). These bonds also are important to the structure of proteins and nucleic acids, two of the major components of living cells. TABLE 2.2 summarizes the different types of chemical bonds we have discussed. CONCEPT AND REASONING CHECKS
2.6
Construct a diagram to show the hydrogen bonding in liquid ammonia (NH3).
Chemical Reactions Change Bonding Partners KEY CONCEPT
7.
Chemical reactions convert reactants into products.
A chemical reaction is a process in which atoms or molecules interact to form new bonds.
43
Different combinations of atoms or molecules result from the reaction; that is, bonding partners change. However, the total number of interacting atoms remains constant. For chemical reactions, an arrow is used to indicate in which direction the reaction will proceed. By convention, the atoms or molecules drawn to the left of the arrow are the reactants and those to the right are the products of the reaction. In biology, many chemical reactions are based on the assembly of larger compounds or the tearing down of larger compounds into smaller ones. In a “synthesis” reaction, smaller reactants are put together into larger products. If water is involved as a product, often it is called a dehydration synthesis (condensation) reaction: +
C6H12O6 Glucose
C6H12O6 → Glucose
C12H22O11 Maltose
+
H 2O Water
The reverse is a “decomposition” reaction, where a larger reactant is broken into smaller products. Often in biology, water is one of the reactants used to break a molecule, so it is referred to as a hydrolysis reaction (hydro = “water”; lysis = “break”): C12H22O11 Maltose
+
H2O → C6H12O6 Water Glucose
+
C6H12O6 Glucose
Most importantly, the new products formed have the same number and types of atoms that were present in the reactants. In forming new products, chemical reactions only involve a change in the bonding partners. No atoms have been gained or lost from any of these reactions. CONCEPT AND REASONING CHECKS
2.7 In the dehydration synthesis and hydrolysis reactions drawn above, what are the reactants and products in each reaction?
TABLE
2.2
Three Types of Chemical Bonds in Living Organisms
Type
Chemical Basis
Strength
Example
Ionic Covalent Hydrogen
Attraction between oppositely-charged ions Sharing of electron pairs between atoms Attraction of a hydrogen nucleus (a proton) to negatively charged oxygen or nitrogen atoms in the same or neighboring molecules
Weak Strong Weak
Sodium chloride; salts Glucose Water
62582_CH02_035_063.pdf 43
2/4/10 2:02 PM
44
CHAPTER 2
The Chemical Building Blocks of Life
2.3
Water, pH, and Buffers
All organisms are composed primarily of water. Humans are about 90% water while bacterial and archaeal organisms are about 70% water by weight. No organism can survive and grow without water.
Na+ Cl– H2O
Water Has Several Unique Properties KEY CONCEPT
8.
Solvent: The liquid doing the dissolving to form a solution. Solute: The substance dissolved in the solvent.
Water is the solvent of life.
Liquid water is the medium in which all cellular chemical reactions occur. Being polar, water molecules are attracted to other polar molecules and act as the universal solvent in cells. Take for example what happens when you put a solute like salt in water. The salt is hydrophilic because it easily dissolves into separate sodium and chloride ions ( FIGURE 2.8 ) as water molecules break the weak ionic bonds and surround each ion in a sphere of water molecules. An aqueous solution, which consists of solutes in water, is essential for chemical reactions to occur (MICROFOCUS 2.2). Molecules that do not dissolve in water are hydrophobic. Water molecules also are reactants in many chemical reactions. The example of the hydrolysis reaction shown on the previous page involved water in splitting maltose into two molecules of glucose. As you have learned, the polar nature of water molecules leads to hydrogen bonding. By forming a large number of hydrogen bonds between water molecules, it takes a large amount of heat energy to increase the temperature of water. Likewise, a large amount of heat must be lost before water decreases temperature. So, by being 70% to 90% water, cells are bathed in a solvent that maintains a more consistent temperature even when the environmental temperatures change. CONCEPT AND REASONING CHECKS
2.8 What characteristic of water gives the molecule its unique properties?
Acids and Bases Affect a Solution’s pH KEY CONCEPT
9.
62582_CH02_035_063.pdf 44
Salt crystal
The concentration of hydrogen ions is expressed in pH units.
Ions in solution
FIGURE 2.8 Solutes Dissolve in Water. Water molecules surround Na+ and Cl– ions, facilitating their dissolving into solution. »» When dissolving, why do the H’s of water surround Cl– while the O’s surround the Na+?
In an aqueous solution, most of the water molecules remain intact. However, some can dissociate spontaneously into hydrogen ions (H+) and hydroxide ions (OH–) only to rapidly recombine. This can be represented as follows, where the double arrow indicates a reversible reaction: H2O ↔ H+ + OH– Besides water, other compounds in cells can release H+ when they dissolve in water. For our purposes, an acid is a chemical substance that donates H+ to a solution. Acids are distinguished by their sour taste. Some common examples are acetic acid in vinegar, citric acid in citrus fruits, and lactic acid in sour milk products. Strong acids can donate large numbers of hydrogen ions to a solution. Hydrochloric acid (HCl), sulfuric acid (H2SO4), and nitric acid (HNO3) are examples. Weak acids, typified by carbonic acid (H2CO3), donate a smaller number of hydrogen ions. By contrast, a base is a substance that combines with H+ in solution. Bases have a bitter taste. Strong bases take up numerous hydrogen ions from a solution. Potassium hydroxide (KOH), a material used to make soap, is among them. Acids and bases frequently react with each other because of their opposing chemical charac-
2/4/10 2:02 PM
2.3 Water, pH, and Buffers
45
2.2: Tools
The Relationship between Mass Number and Molecular Weight Often scientists need to make solutions that have a specific concentration of solutes. To make these solutions, one needs to know how much a particular molecule or solute weighs, which is referred to as the molecular weight. The calculation of the molecular weight simply consists of adding together the mass number of all the individual atoms in a molecule, such as water, carbon dioxide, or glucose. Thus, the molecular weight of a water molecule is 18 daltons, while the molecular weight of a glucose molecule is 180 daltons. Other molecules can reach astonishing proportions—antibodies of the immune system may have a molecular weight of 150,000 daltons and the bacterial toxin causing botulism is of over 900,000 daltons.
Hydrogen (H) 1H=1
Mass number:
Molecular weight: (in daltons)
Carbon (C) 1 C = 12
Oxygen (O) 1 O = 16
Water (H2O) 2H= 2 1 O = 16
Carbon dioxide (CO2) 1 C = 12 2 O = 32
—
—
18
44
—
teristics. An “exchange reaction” involving hydrochloric acid (HCl) and sodium hydroxide (NaOH) is one example: HCl + NaOH → NaCl + H2O To indicate the concentration of H+ in a solution, the Danish chemist Søren P. L. Sørensen introduced the symbol pH (power of hydrogen ions) and the pH scale. This numerical scale extends from 0 (extremely acidic; high H+) to 14 (extremely basic or alkaline; low H+) and is based
Concentrated hydrochloric acid (HCl)
Vinegar, Black wine, pickles coffee Lemon juice Tomato juice Stomach acid
pH 0
1
2
Glucose (C6H12O6) 6 C = 72 12 H = 12 6 O = 96 180
on actual calculations of the number of hydrogen ions present when a substance mixes with water. A substance with a pH of 7, such as pure water, is said to be neutral; solutions that gain H+ are said to be acidic and have a pH lower than 7; solutions that lose H+ are basic (or alkaline) and have a pH greater than 7. The pH scale is logarithmic; that is, every time the pH changes by one unit, the [H+] changes 10 times. For example, lemon juice (pH 2) and black coffee (pH 5) differ a thousandfold (103) in H+ concentration. FIGURE 2.9 summarizes the
Ocean water Pure water Saliva Baking Milk Blood soda
Extremely acidic
Bleach
Household ammonia
Neutral
3
4
5 Optimal growth of most fungi
6
Daltons: Units to measure the weight of atomic particles or molecules; equivalent to atomic mass units used in chemistry (one-twelfth the weight of an atom of 12C).
7
Concentrated sodium hydroxide (NaOH) Oven cleaner
Extremely basic
8
9
10
11
12
13
14
Optimal growth of most bacteria
FIGURE 2.9 A Sample of pH Values for Some Common Substances. Most fungi prefer a slightly acidic pH for growth compared to most bacteria. »» On the pH scale, notice that many of the beverages we drink (e.g., wine, tomato juice, coffee) are fairly acidic. However, we would never normally drink alkaline solutions (e.g., commercial bleach, ammonia). Propose an explanation for these observations.
62582_CH02_035_063.pdf 45
2/4/10 2:02 PM
46
CHAPTER 2
The Chemical Building Blocks of Life
2.3: Environmental Microbiology
Just South of Chicago All you need is a map, some pH paper, and a few collection vials. When in Chicago, use your map to find the Lake Calumet region just southeast of Chicago. When you arrive, pull out your pH paper and sample some of the groundwater in the region near the Calumet River. You will be shocked to discover the pH is greater than 12—almost as alkaline as oven cleaner! In fact, this might be one of the most extreme pH environments on Earth. How did the water get this alkaline and could anything possibly live in the groundwater? The groundwater in the area near Lake Calumet became strongly alkaline as a result of the steel slag that has been dumped into the area for more than 100 years. Used to fill the wetlands and lakes, water and air chemically react with the slag to produce lime [calcium hydroxide, Ca(OH)2]. It is estimated that 10 trillion cubic feet of slag and the resulting lime has pushed the pH to such a high value. Now use your collection vials to collect some samples of the water. Back in the lab you will be surprised to find that there are bacterial communities present in the water. Hydrogeologists who have collected such samples have discovered some bacterial species that until then had only been found in Greenland and deep gold mines of South Africa. Other identified species appear to use the hydrogen resulting from the corrosion of the iron for energy. How did these bacterial organisms get there? The hydrogeologists propose that the bacterial species have always been there and have simply adapted to the environment over the last 100 years when slag has been dumped. Otherwise, the microbes must have been imported in some way. So, once again, provide a specific environment and they will come (or evolve)—the microbes that is.
pH values of several common substances. With regard to organisms, fungi prefer a slightly acidic environment compared to the more neutral environment preferred by most bacteria—although there are some spectacular exceptions (MICROFOCUS 2.3).
Potential pH drop
Potential pH increase (A) (A)
H+ required
Chemical reaction
(B) (B)
Excessive H+ produced
CONCEPT AND REASONING CHECKS
2.9 If the pH of an aqueous solution changes from 7 to 5, how many times has the [H+] changed?
Cell Chemistry Is Sensitive to pH Changes KEY CONCEPT
10. Buffers prevent pH shifts.
As microorganisms—and all organisms—take up or ingest nutrients and undergo metabolism, chemical reactions occur that use up or produce H+. It is important for all organisms to balance the acids and bases in their cells because chemical reactions and organic compounds are very sensitive to pH shifts. Proteins are especially vulnerable, as we will soon see. If the internal cellular pH is not maintained, these proteins may be destroyed. Likewise, when most microbes grow in a microbiological nutrient medium, the waste products produced may lower the pH of the medium, which could kill the organisms.
62582_CH02_035_063.pdf 46
Acid-base buffer system H+ dissociates from acid
H+ absorbed by base
FIGURE 2.10 A Hypothetical Example for pH Shifts. An acid/base buffer system can prevent pH shifts from occuring as a result of a chemical reaction. If the reaction is using up H+ (A), the acid component prevents a pH rise by donating H+ to offset those used. If the reaction is producing excess H+ (B), the base can prevent a pH drop by “absorbing” them. »» Propose what would happen if a chemical reaction continued to release excessive H+ for a prolonged period of time.
To prevent pH shifts, cells and the growth media contain buffers, which are substances that maintain a specific pH. The buffer does not necessarily maintain a neutral pH, but rather whatever pH is required for that environment. Most biological buffers consist of a weak acid and a weak base ( FIGURE 2.10 ). If an excessive number of H+ are produced (poten-
2/4/10 2:02 PM
2.4 Major Organic Compounds of Living Organisms
tial pH drop), the base can absorb them. Alternatively, if there is a decrease in the hydrogen ion concentration (potential pH increase), the weak acid can dissociate, replacing the lost hydrogen ions.
2.4
CONCEPT AND REASONING CHECKS
2.10 If the pH does drop in a cell, what does that tell you about the buffer system?
Major Organic Compounds of Living Organisms
As mentioned in the last section, a typical prokaryotic cell is about 70% water. If all the water is evaporated, the predominant “dry weight” remaining consists of organic compounds, which are those compounds related to or having a carbon basis: the carbohydrates, lipids, proteins, and nucleic acids ( FIGURE 2.11 ). Except for the lipids, each class represents a polymer (poly = many; mer = part) built from a very large number of building blocks called monomers (mono = one).
Percent dry weight:
KEY CONCEPT
11. Functional groups represent the set of atoms involved in chemical reactions.
Before we look at the major classes of organic compounds, we need to address one question. The monomers building carbohydrates, nucleic acids, and proteins are essentially stable molecules because their outer shells are filled through covalent bonding. Why then should these molecules take part in chemical reactions to build polymers? The answer is that these monomers are not completely stable. Projecting from the carbon skeletons or other atoms on these biological molecules are groups of atoms called functional groups. Functional groups represent points where further chemical reactions can occur if facilitated by a specific enzyme. The reactions will not happen spontaneously. There is a small number of functional groups but their differences and placement on compounds makes possible a large variety of chemical reactions. The important functional groups in living organisms are identified in TABLE 2.3 . Functional groups on monomers can interact to form larger molecules or polymers through dehydration synthesis reactions. In addition, functional groups can be critical for the decomposition of larger polymers into monomers through hydrolysis reactions.
Phospholipids (8%)
Ions, small molecules (4%)
Nucleic acids (27%)
Organic compounds (26%)
Organic compounds
H2O (70%) Proteins (58%)
Functional Groups Define Molecular Behavior
62582_CH02_035_063.pdf 47
47
Bacterial cell
Carbohydrates (7%)
FIGURE 2.11 Organic Compounds in Bacterial Cells. Organic compounds are abundant in cells. The approximate composition of these compounds in a bacterial cell is similar to the percentages found in other microbes. »» Propose a reason why proteins make up almost 60% of the dry weight of a bacterial cell.
TABLE
2.3
Common Functional Groups on Organic Compounds
Functional Group
Shorthand
Structural Formula
Hydroxyl
—OH
—O—H
Carboxyl
—COOH
Carbonyl
—CO—
O —C—OH O —C—
Amino
—NH2
Sulfhydryl
—SH
Phosphate
—H2PO4
H —N—H —S—H OH —O—P O OH
Enzyme: A protein that facilitates a specific chemical reaction.
2/4/10 2:02 PM
48
CHAPTER 2
The Chemical Building Blocks of Life
If you are unsure about the role of these functional groups, do not worry. We will see how specific functional groups interact through dehydration synthesis reactions as we now visit each of the four classes of organic compounds. CONCEPT AND REASONING CHECKS
2.11 Why must dehydration synthesis and hydrolysis reactions be controlled by enzymes?
Carbohydrates Consist of Sugars and Sugar Polymers KEY CONCEPT
12. Carbohydrates provide energy and structural materials.
Carbohydrates are organic compounds composed of carbon, hydrogen, and oxygen atoms that build sugars and starches. In simple sugars, like glucose (C6H12O6), the ratio of hydrogen to oxygen is 2 to 1, the same as in water. The carbohydrates therefore are considered “hydrated carbon.” However, the atoms are not present as water molecules bound to carbon but rather carbon covalently bonded to hydrogen and hydroxyl groups (H–C–OH). Carbohydrates function as major fuel sources in cells. They also function as structural molecules in cell walls and nucleic acids. Often the carbohydrates are termed saccharides (sacchar = “sugar”) and are divided into three groups. Monosaccharides and disaccharides are simple sugars; many represent the monomers for the complex polysaccharides. Glucose, a sixcarbon sugar, is one of the most widely encountered monosaccharides ( FIGURE 2.12A ). Glucose serves as the basic supply for cellular energy in the world. Estimates vary, but many scientists estimate half the world’s carbon exists as glucose. Such sugars are synthesized from water and carbon dioxide through the process of photosynthesis. Algae and cyanobacteria are microorganisms that have the chemical machinery for this process, which is described in Chapter 6. Disaccharides (di = two) are composed of two monosaccharides held together by a covalent bond. Sucrose (table sugar) is an example. It is constructed from a glucose and fructose molecule through a dehydration synthesis reaction. Sucrose is a starting point in wine fermentations. Maltose, another disaccharide, is composed of two glucose monomers, occurs in cereal grains,
62582_CH02_035_063.pdf 48
such as barley, and is fermented by yeasts for energy ( FIGURE 2.12B ). An important by-product of the fermentation is the formation of alcohol in beer. Lactose, a third common disaccharide, is composed of the monosaccharides glucose and galactose. Lactose is known as “milk sugar” because it is the principal sugar in milk. Under controlled industrial conditions, microorganisms digest the lactose for energy; in the process, they produce the acid in yogurt, sour cream, and other sour dairy products. In the microbial world, the real significance of monosaccharides is as building blocks for polysaccharides ( FIGURE 2.12C ). Polysaccharides (poly = many) are complex carbohydrates formed by joining together hundreds of thousands of similar monomers. Covalent bonds resulting from the reactions link the units together. Starch and glycogen are common storage polysaccharides in algal and some bacteria cells, where they function as a stored energy source. Cellulose, a structural polysaccharide, is a component of the cell walls of many algae while chitin, built from chains of another glucose derivative, N-acetylglucosamine, forms the cell walls of fungi. Some bacterial cells also produce dextran that enables the cells to attach to surfaces (MICROFOCUS 2.4). In most bacterial cells, the cell wall is composed of carbohydrate and protein. The carbohydrate building block is a disaccharide of N-acetylglucosamine and N-acetylmuramic acid linked in long chains. In Chapter 4, we will examine the cell wall in more detail. CONCEPT AND REASONING CHECKS
2.12 Explain how carbohydrate monomers are assembled into energy storage and cell wall polymers. Give examples.
Lipids Are Water-Insoluble Compounds KEY CONCEPT
13. Lipids store energy and are components of membranes.
The lipids are a broad group of nonpolar organic compounds that are hydrophobic; they do not dissolve in water. Like carbohydrates, lipids are composed of carbon, hydrogen, and oxygen, but the proportion of oxygen is much lower. Lipids serve many microorganisms, but not bacterial species, as important stored energy sources.
2/4/10 2:02 PM
2.4 Major Organic Compounds of Living Organisms
(A) Monosaccharides
CH2OH
CH3
C
C=O H
CH2OH C H
O
C OH
H
C
C
H
OH C H
Glucose
H
HO
H
H
C
C
H
OH
C HO
C=O CH3
C=O R
OH
Dehydration synthesis
H2O
H2O
C=O CH3
CH2OH C
O
H Glucose OH
H
CH3
CH2OH C
HN
HC–CH3
(B) Disaccharides H
C
H
N-acetylmuramic acid (NAM)
Glucose
H2O
C O
OH O
C OH
H
C
N-acetylglucosamine (NAG)
H
OH C
HO
H
CH2OH
O
C
Dehydration synthesis
H
C
CH2OH
OH
H
C
OH
O
H
C
C
C
HO
H
HN
C HO
H
H
49
H
H
C
C
H
H
H
H
Glucose C
OH
O
C=O
O
H
OH
HN
C HO
C
C
C
C
C
H
OH
H
OH
H
H
CH2OH C
C
(NAG)
H
C
C
H C
H
H O
O
CH2OH
H
HO O OH
(NAG)
OH
H
C
C
H
HN
C H
C H
H
HN
C
C
OH
H
H
(NAG)
CH2OH H
H
C
C
C
O
H
(NAM) H
O
O
C CH2OH
OH
C
C
H
HN
O HC–CH3
C=O
C=O
CH3
R
C H
C=O CH3
(C) Polysaccharides
Some bacteria (Glucose)n
Algae (Glucose)n
Glycogen Starch
Cellulose
Some bacteria (Glucose)n
Fungi (NAG)n
Most bacteria (NAG—NAM)n
Dextran
Chitin
Peptidoglycan
Note: The polysaccharides of glucose [(Glucose)n ] vary in the carbon bonding between glucose monomers and branching of the polymer chains. FIGURE 2.12 Carbohydrate Monomers Are Built into Polymers. (A) There are many monosaccharides used by organisms that can be combined into disaccharides (B) or assembled into long polymers called polysaccharides (C). »» What type of chemical reaction is required to link glucose into a long polymer such as cellulose?
Lipids consist of a three-carbon glycerol molecule and up to three long-chain fatty acids (triglyceride) ( FIGURE 2.13A ). Each fatty acid is a long nonpolar hydrocarbon chain containing between 16 and 18 carbon atoms. Bonding of each fatty acid to the glycerol molecule occurs by a dehydration synthesis reaction between the hydroxyl and carboxyl functional groups. A fatty acid is considered to be saturated if it contains the maximum number of hydrogen atoms extending from the carbon backbone, that is, no
62582_CH02_035_063.pdf 49
double covalent bonds between carbon atoms. A fatty acid is unsaturated if it contains less than the maximum hydrogen atoms; that is, there is one or more double covalent bonds between a few carbon atoms. Another type of lipid found in cell membranes is the phospholipids, which have only two fatty acid tails attached to glycerol ( FIGURE 2.13B ). In place of the third fatty acid there is a phosphate group, representing a functional group that is polar and can actively interact with other polar
2/5/10 1:01 PM
50
CHAPTER 2
The Chemical Building Blocks of Life
2.4: Public Health
Sugars, Acid, and Dental Cavities Each of us at some time probably has feared the dentist’s drill after a cavity has been detected. Dental cavities (caries) usually result from eating too much sugar or sweets. These sugars contribute to cavity formation only in an indirect way. The real culprits are oral bacteria. Many species of microorganisms normally inhabit the mouth (see figure). Some of the bacterial species, along with saliva and food debris, form a gummy layer called dental plaque, a type of biofilm mentioned in Chapter 1. If not removed, plaque accumulates on the grooved chewing surfaces of back molars and at the gum line. Plaque starts to accumulate within 20 minutes after Cells of Streptococcus mutans, one of the major agents eating. As the bacterial cells multiply, they digest the in dental plaque that produces cavity-causing acid. sucrose (table sugar) in sweets for energy. The metabo- (Bar = 10 µm.) lism of sucrose has two consequences. Some bacterial cells produce dextran, an adhesive polysaccharide that increases the thickness of plaque. They also produce lactic acid as a by-product of sugar metabolism. Being trapped under the plaque, the acid is not neutralized by the saliva. When the pH drops to 5.5 or lower, the hydrogen ions start to dissolve or demineralize the dental enamel. Over time, a depression or cavity forms. When the soft dental tissues underneath the enamel are reached, toothache pain results from the exposure of the sensitive nerve endings in the soft tissues. Good oral hygiene, including flossing, brushing, and regular professional dental cleaning, can keep plaque to a minimum. At home, watch what you eat. Consuming sugary foods with a meal or for dessert is less likely to cause cavities because the increased saliva produced while eating helps wash food debris off the tooth surface and neutralize any acids produced. However, snacking on sugary foods that are sticky, like caramel, toffee, dried fruit, or candies, allows the food debris to cling to teeth for a longer time, causing the formation of more plaque and providing a continuous acid attack on your teeth. No wonder cavities are one of the most prevalent infectious diseases, second only to the common cold. More detailed information on tooth decay is provided in Chapter 11.
molecules. We will have more to say about phospholipids and membranes in the next chapter. Some bacterial toxins are a combination of polysaccharide and lipid (TEXTBOOK CASE 2). Other types of lipids include the waxes and sterols. Waxes are composed of long chains of fatty acids and form part of the cell wall in Mycobacterium tuberculosis, the bacterium causing tuberculosis. Sterols, such as cholesterol, are very different from lipids and are included with lipids solely because they too are hydrophobic molecules ( FIGURE 2.13C ). Sterols, composed of several rings of carbon atoms with side chains, stabilize membranes of algae, protozoa, and fungi, and the bacterium Mycoplasma. Sterol-like molecules are used in most bacterial cells to control membrane stability and flexibility.
62582_CH02_035_063.pdf 50
CONCEPT AND REASONING CHECKS
2.13 Why are lipids not considered polymers in the sense that polysaccharides are?
Nucleic Acids Are Large, InformationContaining Polymers KEY CONCEPT
14. Nucleic acids store, transport, and control hereditary information.
The nucleic acids, among the organic compounds found in organisms, are organic compounds composed of carbon, hydrogen, oxygen, nitrogen, and phosphorus atoms. Two types function in all living things: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
2/4/10 2:02 PM
2.4 Major Organic Compounds of Living Organisms
51
Carboxyl group H
CH3
O
H
C
OH + HO
H
C
OH
H
C
OH
C
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
N+
H3C
CH3
CH2
Saturated fatty acid Hydroxyl group
H
H
C
O Dehydration synthesis
C
Phosphate group
3 H2O
O
C
H2C CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH3
O
O
O O
O
C
C
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
C
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH
CH
CH
2
H
2
A LIPID
Covalent bonds
CH
CH
2
CH
2
CH
2
CH3
CH
3
(A)
CH2
CH3 CH3 CH
CH2
CH2 CH2 CH2 CH
CH3
CH2 CH2
CH3
C
Symbol
Tails
CH CH2 CH2 CH2 CH2
CH2 CH2
CH3
CH2 CH2
A STEROL, CHOLESTEROL
(C) HO
CH2
CH
O
Unsaturated fatty acid C
O
P
Glycerol
O H
–O
O O
O
Head
CH2
H Glycerol
H
CH3
(B)
CH2 Fatty acids
CH2 CH2 CH3
CH3 A PHOSPHOLIPID
FIGURE 2.13 Lipid and Lipid-Related Compounds. (A) A lipid, such as a triglyceride, consists of glycerol and fatty acids. (B) A phospholipid consists of glycerol attached to two fatty acids and a phosphate head group. Inset: The symbol for the structure of a phospholipid. (C) The sterol cholesterol. »» Why are all these compounds considered “lipids”?
Both DNA and RNA are macromolecules composed of repeating monomers called nucleotides ( FIGURE 2.14A ). Each nucleotide has three components: a sugar molecule, a phosphate group, and a nitrogenous base. The sugar in DNA is deoxyribose, while in RNA it is ribose. The nitrogenous bases are nitrogen-containing compounds. In DNA, the purine bases are adenine (A) and guanine (G), while the pyrimidine bases are cytosine (C) and thymine (T). In RNA, adenine, guanine, and cytosine also are present, but uracil (U) is found instead of thymine. Nucleotides are covalently joined through dehydration synthesis reactions between the sugar of one nucleotide and the phosphate of the adjacent nucleotide to eventually form a polynucleotide ( FIGURE 2.14B ). DNA. In 1953, James Watson, Francis Crick, Rosalind Franklin, and Maurice Wilkins published
62582_CH02_035_063.pdf 51
papers describing how a complete DNA molecule consists of two polynucleotide strands opposed to each other in a ladder-like arrangement ( FIGURE 2.14C ). Guanine and cytosine line up opposite one another, and thymine and adenine oppose each other in the two strands. The complementary base pairs in the double-stranded DNA molecule are held together by hydrogen bonds. The double strand then twists to form a spiral arrangement called the DNA double helix. DNA is the genetic material in all living organisms. The genetic information exists in discrete units called genes, which are sequences of nucleotides that encode information to regulate and synthesize proteins (Chapter 8). In bacterial and archaeal cells, these genes are found on a single circular chromosome, while in most eukaryotic microbes, the genes are located on several linear chromosomes. Genes only
Chromosome: A DNA molecule containing the hereditary information in the form of genes.
2/4/10 2:02 PM
52
CHAPTER 2
The Chemical Building Blocks of Life
Textbook
CASE
2
An Outbreak of Salmonella Food Poisoning 1
During the morning of October 17, 1991, a restaurant employee prepared a Caesar salad dressing, cracking fresh eggs into a large bowl containing olive oil.
2
Anchovies, garlic, and warm water then were mixed into the eggs and oil.
3
The warm water raised the temperature of the mixture slightly before the dressing was placed in the refrigerator.
4
Later that day, the Caesar dressing was placed at the salad bar in a cooled compartment having a temperature of about 60°F. The dressing remained at the salad bar until the restaurant closed, a period of 8 to 10 hours. During that time, many patrons helped themselves to the Caesar salad.
5
Within three days, fifteen restaurant patrons experienced gastrointestinal illness. Symptoms included diarrhea, fever, abdominal cramps, nausea, and chills. Thirteen sought medical care, and eight (all elderly over 65 years of age) required intravenous rehydration.
6
From the stool samples of all 13 patrons who sought medical attention, bacteria were cultured (see figure) and laboratory tests identified Salmonella enterica serotype Enteritidis as the causative agent (see Chapter 11).
7
S. enterica serotype Enteritidis produces a lipopolysaccharide toxin that causes the symptoms experienced by all the affected patrons.
Questions: (Answers can be found in Appendix D.) A.
What might have been the origin of the bacterial contamination?
B.
What conditions would have encouraged bacterial growth?
C.
How could the outbreak have been prevented?
D.
What types of organic compounds form the lipopolysaccharide toxin?
E.
Why did so many of the elderly patrons develop a serious illness?
A culture plate of Salmonella.
For additional information see http://www.cdc.gov/ncidod/dbmd/diseaseinfo/salment_g.htm.
carry the information to regulate or synthesize proteins. RNA. Besides having uracil as a base and ribose as the sugar, RNA molecules in cells are single-stranded polynucleotides. Biologists once viewed RNAs as the intermediaries, involved in carrying gene information or as structural mol-
62582_CH02_035_063.pdf 52
ecules needed to construct proteins. This certainly is a major role for RNA but not the only role. In viruses such as the influenza and measles viruses, RNA is the genetic information, not DNA. Other RNA molecules play key roles in regulating gene activity, while several small RNAs control various cellular processes in microbial cells.
2/4/10 2:02 PM
2.4 Major Organic Compounds of Living Organisms
Phosphate group
PO4==
Base
O
CH2 C H
Sugar C
G T
A
H
C OH
C
C H
HOCH2
H
G
C
G
C
H
C
C
C
H
O
H
Covalent bond
G
HOCH2
C
C
H
H
H
H
H
C
C
H
OH
C
H
OH
In RNA
(A) (A)
H
C
C
OH
H
H
(B) (B)
T
PYRIMIDINES
PURINES C
G
NH2
G
C
A
T
H
O
A
T
N
C C
N
H H
H —C N
One base pair P
T T TT
A
N
T
Sugar
D
N
P
Phosphate group
D
C C
N
H
C N
G
C
One nucleotide
O
N H
H
Thymine (T) (DNA only)
Adenine (A) P
C
C
C
H
N
C C
O
N
Cytosine (C)
H3C
H
D
C
C
O
H —C N
G
N
H
NH2
NH2
D
C
C C
Guanine (G) P
A
C
C
H
D
D
P
H
T
A A
P
C
H
G
C
P
Base
O
CH2
C
C
H
PO3=
OH
H
In DNA
C
O
C OH
C H
RIBOSE (R)
OH
C
A
T
O
Base
O
CH2
H
DEOXYRIBOSE (D) C
G
H
PO4==
53
O H
D
C C
H N
D P Hydrogen bond
(C) (C)
DNA DOUBLE HELIX
C
C H
N
O
H
Uracil (U) (RNA only)
FIGURE 2.14 The Molecular Structures of Nucleotide Components and the Construction of DNA. (A) The sugars in nucleotides are ribose and deoxyribose, which are identical except for one additional oxygen atom in RNA. The nitrogenous bases include adenine and guanine, which are large purine molecules, and thymine, cytosine, and uracil, which are smaller pyrimidine molecules. Note the similarities in the structures of these bases and the differences in the side groups. (B) Nucleotides are bonded together by dehydration synthesis reactions. (C) The two polynucleotides of DNA are held together by hydrogen bonds between adenine (A) and thymine (T) or guanine (G) and cytosine (C) to form a double helix. »» If a segment of one strand of DNA has the bases TTAGGCACG, what would be the sequence of bases in the complementary strand?
The nucleic acids cannot be altered without injuring the organism or killing it. Ultraviolet light damages DNA, and thus it can be used to control microbes on an environmental surface. Chemicals, such as formaldehyde, alter the nucleic acids of viruses and can be used in the preparation of vaccines. Certain antibiotics interfere with DNA or RNA function and thereby kill bacteria.
62582_CH02_035_063.pdf 53
Chapters 8 and 9 are devoted to the role of nucleic acids in the genetics of microbes and how the genetic information can be manipulated for medical or industrial applications. It also is important to point out that nucleotides have other roles in cells besides being part of DNA or RNA. Adenine nucleotides with three attached phosphate groups form adenosine
2/4/10 2:02 PM
54
CHAPTER 2
The Chemical Building Blocks of Life
triphosphate (ATP), which is the cellular energy currency in all cells. Other nucleotides can be part of the structure of some enzymes, while independent, modified nucleotides called cyclic adenosine monophosphate (cAMP) act as chemical signals in many microbes. CONCEPT AND REASONING CHECKS
2.14 How does the structure of DNA differ from that of RNA?
Proteins Are the Workhorse Polymers in Cells KEY CONCEPT
15. Proteins fold into diverse three-dimensional shapes.
Proteins are the most abundant organic compounds in microorganisms and all living organisms, making up about 58% of the cell’s dry weight. The high percentage of protein indicates their essential and diverse roles. Many proteins function as structural components of cells and cell walls, and as transport agents in membranes. A large number of proteins serve as enzymes.
Proteins are composed of carbon, hydrogen, oxygen, nitrogen, and, usually, sulfur atoms. Proteins are polymers built from nitrogencontaining monomers called amino acids (MICROFOCUS 2.5). At the center of each amino acid is a carbon atom attached to two functional groups: an amino group (–NH2) and a carboxyl group (–COOH) ( FIGURE 2.15A ). Also attached to the carbon is a side chain, called the R group. Each of the 20 amino acids differs only by the atoms composing the R group. These side chains, many being functional groups, are essential in determining the final shape, and therefore function, of the protein. In protein formation, two amino acids (sometimes called peptides) are joined together by a covalent bond when the amino group of one amino acid is linked to the carboxyl of another amino acid through a dehydration synthesis reaction (Figure 2.15A). Repeating the reaction hundreds of times produces a long chain of amino acids called a polypeptide and the covalent bond therefore is called a peptide bond. How the amino acids are slotted into position to build a polypeptide is a complex process discussed in Chapter 8.
2.5: Environmental Microbiology
Triple Play—Bacteria to Plants to Humans About 80% of the atmosphere is nitrogen gas (N2). Nitrogen gas, as you have discovered, contains a triple covalent bond that is very hard to break. Yet, one of the essential elements in nucleic acids and proteins in all organisms is nitrogen. So, how can the gaseous form of nitrogen be converted into a form that can be used to make essential biological compounds? The most important biological process to break the triple covalent bond in N2 is accomplished by a few bacterial species commonly found in root nodules of pea and bean plants (legumes) or in the soil close to the plant roots. These bacterial organisms contain an enzyme, called nitrogenase, which converts N2 into ammonia that then can be further converted by microbial action into forms used by legumes and other plants. The process is called nitrogen fixation: N2 → NH3 (ammonia)
In contact with water, the gaseous ammonia is converted to ammonium ions (NH4+), which serve as a source of nitrogen for nucleic acid and amino acid synthesis by bacterial cells and plants. We then get our nitrogen for amino acids and nucleotides from eating plants or through exchange reactions of carbohydrate metabolism that convert sugars into nucleotides or amino acids. Chapter 26 describes the nitrogen cycle in more detail. The important point to remember in all this chemistry is that the initial fixation of nitrogen is dependent on bacterial chemistry. In fact, without nitrogen fixation, life as we know it would not exist.
62582_CH02_035_063.pdf 54
2/4/10 2:02 PM
2.4 Major Organic Compounds of Living Organisms
Nonionized form
H
H
Amino group
Peptide bond
CH2OH
O
Dehydration synthesis
OH +
N — C — C -— OH H
R group
H
H
H —N—C—C H
CH3
CH2OH
O
OH
N—C—C — N—C—C O
H
55
H
H
CH3
O
H
H2O
R group
Alanine (Amino acid)
Water
Serine (Amino acid)
Dipeptide Dehydration Syntheses
(A)
H H+ N H
H
H
R
N
C
H
H
N
C
C
R
O
H
R
N
C
H
H
N
C
C
R
O
H
R
N
C
O C
C
R
O
C
H O
C
H O
C
O–
H
(B) Primary structure: polypeptide chain C
C C O
H
R
H
N
H C O C
R H C
N H C H
O C
C O
H N
C O R
R
O C R
Pleated sheet
H
H
N H N
C
C O H N H C R H C R N H C H
Hydrogen bond
N
N H O C R C H
C O H N N C O R H C C H R
H
H
C C
N
N
C
C
H
O
C H O O C H HO H H C C N H C R C N R O O R H N H H C R H C C N C O C N C H O O H C R C N O H Alpha Random C R N helix coil O H
N
R
R H OH C R C C N
H
C R
H C
N
R
C
R C
C
O
H
O
N
(C) Secondary structure: pleated sheet, alpha helix, and random coil Ionic bond CH2 CH2
CH2
O
CH2 NH3+ –O
C
CH2
Hydrogen bond O CH2
(D) Tertiary structure: bonding between R groups on amino acids
Disulfide bridge (covalent bond)
OH
+
CH2 S
–
O C
S
CH2
CH2
Polypeptide chain Bonds associated with tertiary structure
(E) Quaternary structure: two or more folded polypeptides FIGURE 2.15 Amino Acids and Their Assembly into Polypeptides. (A) Amino acids are linked together by dehydration synthesis reactions. (B) As they get longer, the sequence of amino acids forms the primary structure, which takes on a secondary structure (C). (D) The whole polypeptide folds into a tertiary structure through bonding between R groups. Some proteins consist of more than one polypeptide, forming a quaternary structure (E). »» Explain why each and every protein must have three or four levels of folding.
62582_CH02_035_063.pdf 55
2/4/10 2:02 PM
56
CHAPTER 2
The Chemical Building Blocks of Life
However, the sequence of amino acids is critical because a single amino acid improperly positioned may change the three-dimensional shape and function of the protein. Because proteins have tremendously diverse roles, they come in many sizes and shapes. The final shape depends on several factors associated with the amino acids. The sequence of amino acids in the polypeptide represents the primary structure ( FIGURE 2.15B ). Each protein that has a different function will have a different primary structure. However, the sequence of amino acids alone is not sufficient to confer function. Many polypeptides have regions folded into a corkscrew shape or alpha helix. These regions represent part of the protein’s secondary structure ( FIGURE 2.15C ). Hydrogen bonds between amino groups (–NH) and carbonyl groups (–C=O) on nearby amino acids maintain this structure. A secondary structure also may form when the hydrogen bonds cause portions of the polypeptide chain to zigzag in a flat plane, forming a pleated sheet. Other regions may not interact and remain in a random coil. Many polypeptides also have a tertiary structure ( FIGURE 2.15D ). Such a three-dimensional (3-D) shape of a polypeptide is folded back on itself much like a spiral telephone cord. Ionic and hydrogen bonds between R groups on amino acids in proximity to each other help form and maintain the polypeptide in its tertiary structure. In addition, covalent bonds, called disulfide bridges, between sulfur atoms in R groups are important in stabilizing tertiary structure. The ionic and hydrogen bonds helping hold a protein in its 3-D shape are relatively weak associations. As such, these interactions in a pro-
62582_CH02_035_063.pdf 56
tein are influenced by environmental conditions. When subjected to heat, pH changes, or certain chemicals, these bonds may break, causing the polypeptide to unfold and lose its biological activity. This loss of 3-D shape is referred to as denaturation. For example, the white of a boiled egg is denatured egg protein (albumin) and cottage cheese is denatured milk protein. Should enzymes be denatured, the important chemical reactions they facilitate will be interrupted and death of the organism may result. Viruses also can be destroyed by denaturing the proteins found on and in the virus. Now you should understand the importance of buffers in cells; by preventing pH shifts, they prevent protein denaturation and maintain protein function. Many proteins are single polypeptides. However, other proteins contain two or more polypeptides to form the complete and functional protein; this is called the quaternary structure ( FIGURE 2.15E ). Each polypeptide chain is folded into its tertiary structure and the unique association between separate polypeptides produces the quaternary structure. The same types of chemical bonds are involved as in tertiary structure. The four major classes of organic compounds are summarized in FIGURE 2.16 . MICROFOCUS 2.6 looks at the origins of the monomers and polymers discussed in this chapter, while MICROINQUIRY 2 uses the radioactive attributes of two chemical elements to discover whether protein or DNA is the genetic material. CONCEPT AND REASONING CHECKS
2.15 Why does a denatured protein no longer have biological activity?
2/4/10 2:02 PM
2.4 Major Organic Compounds of Living Organisms
Neutrons
57
Electrons
Protons
are built into
Atoms that form elements, including
Carbon
Oxygen
Hydrogen
Nitrogen
which can share electrons in covalent bonds to form Organic molecules that include
Large organic compounds such as
CARBOHYDRATES
LIPIDS
NUCLEIC ACIDS
PROTEINS
that are built from
that are built from
that are built from
that are built from
Nucleotides
Amino Acids
and are assembled into
and are assembled into a
Monosaccharides Glycerol
Fatty acids
and can be assembled into and can be assembled into Polysaccharides
Primary structure
such as those composed of
N-acetylglucosamine
N-acetylmuramic acid
Triglycerides
Waxes
DNA
RNA
which arranges into a
Secondary structure
glucose
Phospholipids and then folds into a Lipid-related molecules
Chitin
Tertiary structure
Peptidoglycan including
Glycogen
Starch
Cellulose
Dextran
two or more of which may link into a
Sterols Quaternary structure
FIGURE 2.16 A Concept Map Summarizing Atoms, Elements, and Organic Compounds. »» What elements make up each of the four large organic compounds?
62582_CH02_035_063.pdf 57
2/4/10 2:02 PM
58
CHAPTER 2
The Chemical Building Blocks of Life
2.6: Evolution
Generating Life—Today (Part II) In MicroFocus 1.2, we discussed the idea of creating life artificially—through the discipline called synthetic biology. The idea concerns the ability to create “new” life in a test tube. As you discovered, some scientists already have made initial strides in this direction by reconstructing a virus from scratch. Others are trying to design “new organisms” by piecing together specific cellular and genetic parts taken from various microbes. So far, these “bioreactors” do not represent cellular life. However, the potential to build synthetic life also opens up the possibility of assembling, in the lab, a “primordial organism” similar to what might have started life on Earth. Chemical precursors of life may have involved gases like formaldehyde, methane, water, hydrogen cyanide, and ammonia. As the Earth formed, these “molecular seeds” were brought together and concentrated at the Earth’s surface. Through a process of chemical evolution, chemical reactions between these precursors might have produced larger and more complicated compounds. If the products could be stabilized in some way, they could form into simple sugars, nucleotides, and amino acids—the building blocks of carbohydrates, nucleic acids, and proteins. In fact, in the 1950s Stanley Miller and Harold Urey carried out experiments demonstrating that such chemical evolution could occur. Mixing the primeval gases with an energy source produced within days a few amino acids and nitrogenous bases. A more recent 2008 re-examination of these experiments using conditions similar to a volcanic eruption found additional organic molecules, including 22 amino acids. Most scientists today believe that RNA was the original “genetic information” in primitive cells and could also act as an enzyme (see MicroFocus 6.2, page 164). Such ribozymes may have arose from sugars, such as ribose, combining with the nitrogenous bases (A, G, C, and U). Along with phosphate, which existed in volcanic areas and other deposits on Earth, the bases and sugars could be linked together into nucleotides, which then would form into long chains of RNA. So, RNA-based life forms may have spread and evolved on Earth for millions of years. Generating or recreating such life today may be the way to verify the hypothesis. Scientists, such as John Szostak and his team at Harvard Medical School, have mixed RNA nucleotides with clay and then added fatty acids. The spontaneous result was a primordial cell—a lipid (membrane) bubble containing short RNA polynucleotides. A key experiment is to demonstrate that the RNAs can carry out simple chemical reactions such as hydrolysis or dehydration synthesis reactions by acting as a ribozyme. The researchers have not created synthetic life—yet. However, the experiments do indicate their ideas have promise and may go a long way toward telling scientists how life originated on Earth.
Electrical spark (lightning) H20 NH3
CH4 H2
CO Gases (primitive atmosphere)
Direction of water vapor circulation
+ Electrodes –
To vacuum pump
Condenser Cold water Sampling probe Sampling probe Water (ocean) Cooled water (containing organic compounds) Trap
62582_CH02_035_063.pdf 58
Heat source
2/4/10 2:02 PM
2.4 Major Organic Compounds of Living Organisms
59
INQUIRY 2
Is Protein or DNA the Genetic Material? In the early 1950s, there were scientists who still debated whether protein or DNA was the genetic material in cells. To settle the controversy, in 1952 Alfred Hershey and Martha Chase carried out a series of experiments to trace the fates of protein and DNA, and in so doing hopefully settle the debate. It was known that some viruses that infect bacterial cells were composed of DNA and protein, and that the virus genetic material needed to enter the bacterial cells to direct the production of more viruses. Because the viruses left a viral coat on the surface, what actually entered the cells—protein or DNA? Whichever did must be the genetic material. Several biologically important elements have isotopes that are radioactive. The table to the right lists a few such elements. Hershey and Chase decided to radioactively label the viruses such that the protein and DNA could be identified by their unique radioactive profiles.
B. After infection, the C. The mixture is D. Radioactivity in the A. Viruses containing radioactive sulfur (35S) mixture is placed in centrifuged in a test pellet and liquid is a blender to separate tube to separate the measured. or (32P) are mixed viruses outside the cells from the viruses. with bacteria so that cells from the bacterial infection can occur. cells.
DNA Protein Bacterial virus Experiment 1: Viruses are produced that have radioactive sulfur (35S) incorporated into the virus protein.
2d. If protein is the genetic material, Element Common Form Radioactive Form which isotope should 1H 3H (tritium) be associated with Hydrogen 12C 14C the bacterial cells? Carbon 31P 32P 2e. If DNA is the genetic Phosphorus material, which 32S 35S Sulfur isotope should be associated with the 2a. Which of the radioactive bacterial cells? elements would only label 2f. So, did the experiments carried protein? out by Hershey and Chase 2b. Which of the radioactive support or refute Avery’s work elements would only label DNA? that DNA was the genetic 2c. Could 3H or 14C have been used? material? Explain. Answers can be found on the student The Hershey and Chase experiment is companion Web site in Appendix D. outlined in the figure below. From the two experiments, they could then measure the radioactivity in the pellet (bacterial cells) and the fluid (virus coats) and determine which radioactive isotope was associated with the bacterial cells.
Some Radioactive Isotopes
Bacterial cell
Empty protein shell
Experiment 1 results: All radioactivity is 35S and it is detected in the liquid.
Centrifuge Pellet (bacterial cells and contents)
Experiment 2: Viruses are produced that have radioactive phosphorus (32P) incorporated into the virus DNA.
Experiment 2 results: All radioactivity is 32P and it is detected in the pellet (bacterial cells).
Centrifuge Pellet
Is Protein or DNA the Genetic Material? The Hershey-Chase experiment.
62582_CH02_035_063.pdf 59
2/4/10 2:02 PM
60
CHAPTER 2
The Chemical Building Blocks of Life
SUMMARY OF KEY CONCEPTS 2.1 The Elements of Life 1. Atoms consist of an atomic nucleus (with neutrons and positively charged protons) surrounded by a cloud of negatively charged electrons. 2. Isotopes of an element have different numbers of neutrons. Some unstable ones, called radioisotopes, are useful in research and medicine. If an atom gains or loses electrons, it becomes an electrically charged ion. Many ions are important in microbial metabolism. 3. Each electron shell holds a maximum number of electrons. Chemical bonding occurs between atoms to fill the outer shells with electrons. 2.2 Chemical Bonding 4. Ionic bonds result from the attraction of oppositely charged ions. Compounds called salts result. 5. Most atoms achieve stability through a sharing of electrons, forming covalent bonds. The equal sharing of electrons produces nonpolar molecules (no electrical charge). Atomic interactions between hydrogen and oxygen (or nitrogen) produce unequal sharing of electrons, which generates polar molecules (have electrical charges). 6. Separate polar molecules, like water, are electrically attracted to one another and form hydrogen bonds, involving positively charged hydrogen atoms and negatively charged oxygen (or nitrogen) atoms. 7. In a chemical reaction, the atoms in the reactant change bonding partners in forming one or more products. Two common chemical reactions in cells are dehydration synthesis reactions and hydrolysis reactions. In these reactions, the number of atoms is the same in the reactants and products. 2.3 Water, pH, and Buffers 8. All chemical reactions in organisms occur in liquid water. Being polar, water has unique properties. These include its role as a
solvent, as a chemical reactant, and as a factor to maintain a fairly constant temperature. 9. Acids donate hydrogen ions (H+) while bases acquire H+ from a solution. The pH scale indicates the number of H+ in a solution and denotes the relative acidity of a solution. 10. Buffers are a mixture of a weak acid and a weak base that maintain acid/base balance in cells. Excess H+ can be absorbed by the base and too few H+ can be provided by the acid. 2.4 Major Organic Compounds of Living Organisms 11. The building of large organic compounds depends on the functional groups found on the building blocks called monomers. Functional groups on monomers interact through dehydration synthesis reactions to form a covalent bond between monomers. 12. Carbohydrates include monosaccharides such as glucose that are linked into polysaccharides that represent energy and structural molecules. 13. Lipids serve as energy sources, but their major role is as phospholipids in cell membranes. Other lipids include the sterols. 14. The genetic instructions for living organisms are composed of two types of nucleic acids: deoxyribonucleic acid (DNA), which stores and encodes the hereditary information; and ribonucleic acid (RNA), which transmits the information to make proteins, controls genes, and helps regulate genetic activity. 15. Proteins are chains of amino acids connected by peptide bonds. Proteins are used as enzymes and as structural components of cells. Primary, secondary, and tertiary structures form the functional shape of many proteins, which can unfold by denaturation. Many proteins are the result of two or more polypeptides bonding together (quaternary structure).
LEARNING OBJECTIVES After understanding the textbook reading, you should be capable of writing a paragraph that includes the appropriate terms and pertinent information to answer the objective. 1. Contrast the properties of protons, neutrons, and electrons. Assess the importance of these atomic particles to atomic structure. 2. Summarize how elements can form isotopes and ions. 3. Describe the basis for chemical bonding. 4. Distinguish between ions and ionic bonds. 5. Compare and contrast polar molecules with nonpolar molecules. 6. Explain how hydrogen bonds form. 7. Describe the differences between a dehydration synthesis reaction and a hydrolysis reaction.
62582_CH02_035_063.pdf 60
8. 9. 10. 11. 12.
Identify several properties of water. Contrast an acid and a base. Assess the importance of buffers to chemical reactions. Identify the role of functional groups on organic molecules. List the polysaccharides found in cells or organisms. Explain their role in microorganisms. 13. Explain how dehydration synthesis forms a lipid. Contrast between saturated and unsaturated fatty acids. 14. Summarize how DNA and RNA differ in structure and function. 15. Show how amino acids link together and name the specific type of bond formed between these amino acids, and compare the four levels of protein structure.
2/4/10 2:02 PM
Step A: Self-Test
61
STEP A: SELF-TEST Each of the following questions is designed to assess your ability to remember or recall factual or conceptual knowledge related to this chapter. Read each question carefully, then select the one answer that best fits the question or statement. Answers to even-numbered questions can be found in Appendix C. 1. These positively charged particles are found in the atomic nucleus. A. Protons only B. Electrons only C. Protons and neutrons D. Neutrons only 2. Atoms of the same element that have different numbers of neutrons are called ______. A. isotopes B. ions C. isomers D. inert elements 3. If an element has two electrons in the first shell and seven in the second shell, the element is said to be what? A. Unstable B. Unreactive C. Stable D. Inert 4. For ______ bonding, one or more electrons are transferred between atoms. A. hydrogen B. ionic C. peptide D. covalent 5. The covalent bonding of atoms forms a/an A. molecule. B. ion. C. element. D. isomer. 6. The ______ bond is a weak bond that can exist between poles of adjacent molecules. A. hydrogen B. ionic C. polar covalent D. nonpolar covalent 7. In what type of chemical reaction are the products of water removed during the formation of covalent bonds? A. Hydrolysis B. Ionization C. Dehydration synthesis D. Decomposition
62582_CH02_035_063.pdf 61
8. A ______ dissolves in water. A. solvent B. hydrophobic molecule C. solute D. nonpolar molecule 9. The pH scale relates the measure of ______ of a chemical substance. A. ionization B. denaturation C. acidity D. buffering 10. Which one of the following statements about buffers is false? A. They work inside cells. B. They consist of a weak acid and weak base. C. They prevent pH shifts. D. They enhance chemical reactions. 11. A functional group designated—COOH is known as a/an A. carboxyl. B. carbonyl. C. amino. D. hydroxyl. 12. Which one of the following is NOT a polysaccharide? A. Chitin B. Glycogen C. Cellulose D. Lipid 13. How do the lipids differ from the other organic compounds? A. They are the largest organic compounds. B. They are nonpolar compounds. C. They have no biological role. D. They are not used for energy storage. 14. Both DNA and RNA are composed of ______. A. polynucleotides B. genes C. polysaccharides D. polypeptides 15. The ______ structure of a protein is the sequence of amino acids. A. primary B. secondary C. tertiary D. quaternary
2/4/10 2:02 PM
62
CHAPTER 2
The Chemical Building Blocks of Life
STEP B: REVIEW Answers to even-numbered questions can be found in Appendix C. 16. Construct a concept map for chemical bonds using the following terms: hydrocarbon nonpolar covalent bonds hydrogen bonds polar covalent bonds ionic bonds salts methane water NaCl 17. Use the following list to identify the structures (i–v) drawn below. A. Amino acid B. Monosaccharide C. Nucleotide D. Lipid E. Disaccharide F. Polysaccharide G. Sterol 18. Identify any and all functional groups on each structure (i–v). (i) CH OH 2
C H
H
C
H
C
C
HO
C H
HO
C
C
C
OH
OH
H
OH
H
C H
O
CH2OH
O
H
(ii)
CH2OH O
O
H
H
C
O
H
C
O
H
C
O
C
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH3
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH2
CH
CH
O C
CH2
CH3
O C
CH
2
H
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
3
(iii)
CH3 CH3 CH CH3
CH2 CH2 CH2 CH CH3
CH3
HO
(iv)
CH2OH C H
O H
H
C
C
HO
(v)
H
C
C
H
OH
OH
H
H N H
OH
C
C
O OH
CH2OH
62582_CH02_035_063.pdf 62
2/4/10 2:02 PM
Step D: Questions for Thought and Discussion
63
STEP C: APPLICATIONS Answers to even-numbered questions can be found in Appendix C. 19. You want to grow a bacterial species that is acid-loving; that is, it grows best in very acid environments. Would you want to grow it in a culture that has a pH of 2.0, 6.8, or 11.5? Explain. 20. You are given two beakers of a broth growth medium. However, only one of the beakers of broth is buffered. How could you determine which
beaker contains the buffered broth solution? Hint: You are provided with a bottle of concentrated HCl and pH papers that indicate a solution’s pH. 21. The microbial community in a termite’s gut contains the enzyme cellulase. How does this benefit the termite and the termite’s microbial community?
STEP D: QUESTIONS FOR THOUGHT AND DISCUSSION Answers to even-numbered questions can be found in Appendix C. 22. Propose a reason why organic molecules tend to be so large. 23. Bacterial cells do not grow on bars of soap even though the soap is wet and covered with bacterial organisms after one has washed. Explain this observation. 24. Suppose you had the choice of destroying one class of organic compounds in bacterial cells to prevent their spread. Which class would you choose? Why? 25. Milk production typically has the bacterium Lactobacillus added to the milk before it is delivered to market. This organism produces lactic
acid. (a) Why would this organism be added to the milk and (b) why was it chosen? 26. The toxin associated with the foodborne disease botulism is a protein. To avoid botulism, home canners are advised to heat preserved foods to boiling for at least 12 minutes. How does the heat help? 27. Justify Isaac Asimov’s quote, “The significant chemicals in living tissue are rickety and unstable, which is exactly what is needed for life,” to the atoms, molecules, and organic compounds described in this chapter.
HTTP://MICROBIOLOGY.JBPUB.COM/9E The site features eLearning, an online review area that provides quizzes and other tools to help you study for your class. You can also follow useful links for in-depth information, read more MicroFocus stories, or just find out the latest microbiology news.
62582_CH02_035_063.pdf 63
2/4/10 2:02 PM
3 Chapter Preview and Key Concepts
3.1 The Bacteria/Eukaryote Paradigm 1. Bacterial cells undergo biological processes as complex as in eukaryotes. 2. There are organizational patterns common to all living organisms. 3. Bacteria and eukaryotes have distinct subcellular compartments.
3.2 Classifying Microorganisms 4. Organisms historically were grouped by shared characteristics. 5. The three-domain system shows the taxonomic relationships between living organisms. MICROINQUIRY 3: The Evolution of Eukaryotic Cells 6. The binomial system identifies each organism by a universally accepted scientific name. 7. Species can be organized into higher, more inclusive groups. 8. Identification and classification of microorganisms may use different methods.
3.3 Microscopy 9. Metric system units are the standard for measurement. 10. Light microscopy uses visible light to magnify and resolve specimens. 11. Specimens stained with a dye are contrasted against the microscope field. 12. Different optical configurations provide detailed views of cells. 13. Electron microscopy uses a beam of electrons to magnify and resolve specimens.
Concepts and Tools for Studying Microorganisms We think we have life down; we think we understand all the conditions of its existence; and then along comes an upstart bacterium, live or fossilized, to tweak our theories or teach us something new. —Jennifer Ackerman in Chance in the House of Fate (2001) The oceans of the world are a teeming but invisible forest of microorganisms and viruses. For example, one liter of seawater contains more than 25,000 different bacterial species. A substantial portion of these marine microbes represent the phytoplankton (phyto = “plant”; plankto = “wandering”), which are floating communities of cyanobacteria and eukaryotic algae. Besides forming the foundation for the marine food web, the phytoplankton account for 50% of the photosynthesis on earth and, in so doing, supply about half the oxygen gas we and other organisms breathe. While sampling ocean water, scientists from MIT’s Woods Hole Oceanographic Institution discovered that many of their samples were full of a marine cyanobacterium, which they eventually named Prochlorococcus. Inhabiting tropical and subtropical oceans, a typical sample often contained more than 200,000 (2 × 105) cells in one drop of seawater. Studies with Prochlorococcus suggest the organism is responsible for almost 50% of the photosynthesis in the open oceans ( FIGURE 3.1 ). This makes Prochlorococcus the smallest and most abundant marine photosynthetic organism yet discovered.
6464
62582_CH03_064_096.pdf 64
2/4/10 1:59 PM
CHAPTER 3
Concepts and Tools for Studying Microorganisms
65
FIGURE 3.1 Photosynthesis in the World’s Oceans. This global satellite image (false color) shows the distribution of photosynthetic organisms on the planet. In the aquatic environments, red colors indicate high levels of chlorophyll and productivity, yellow and green are moderate levels, and blue and purple areas are the “marine deserts.” »» How do the landmasses where photosynthesis is most productive (green) compare in size to photosynthesis in the oceans?
The success of Prochlorococcus is due, in part, to the presence of different ecotypes inhabiting different ocean depths. For example, the high sunlight ecotype occurs in the surface waters while the low-light type is found below 50 meters. This latter ecotype compensates for the decreased light by increasing the amount of cellular chlorophyll that can capture the available light. In terms of nitrogen sources, the high-light ecotype only uses ammonium ions (NH4+) (see MicroFocus 2.5). At increasing depth, NH4+ is less abundant so the low-light ecotype compensates by using a wider variety of nitrogen sources. These and other attributes of Prochlorococcus illustrate how microbes survive through change. They are of global importance to the functioning of the biosphere and, directly and indirectly, affect our lives on Earth. Once again, we encounter an interdisciplinary group of scientists studying how microorgan-
62582_CH03_064_096.pdf 65
isms influence our lives and life on this planet. Microbial ecologists study how the phytoplankton communities help in the natural recycling and use of chemical elements such as nitrogen. Evolutionary microbiologists look at these microorganisms to learn more about their taxonomic relationships, while microscopists, biochemists, and geneticists study how Prochlorococcus cells compensate for a changing environment of sunlight and nutrients. This chapter focuses on many of the aspects described above. We examine how microbes maintain a stable internal state and how they can exist in “multicellular”, complex communities. Throughout the chapter we are concerned with the relationships between microorganisms and the many attributes they share. Then, we explore the methods used to name and catalog microorganisms. Finally, we discuss the tools and techniques used to observe the microbial world.
Ecotypes: Subgroups of a species that have special characteristics to survive in their ecological surroundings.
Biosphere: That part of the earth— including the air, soil, and water—where life occurs.
2/4/10 1:59 PM
66
CHAPTER 3
Concepts and Tools for Studying Microorganisms
3.1
The Bacteria/Eukaryote Paradigm
In the news media or even in scientific magazines and textbooks, bacterial and archaeal species often are described as “simple organisms” compared to the “complex organisms” representing multicellular plant and animal species. This view represents a mistaken perception. Despite their microscopic size, bacterial and archaeal organisms exhibit every complex feature, or emerging property, common to all living organisms. These include: • DNA as the hereditary material controlling structure and function. • Complex biochemical patterns of growth and energy conversions. • Complex responses to stimuli. • Reproduction to produce offspring. • Adaptation from one generation to the next. Focusing on the Bacteria, what is the evidence for complexity? Bacterial Complexity: Homeostasis and Biofilm Development KEY CONCEPT
1.
Bacterial cells undergo biological processes as complex as in eukaryotes.
Historically, when one looks at bacterial cells even with an electron microscope, often there is little to see ( FIGURE 3.2A ). “Cell structure,” representing the cell’s physical appearance or its components and the “pattern of organization,” referring to the configuration of those structures and their relationships to one another, do give the impression of simpler cells. But what has been overlooked is the “cellular process,” the activities all cells carry out for the continued survival of the cell (and organism). At this level, the complexity is just as intricate as in any eukaryotic cell. So, in reality, bacteria cells carry out many of the same cellular processes as eukaryotes—only without the need for an elaborate, visible structural organization. Homeostasis. All organisms continually battle their external environment, where factors such as temperature, sunlight, or toxic chemicals can have serious consequences. Organisms strive to maintain a stable internal state by making appropriate metabolic or structural adjustments. This ability to adjust yet maintain a relatively steady
62582_CH03_064_096.pdf 66
internal state is called homeostasis (homeo = “similar”; stasis = “state”). Two examples illustrate the concept ( FIGURE 3.2B ). The low-light Prochlorococcus ecotype mentioned in the chapter introduction lives at depths of below 50 meters. At these depths, transmitted sunlight decreases and any one nitrogen source is less accessible. The ecotype compensates for the light reduction and nitrogen limitation by (1) increasing the amount of cellular chlorophyll to capture light and (2) using a wider variety of available nitrogen sources. These adjustments maintain a steady internal state. For our second example, suppose a patient is given an antibiotic to combat a bacterial infection. In response, the infecting bacterium compensates for the change by breaking the structure of the antibiotic. The adjustment, antibiotic resistance, maintains homeostasis in the bacterial cell. In both these examples, the internal environment is maintained despite a changing environment. Such, often complex, homeostatic controls are critical to all microbes, including bacterial species. Biofilm Development. One of the emerging properties of life is that cells must cooperate with one another. This is certainly true in animals and plants, but it is true of most bacterial organisms as well. The early studies of disease causation done by Pasteur and Koch (see Chapter 1) certainly required pure cultures to associate a specific disease with one specific microbe. However, today it is necessary to abolish the impression that bacteria are self-contained, independent organisms. In nature few species live such a pure and solitary life. In fact, it has been estimated that up to 99% of bacterial species live in communal associations called biofilms; that is, in a “multicellular state” where survival requires chemical communication and cooperation between cells. As a biofilm forms, the cells become embedded in a matrix of excreted polymeric substances produced by the bacterial cells ( FIGURE 3.2C .) These sticky substances are composed of charged and neutral polysaccharides that hold the biofilm together and cement it to nonliving or living surfaces, such as metals, plastics, soil particles,
2/4/10 1:59 PM
3.1 The Bacteria/Eukaryote Paradigm
67
MICROORGANISM external change affects
Microorganism attempts to compensate
Compensation fails loss of homeostasis Microorganism dies (A)
Compensation succeeds homeostasis maintained Microorganism lives
(B)
Stage 1: Initial Attachment. Formation begins with the reversible attachment of freefloating bacteria to a surface.
1 Stage 2: Irreversible Attachment. Many pioneer cells anchor themselves irreversibly using cell adhesion structures as they secrete sticky, extracellular polysaccharides.
2
3
Stage 3: Maturation I. The first colonists facilitate the arrival of other cells by providing more diverse adhesion sites and beginning to build the polysaccharide matrix that holds the biofilm together. As nutrients accumulate, the cells start to divide.
4
Stage 4: Maturation II. A fully mature biofilm is now established and may only change in shape and size.The matrix acts as a protective coating for the cells and is a barrier to chemicals, antibiotics, and other potentially toxic substances.
Dispersion. Important to the biofilm lifecycle, single dividing cells (dark cells on the figure) will be periodically dispersed from the biofilm. The new pioneer cells can then colonize new surfaces.
(C) FIGURE 3.2 Simpler, Unicellular Organisms? (A) This false-color electron microscope image of Staphylococcus aureus gives the impression of simplicity in structure. (Bar = 0.5µm) (B) A concept map illustrating how bacterial organisms, like all microorganisms, have to compensate for environmental changes. Survival depends on such homeostatic abilities. (C) The formation of a biofilm is an example of intercellular cooperation in the development of a multicellular structure. »» Using the concept map in (B), explain how Prochlorococcus compensates for low-light conditions in its environment. (C) Modified from David G. Davies, Binghamton University, Binghamton NY.
62582_CH03_064_096.pdf 67
2/4/10 1:59 PM
68
CHAPTER 3
Concepts and Tools for Studying Microorganisms
medical indwelling devices, or human tissue. The mature, fully functioning biofilm is like a living tissue with a primitive circulatory system made of water channels to bring in nutrients and eliminate wastes. A biofilm is a complex, metabolically cooperative community made up of peacefully coexisting species. It is during this colonization that the cells are able to “speak to each other” and cooperate through chemical communication. This process, called quorum sensing, involves the ability of bacteria to sense their numbers, and then to communicate and coordinate behavior, including gene expression, via signaling molecules. Thus, biofilms are characterized by structural heterogeneity, genetic diversity, and complex community interactions. The cells within the community are profoundly different in behavior and function from those of their independent, free-living cousins. MICROFOCUS 3.1 describes a few examples. Biofilms can also be associated with infections. Development of a fatal lung infection (cystic fibrosis pneumonia), middle ear infections (otitis media), and tooth decay (dental caries) are but a few examples ( FIGURE 3.3A ). Biofilms also can develop on improperly cleaned medical devices, such as artificial joints, mechanical heart valves, and catheters ( FIGURE 3.3B ), such that when implanted into the body, the result is a slow devel-
(A)
oping but persistent infection. As mentioned, the polysaccharide matrix acts as a protective coating for the embedded cells and impedes penetration by antibiotics and other antimicrobial substances. As a result, the infection can be extremely hard to eradicate. On the other hand, biofilms can be useful. For example, sewage treatment plants use biofilms to remove contaminants from water (Chapter 26). As mentioned in Chapter 1, bioremediation uses microorganisms to remove or clean up chemicallycontaminated environments, such as oil spills or toxic waste sites. Such biofilms have been used at sites contaminated with toxic organics, such as “polycyclic aromatic hydrocarbons” that can lead to cancer. Perchlorate (ClO4–) is a soluble anion that is a component in rocket fuels, fireworks, explosives, and airbag manufacture. It is toxic to humans and is highly persistent in drinking water, especially in the western United States. Natural subterranean biofilms are being genetically modified so the cells contain the genes needed to degrade perchlorate from groundwater. In both these cases, a concentrated community of microorganisms—a biofilm—can have positive effects on the environment. CONCEPT AND REASONING CHECKS
3.1 Support the statement “Bacterial cells represent complex organisms.”
(B)
Biofilms in Disease. (A) A false-color electron microscope image of a tooth surface showing the plaque biofilm (purple) containing bacteria cells. The red cells are red blood cells. (Bar ⫽ 60 µm.) (B) An electron microscope image of Staphylococcus aureus contamination on a catheter. The fibrous-looking substance is part of the biofilm. (Bar ⫽ 3 µm.) »» What is the best way to minimize such biofilms on the teeth? FIGURE 3.3
62582_CH03_064_096.pdf 68
2/4/10 1:59 PM
3.1 The Bacteria/Eukaryote Paradigm
69
3.1: Environmental Microbiology
The Power of Quorum Sensing As the chapter opener stated, the microbial world is truly immense and we are continually surprised by what we find. Take quorum sensing for example. The discovery that bacterial cells can communicate with each other changed our general perception of bacterial species as single, simple organisms inhabiting our world. Here are two examples. Vibrio fischeri Vibrio fischeri is a light-emitting, marine bacterial organism found at very low concentrations around the world. At these low concentrations, the cells do not emit any light (see figure). However, juvenile Hawaiian bobtail squids selectively draw up the free-living V. fischeri and the bacterial cells take up residence in what will be the squids’ functional adult light organ called the photophore. The bacterial cells are maintained in this organ for the entire life of the squid. Why take up these bacterial cells? The bobtail squid is a nocturnal species that hunts and feeds in shallow marine waters. On moonlit nights, the light casts a moving shadow of the squid on the sandy bottom. Such movements can attract squid predators. The V. fischeri cells confined to the photophore grow to high concentrations (about 1011 cells/ml). Sensing their high numbers, the V. fischeri cells start chemically “chatting” with one another and produce a signaling molecule that triggers the synthesis of the bacterial enzyme luciferase. This enzyme oxidizes bacterial luciferin to oxyluciferin and energy. Now here is the quorum sensing finale: The energy is given off as cold light (bioluminescence)—the squid’s photophore shines. The squid modulates the light to match that of the moonlight and directs the bacterial glow toward the bottom of the shallow waters, eliminating the bottom shadows and camouflaging itself from any predators.
Photographs of Vibrio fischeri growing in a culture plate (left) and triggered to bioluminesce (right).
Myxobacteria One of the first organisms in which quorum sensing was observed was in the myxobacteria, a bacterial group that predominantly lives in the soil. Individual myxobacterial cells are always evaluating both their own nutritional status and that of their community. The myxobacterial cells can move actively by gliding and, on sensing food (bacterial, yeast, or algal cells), typically travel in “swarms” (also known as “wolf packs”) that are kept together by intercellular molecular signals. This form of quorum sensing coordinates feeding behavior and provides a high concentration of extracellular enzymes from the “multicellular” swarm needed to digest the prey. Like a lone wolf, a single cell could not effectively carry out this behavior. Under nutrient starvation, a different behavior occurs—the cells aggregate into fruiting bodies that facilitate species survival. During this developmental program, approximately 100,000 cells coordinately construct the macroscopic fruiting body. In Myxococcus xanthus, the myxobacterial cells first respond by triggering a quorum-sensing A-signal that helps them assess starvation and induce the first stage of aggregation. Later, the morphogenetic C-signal helps to coordinate fruit body development, as many myxobacterial cells die in forming the stalk while the remaining viable cells differentiate into environmentally resistant and metabolically quiescent myxospores.
62582_CH03_064_096.pdf 69
2/4/10 1:59 PM
70
CHAPTER 3
Concepts and Tools for Studying Microorganisms
Bacteria and Eukaryotes: The Similarities in Organizational Patterns KEY CONCEPT
2.
Metabolism: All the chemical reactions occurring in an organism or cell.
There are organizational patterns common to all living organisms.
In the 1830s, Matthias Schleiden and Theodor Schwann developed part of the cell theory by demonstrating all plants and animals are composed of one or more cells, making the cell the fundamental unit of life. (Note: about 20 years later, Rudolph Virchow added that all cells arise from pre-existing cells.) Although the concept of a microorganism was just in its infancy at the time, the theory suggests that there are certain organizational patterns common to all organisms. Genetic Organization. All organisms have a similar genetic organization whereby the hereditary material is communicated or expressed (Chapter 9). The organizational pattern for the hereditary material is in the form of one or more chromosomes. Structurally, most bacterial cells
have a single, circular DNA molecule without an enclosing membrane ( FIGURE 3.4 .) Eukaryotic cells, however, have multiple, linear chromosomes enclosed by the membrane envelope of the cell nucleus. Compartmentation. All organisms have an organizational pattern separating the internal compartments from the surrounding environment but allowing for the exchange of solutes and wastes. The pattern for compartmentation is represented by the cell. All cells are surrounded by a cell membrane (known as the plasma membrane in eukaryotes), where the phospholipids form the impermeable boundary to solutes while membrane proteins are the gates through which the exchange of solutes and wastes occurs, and across which chemical signals are communicated. We have more to say about membranes in the next chapter. Metabolic Organization. The process of metabolism is a consequence of compartmentation. By being enclosed by a membrane, all cells
Centrosome Flagellum Golgi apparatus Cytoplasm Free ribosomes Mitochondrion Nuclear envelope
Lysosome
DNA (chromosomes)
Ribosome
Ribosomes attached to endoplasmic reticulum
Cytoplasm
Plasma membrane
Cell membrane
Cilia Cytoskeleton
Cell wall (a) (A)
Rough endoplasmic Smooth endoplasmic reticulum reticulum
DNA (chromosome) (B)
A Comparison of Prokaryotic and Eukaryotic Cells. (A) A stylized bacterial cell as an example of a prokaryotic cell. Relatively few visual compartments are present. (B) A protozoan cell as a typical eukaryotic cell. Note the variety of cellular subcompartments, many of which are discussed in the text. Universal structures are indicated in red. »» List the ways you could microscopically distinguishing a eukaryotic microbial cell from a bacterial cell. FIGURE 3.4
62582_CH03_064_096.pdf 70
2/4/10 2:00 PM
3.1 The Bacteria/Eukaryote Paradigm
have an internal environment in which chemical reactions occur. This space, called the cytoplasm, represents everything surrounded by the membrane and, in eukaryotic cells, exterior to the cell nucleus. If the cell structures are removed from the cytoplasm, what remains is the cytosol, which consists of water, salts, ions, and organic compounds as described in Chapter 2. Protein Synthesis. All organisms must make proteins, which we learned in Chapter 2 are the workhorses of cells and organisms. The structure common in all cells is the ribosome, an RNAprotein machine that cranks out proteins based on the genetic instructions it receives from the DNA (Chapter 8). Although the pattern for protein synthesis is identical, structurally bacterial ribosomes are smaller than their counterparts in eukaryotic cells. CONCEPT AND REASONING CHECKS
3.2 The cell theory states that the cell is the fundamental unit of life. Summarize those processes all cells have that contribute to this fundamental unit.
Bacteria and Eukaryotes: The Structural Distinctions
71
port. Lysosomes, somewhat circular, membraneenclosed sacs containing digestive (hydrolytic) enzymes, are derived from the Golgi apparatus and, in protozoal cells, break down captured food materials. Bacteria lack an endomembrane system, yet they are capable of manufacturing and modifying proteins and lipids just as their eukaryotic relatives do. However, many bacterial cells contain so-called microcompartments surrounded by a protein shell ( FIGURE 3.5 .) These microcompartments represent a type of organelle since the shell proteins can control transport similar to membrane-enclosed organelles. Energy Metabolism. Cells and organisms carry out one or two types of energy transformations. Through a process called cellular respiration, all cells convert chemical energy into cellular energy for cellular work. In eukaryotic microbes, this occurs in the cytosol and in membrane-enclosed organelles called mitochondria (sing., mitochondrion). Bacterial (and archaeal) cells lack mitochondria; they use the cytosol and cell membrane to complete the energy converting process.
KEY CONCEPT
3.
Bacteria and eukaryotes have distinct subcellular compartments.
In the cytoplasm, eukaryotic microbes have a variety of structurally discrete, often membraneenclosed, subcellular compartments called organelles to carry out specialized functions (Figure 3.4). Bacterial cells also have subcellular compartments—they just are not readily visible or membrane enclosed. Protein/Lipid Transport. Eukaryotic microbes have a series of membrane-enclosed organelles that compose the cell’s endomembrane system, which is designed to transport protein and lipid cargo through and out of the cell. This system includes the endoplasmic reticulum (ER), which consists of flat membranes to which ribosomes are attached (rough ER) and tube-like membranes without ribosomes (smooth ER). These portions of the ER are involved in protein and lipid synthesis and transport, respectively. The Golgi apparatus is a group of independent stacks of flattened membranes and vesicles where the proteins and lipids coming from the ER are processed, sorted, and packaged for trans-
62582_CH03_064_096.pdf 71
Microcompartments. Purified bacterial microcompartments from Salmonella enterica are composed of a complex protein shell that encases metabolic enzymes. (Bar ⫽ 100 nm.) »» How do these bacterial microcompartments differ structurally from a eukaryotic organelle? FIGURE 3.5
Vesicles: Membrane-enclosed spheres involved with secretion and storage.
2/4/10 2:00 PM
72
CHAPTER 3
Diffusion: The movement of a substance from where it is in a higher concentration to where it is in a lower concentration.
Concepts and Tools for Studying Microorganisms
A second energy transformation, photosynthesis, involves the conversion of light energy into chemical energy. In algal protists, photosynthesis occurs in membrane-bound chloroplasts. Some bacteria, such as the cyanobacteria we have mentioned, also carry out almost identical energy transformations. Again, the cell membrane or elaborations of the membrane represent the chemical workbench for the process. Cell Structure and Transport. The eukaryotic cytoskeleton is organized into an interconnected system of cytoplasmic fibers, threads, and interwoven molecules that give structure to the cell and assist in the transport of materials throughout the cell. The main components of the cytoskeleton are microtubules that originate from the centrosome and microfilaments, each assembled from different protein subunits. Bacterial cells to date have no similar physical cytoskeleton, although proteins related to those that construct microtubules and microfilaments aid in determining the shape in some bacterial cells as we will see in Chapter 4. Cell Motility. Many microbial organisms live in watery or damp environments and use the process of cell motility to move from one place to another. Many algae and protozoa have long, thin protein projections called flagella (sing., flagellum) that, covered by the plasma membrane, extend from the cell. By beating back and forth, the flagella provide a mechanical force for motility. Many bacterial cells also exhibit motility; however,
the flagella are structurally different and without a cell membrane covering. The pattern of motility also is different, providing a rotational propellerlike force for movement (Chapter 4). Some protozoa also have other membraneenveloped appendages called cilia (sing., cilium) that are shorter and more numerous than flagella. In some motile protozoa, they wave in synchrony and propel the cell forward. No bacterial cells have cilia. Water Balance. The aqueous environment in which many microorganisms live presents a situation where the process of diffusion occurs, specifically the movement of water, called osmosis, into the cell. Continuing unabated, the cell would eventually swell and burst (cell lysis) because the cell or plasma membrane does not provide the integrity to prevent lysis. Most bacterial and some eukaryotic cells (fungi, algae) contain a cell wall exterior to the cell or plasma membrane. Although the structure and organization of the wall differs between groups (see Chapter 2), all cell walls provide support for the cells, give them shape, and help them resist the pressure exerted by the internal water pressure. A summary of the bacteria and eukaryote processes and structures is presented in TABLE 3.1 . CONCEPT AND REASONING CHECKS
3.3 Explain how variation in cell structure between bacteria and eukaryotes can be compatible with a similarity in cellular processes between these organisms.
TABLE
3.1
Comparison of Bacterial and Eukaryotic Cell Structure Cell Structure or Compartment
62582_CH03_064_096.pdf 72
Process
Bacterial
Eukaryotic
Genetic organization Compartmentation Metabolic organization Protein synthesis Protein/lipid transport Energy metabolism Cell structure and transport Cell motility Water balance
Circular DNA chromosome Cell membrane Cytoplasm Ribosomes Cytoplasm Cytoplasm and cell membrane Proteins in cytoplasm Bacterial flagella Cell wall
Linear DNA chromosomes Plasma membrane Cytoplasm Ribosomes Endomembrane system Mitochondria and chloroplasts Protein filaments in cytoplasm Eukaryotic flagella or cilia Cell wall
2/4/10 2:00 PM
3.2 Classifying Microorganisms
3.2
Classifying Microorganisms
If you open any catalog, items are separated by types, styles, or functions. For example, in a fashion catalog, watches are separated from shoes and, within the shoes, men’s, women’s, and children’s styles are separated from one another. Even the brands of shoes or their use (e.g., dress, casual, athletic) may be separated. With such an immense diversity of organisms on planet Earth, the human drive to catalog these organisms has not been very different from cataloging watches and shoes; both have been based on shared characteristics. In this section, we shall explore the principles on which microorganisms are classified and cataloged. Classification Attempts to Catalog Organisms KEY CONCEPT
4.
Organisms historically were grouped by shared characteristics.
In the 18th century, Carolus Linnaeus, a Swedish scientist, began identifying living organisms according to similarities in form (resemblances) and placing organisms in one of two “kingdoms”— Vegetalia and Animalia ( FIGURE 3.6 ). This system was well accepted until the mid-1860s when a German naturalist, philosopher, and physician, Ernst Haeckel, identified a fundamental problem in the two-kingdom system. The unicellular (microscopic) organisms being identified by Haeckel, Pasteur, Koch, and their associates did not conform to the two-kingdom system of multicellular organisms. Haeckel constructed a third kingdom, the Protista, in which all the known unicellular organisms were placed. The bacterial organisms, which he called “moneres,” were near the bottom of the tree, closest to the root of the tree. With improvements in the design of light microscopes, more observations were made of bacterial and protist organisms. In 1937, a French biologist, Edouard Chatton, proposed that there was a fundamental dichotomy among the Protista. He saw bacteria as having distinctive properties (not articulated in his writings) in “the prokaryotic nature of their cells” and should be separated from all other protists “which have eukaryotic cells.” With the development of the electron microscope
62582_CH03_064_096.pdf 73
73
in the 1950s, it became apparent that some protists had a membrane-enclosed nucleus and were identified, along with the plants and animals, as being eukaryotes while other protists (the bacteria) lacked this structure and were considered to be prokaryotes (see Chapter 1). Thus, in 1956, Herbert Copland suggested bacteria be placed in a fourth kingdom, the Monera. But there was still one more problem with the kingdom Protista. Robert H. Whittaker, a botanist at the University of California, saw the fungi as yet another kingdom of organisms. The fungi are the only eukaryotic group that must externally digest their food prior to absorption and, as such, live in the food source. For this and other reasons, Whittaker in 1959 refined the four-kingdom system into five kingdoms, identifying the kingdom Fungi as a separate, multicellular, eukaryotic kingdom distinguished by an absorptive mode of nutrition (Chapter 17). The five kingdom system rested safely for about 15 years. In the late 1970s, Carl Woese, an evolutionary biologist at the University of Illinois, began a molecular analysis of living organisms based on comparisons of nucleotide sequences of genes coding for the small subunit ribosomal RNA (rRNA) found in all organisms. These analyses revealed yet another dichotomy, this time among the prokaryotes. By 1990, it was clear that the kingdom Monera contained two fundamentally unrelated groups, what Woese initially called the Bacteria and Archaebacteria. These two groups were as different from each other as they were different from the eukaryotes. CONCEPT AND REASONING CHECKS
3.4 What four events changed the cataloging of microorganisms.
Kingdoms and Domains: Trying to Make Sense of Taxonomic Relationships KEY CONCEPT
5.
The three-domain system shows the taxonomic relationships between living organisms.
What many of these scientists are or were doing is systematics; that is, studying the diversity of life and its evolutionary relationships. Systematic biologists—systematists for short— identify, describe, name, and classify organisms
2/4/10 2:00 PM
74
CHAPTER 3
Concepts and Tools for Studying Microorganisms
Living organisms separated into kingdoms Approximate date 1735
Animalia
Vegetalia
consisting of
consisting of
Algae
Plants remaining as kingdom
1866
Fungi
Protozoa
Animals remaining as kingdom
grouped into kingdom
Plantae
Protista
Animalia
containing
Bacteria
Fungi
Algae
Protozoa
based on structure and metabolism to form the 1937
Prokaryota
Eukaryota separating into kingdoms
forming the kingdom
1959
Monera
Protista
Fungi
Animalia
Plantae
separated into domains combined into domain
1990
Bacteria
Archaea
Eukarya
FIGURE 3.6 A Concept Map Illustrating the Development of Classification for Living Organisms. Over some 140 years, new observations and techniques have been used to reclassify and reorganize living organisms. »» Of the plants, algae, fungi, bacteria, protozoa, and animals, which are in each of the three domains? Modified from Schaechter, Ingraham, and Neidhardt. Microbe. ASM Press, 2006, Washington, D.C.
(taxonomy), and organize their observations within a framework that shows taxonomic relationships. Often it is difficult to make sense of taxonomic relationships because new information that is more detailed keeps being discovered about organisms. This then motivates taxonomists to figure out how
62582_CH03_064_096.pdf 74
the new information fits into the known classification schemes—or how the schemes need to be modified to fit the new information. This is no clearer than the most recent taxonomic revolution that, as the opening quote states, has come along to “tweak our theories or teach us something new.”
2/4/10 2:00 PM
3.2 Classifying Microorganisms
Eukaryotes
Prokaryotes
ARCHAEA (2 major phyla)
BACTERIA (>70 major phyla)
75
EUKARYA (>30 major phyla)
symbiosis Endo
Slime molds
MULTICELLULAR ORGANISMS Animals
Amoebas
Cyanobacteria
Fungi
Euryarchaeota
Plants Proteobacteria Ciliates Gram-positive bacteria
Crenarchaeota
Kinetoplastids Parabasalids
UNIVERSAL ANCESTOR
Mitochondrion degenerates Diplomonads
FIGURE 3.7 The Three-Domain System Forms the “Tree of Life”. Fundamental differences in genetic endowments are the basis for the three domains of all organisms on Earth. Some 3.5 billion years ago, a universal ancestor arose from which all modern day organisms descended. »» What cellular characteristic was the major factor stimulating the development of the three-domain system?
Carl Woese, along with George Fox and coworkers at the University of Illinois, UrbanaChampaign, proposed a new classification scheme with a new most inclusive taxon, the domain. The new scheme initially came from work that compared the DNA nucleotide base sequences for the RNA in ribosomes, those protein manufacturing machines needed by all cells. Woese and Fox’s results were especially relevant when comparing those sequences from a group of bacterial organisms formerly called the archaebacteria (archae = “ancient”). Many of these bacterial forms are known for their ability to live under extremely harsh environments. Woese discovered that the nucleotide sequences in these archaebacteria were different from those in other bacterial species and in eukaryotes. After finding other differences, including cell wall composition, membrane lipids, and sensitivity to certain antibiotics, the evidence pointed to there being three taxonomic lines to the “tree of life”. One goal of systematics, and the main one of interest here, is to reconstruct the phylogeny (phylo = “tribe”; geny = “production”), the evolutionary history of a species or group of species. Systematists illustrate phylogenies with phylogenetic trees, which identify inferred relationships
62582_CH03_064_096.pdf 75
among species. Because, like all hypotheses, they are revised as scientists gather new data, trees change as our knowledge of diversity increases. In Woese’s three-domain system, one branch of the phylogenetic tree includes the former archaebacteria and is called the domain Archaea ( FIGURE 3.7 ). The second encompasses all the remaining true bacteria and is called the domain Bacteria. The third domain, the Eukarya, includes the four remaining kingdoms (Protista, Plantae, Fungi, and Animalia). In 1996, Craig Venter and his coworkers deciphered the DNA base sequence of the archaean Methanococcus jannaschii and showed that almost two thirds of its genes are different from those of the Bacteria. They also found that proteins replicating the DNA and involved in RNA synthesis have no counterpart in the Bacteria. The threedomain system now is on firm ground. MICROINQUIRY 3 examines a scenario for the evolution of the eukaryotic cell.
Taxon (pl., taxa): Subdivisions used to classify organisms.
CONCEPT AND REASONING CHECKS
3.5 It has been said that Woese “lifted a whole submerged continent out of the ocean.” What is the “submerged continent” and why is the term “lifted” used?
2/4/10 2:00 PM
76
CHAPTER 3
Concepts and Tools for Studying Microorganisms
INQUIRY 3
The Evolution of Eukaryotic Cells Biologists and geologists have speculated for decades about the chemical evolution that led to the origins of the first prokaryotic cells on Earth (see MicroFocus 2.1 and 2.6). Whatever the origin, the first ancestral prokaryotes arose about 3.8 billion years ago and remained the sole inhabitants for some 1.5 billion years. Scientists also have proposed various scenarios to account for the origins of the first eukaryotic cells. The oldest known fossils thought to be eukaryotic are about 2 billion years old. A key concern here is figuring out how different membrane compartments arose to evolve into what are found in the eukaryotic cells today. Debate on this long intractable problem continues, so here we present some of the ideas that have fueled such discussions. At some point around 2 billion years ago, the increasing number of metabolic reactions occurring in presumably larger prokaryotes started to interfere with one another. As cells increased in size, the increasing volume of cell cytoplasm outpaced the ability of the cell surface (membrane) to be an effective “workbench” for servicing the metabolic needs of the whole cell. Complexity would necessitate more extensive workbench surface through compartmentation. The Endomembrane System May Have Evolved through Invagin*tion Similar to today’s bacterial and archaeal cells, the cell membrane of an ancestral prokaryote may have had specialized regions involved in protein synthesis, lipid synthesis, and nutrient hydrolysis. If the invagin*tion of these regions occurred, the result could have been the internalization of these processes as independent internal membrane systems. For example, the membranes of the endoplasmic reticulum may have originated by multiple invagin*tion events of the cell membrane (Figure A1).
62582_CH03_064_096.pdf 76
Biologists have suggested that the elaboration of the evolving ER surrounded the nuclear region and DNA, creating the nuclear envelope. Surrounded and protected by a double membrane, greater genetic complexity could occur as the primitive eukaryotic cell continued to evolve in size and function. Other internalized membranes could give rise to the Golgi apparatus. Chloroplasts and Mitochondria Arose from a Symbiotic Union of Engulfed Bacteria Mitochondria and chloroplasts are not part of the extensive endomembrane system. Therefore, these energy-converting organelles probably originated in a different way. The structure of modern-day chloroplasts and mitochondria is very similar to a bacterial cell. In fact, mitochondria, chloroplasts, and bacteria share a large number of similarities (see Table). In addition, there are bacterial cells alive today that carry out cellular respiration similarly to mitochondria and other bacterial cells (the cyanobacteria) that can carry out photosynthesis similarly to chloroplasts. These similar functional patterns, along with other chemical and molecular similarities, suggested to Lynn Margulis at the University of Massachusetts, Amherst, that presentday chloroplasts and mitochondria represent modern representatives of what were once, many eons ago, freeliving prokaryotes. Margulis, therefore, proposed the endosymbiont model for the origin of mitochondria and chloroplasts. The hypothesis suggests, in part, that mitochondria evolved from a prokaryote that carried out cellular respiration and which was “swallowed” (engulfed) by a primitive eukaryotic cell. The bacterial partner then lived within (endo) the eukaryotic cell in a
mutually beneficial association (symbiosis) (Figure A2). Likewise, a photosynthetic prokaryote, perhaps a primitive cyanobacterium, was engulfed and evolved into the chloroplasts present in plants and algae today (Figure A3). The theory also would explain why both organelles have two membranes. One was the cell membrane of the engulfed bacterial cell and the other was the plasma membrane resulting from the engulfment process. By engulfing these prokaryotes and not destroying them, the evolving eukaryotic cell gained energy-conversion abilities, while the symbiotic bacterial cells gained a protected home. If the first ancestral prokaryote appeared about 3.5 billion years ago and the first single-celled eukaryote about 2 billion years ago, then it took some 1.5 billion years of evolution for the events described above to occur (see Figure 8.2). With the appearance of the first eukaryotic cells, a variety of single-celled forms evolved, many of which were the very ancient ancestors of the single-celled eukaryotic organisms that exist today. Obviously, laboratory studies can only hypothesize at mechanisms to explain how cells evolved and can only suggest—not prove—what might have happened billions of years ago. The description here is a very simplistic view of how the first eukaryotic cells might have evolved. Short of inventing a time machine, we may never know the exact details for the origin of eukaryotic cells and organelles. Discussion Point Determine which endosymbiotic event must have come first: the engulfment of the bacterial progenitor of the chloroplast or the engulfment of the bacterial progenitor of the mitochondrion.
2/4/10 2:00 PM
3.2 Classifying Microorganisms
Ancient prokaryotic cell
Respiratory bacterium
77
Photosynthetic bacterium
DNA
Membranebound ribosomes
Endoplasmic reticulum
Nucleus
Chloroplast
Nuclear membrane Mitochondrion
(A1) Ancient eukaryotic cell
(A2) Early respiratory eukaryotic cell
(A3) Early photosynthetic eukaryotic cell
FIGURE A Possible Origins of Eukaryotic Cell Compartments. (A1) Invagin*tion of the cell membrane from an ancient prokaryotic cell may have led to the development of the cell nucleus as well as to the membranes of the endomembrane system, including the endoplasmic reticulum. (A2) The mitochondrion may have resulted from the uptake and survival of a bacterial cell that carried out cellular resipration. (A3) A similar process, involving a bacterial cell that carried out photosynthesis, could have accounted for the origin of the chloroplast.
TABLE
Similarities between Mitochondria, Chloroplasts, Bacteria, and Microbial Eukaryotes Characteristic
Mitochondria
Chloroplasts
Bacteria
Microbial Eukaryotes
Average size Nuclear envelope present DNA molecule shape Ribosomes Protein synthesis
1–5 µm No Circular Yes; bacterial-like Make some of their proteins Binary fission
1–5 µm No Circular Yes; bacterial-like Make some of their proteins Binary fission
1–5 µm No Circular Yes Make all of their proteins Binary fission
10–20 µm Yes Linear Yes; eukaryotic-like Make all of their proteins Mitosis and cytokinesis
Reproduction
62582_CH03_064_096.pdf 77
2/4/10 2:00 PM
78
CHAPTER 3
Concepts and Tools for Studying Microorganisms
Nomenclature Gives Scientific Names to Organisms KEY CONCEPT
6.
The binomial system identifies each organism by a universally accepted scientific name.
Another goal of systematics is the naming of species and their placement in a classification. In his Systema Naturae, Linnaeus popularized a twoword (binomial) scheme of nomenclature, the two words usually derived from Latin or Greek stems. Each organism’s name consists of the genus to which the organism belongs and a specific epithet, a descriptor that further describes the genus name. Together these two words make up the species name. For example, the common bacterium Escherichia coli resides in the gut of all humans (hom*o sapiens) (MICROFOCUS 3.2). Notice in these examples that when a species name is written, only the first letter of the genus name is capitalized, while the specific epithet is not. In addition, both words are printed in italics or underlined. After the first time a species name has been spelled out, biologists usually abbreviate
the genus name using only its initial genus letter or some accepted substitution, together with the full specific epithet; that is, E. coli or H. sapiens. A cautionary note: often in magazines and newspapers, proper nomenclature is not followed, so our gut bacterium would be written as Escherichia coli. CONCEPT AND REASONING CHECKS
3.6 Which one of the following is a correctly written scientific name for the bacterium that causes anthrax? (a) bacillus Anthracis; (b) Bacillus Anthracis; or (c) Bacillus anthracis.
Classification Uses a Hierarchical System KEY CONCEPT
7.
Species can be organized into higher, more inclusive groups.
Linnaeus’ cataloging of plants and animals used shared and common characteristics. Such similar organisms that could interbreed were related as a species, which formed the least inclusive level of the hierarchical system. Part of Linnaeus’ innovation was the grouping of species into higher taxa
3.2: Tools
Naming Names As you read this book, you have and will come across many scientific names for microbes, where a species name is a combination of the genus and specific epithet. Not only are many of these names tongue twisting to pronounce (many are listed with their pronunciation inside the front and back covers), but how in the world did the organisms get those names? Here are a few examples. Genera Named after Individuals Escherichia coli: named after Theodore Escherich who isolated the bacterial cells from infant feces in 1885. Being in feces, it commonly is found in the colon. Neisseria gonorrhoeae: named after Albert Neisser who discovered the bacterial organism in 1879. As the specific epithet points out, the disease it causes is gonorrhea. Genera Named for a Microbe’s Shape Vibrio cholerae: vibrio means “comma-shaped,” which describes the shape of the bacterial cells that cause cholera. Staphylococcus epidermidis: staphylo means “cluster” and coccus means “spheres.” So, these bacterial cells form clusters of spheres that are found on the skin surface (epidermis). Genera Named after an Attribute of the Microbe Saccharomyces cerevisiae: in 1837, Theodor Schwann observed yeast cells and called them Saccharomyces (saccharo = “sugar”; myce = “fungus”) because the yeast converted grape juice (sugar) into alcohol; cerevisiae (from cerevisia = “beer”) refers to the use of yeast since ancient times to make beer. Myxococcus xanthus: myxo means “slime,” so these are slime-producing spheres that grow as yellow (xantho = “yellow”) colonies on agar. Thiomargarita namibiensis: see MicroFocus 3.5.
62582_CH03_064_096.pdf 78
2/4/10 2:00 PM
3.2 Classifying Microorganisms
79
TABLE
3.2 Domain Kingdom Phylum Class Order Family Genus Species
Taxonomic Classification of Humans, Brewer’s Yeast, and a Common Bacterium Humans
Brewer’s Yeast
Escherichia coli
Eukarya Animalia Chordata Mammalia Primates Hominidae hom*o H. sapiens
Eukarya Fungi Ascomycota Saccharomycotina Saccharomycetales Saccharomycetaceae Saccharomyces S. cerevisiae
Bacteria
that also were based on shared, but more inclusive, similarities. Today several similar species are grouped together into a genus (pl., genera). A collection of similar genera makes up a family and families with similar characteristics make up an order. Different orders may be placed together in a class and classes are assembled together into a phylum (pl., phyla). All phyla would be placed together in a kingdom and/or domain, the most inclusive level of classification. TABLE 3.2 outlines the taxonomic hierarchy for three organisms. In prokaryotes, an organism may belong to a rank below the species level to indicate a special characteristic exists within a subgroup of the species. Such ranks have practical usefulness in helping to identify an organism. For example, two biotypes of the cholera bacterium, Vibrio cholerae, are known: Vibrio cholerae classic and Vibrio cholerae El Tor. Other designations of ranks include subspecies, serotype, strain, morphotype, and variety. David Hendricks Bergey devised one of the first systems of classification for the bacterial species in 1923. Today, the proper taxonomic classification for the Bacteria and Archaea can be found in the second edition of Bergey’s Manual of Systematic Bacteriology. The first two volumes of this 5-volume compendium have been published. The tremendous changes that have taken place in taxonomy can be seen by the addition of more than 2,200 new species and 390 new genera to the first volume of the new second edition.
62582_CH03_064_096.pdf 79
Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Escherichia E.coli
CONCEPT AND REASONING CHECKS
3.7 How would you describe an order in the taxonomic classification?
Many Methods Are Available to Identify and Classify Microorganisms KEY CONCEPT
8.
Identification and classification of microorganisms may use different methods.
There are several traditional and more modern criteria that microbiologists can use to identify and classify microorganisms. For example, a medical identification usually uses physical, staining, and biochemical methods (metabolic tests). In fact, Bergey’s Manual of Determinative Bacteriology, now in its ninth edition, is the primary source for making routine medical identifications of bacterial pathogens. On the other hand, many emerging biotechnologies (Chapter 9) depend on a thorough knowledge of a microorganism’s biochemistry, molecular biology, and phylogenetic relatedness. More molecular methods will be required here. Let’s briefly review some of the more determinative methods and a few molecular methods for classification. Physical Characteristics. These include differential staining reactions to help determine the organism’s shape (morphology), and the size and arrangement of cells. Other characteristics can include oxygen, pH, and growth temperature requirements. Spore-forming ability and motility are additional determinants. Unfortunately, there
Biotypes: Populations or groups of individuals having the same genetic constitution (genotype).
2/4/10 2:00 PM
80
CHAPTER 3
Antibodies: Proteins produced by the immune system in response to a specific chemical configuration (antigen).
Concepts and Tools for Studying Microorganisms
are many bacterial and archaeal organisms that have the same physical characteristics, so other distinguishing features are needed. Biochemical Tests. As microbiologists better understood bacterial physiology, they discovered there were certain metabolic properties that were present only in certain groups. Today, a large number of biochemical tests exist and often a specific test can be used to eliminate certain groups from the identification process. Among the more common tests are: fermentation of carbohydrates, the use of a specific substrate, and the production of specific products or waste products. But, as with the physical characteristics, often several biochemical tests are needed to differentiate between species. These identification tests are important clinically, as they can be part of the arsenal available to the clinical lab that is trying to identify a pathogen. Many of these tests use rapid identification methods (MICROFOCUS 3.3) or automated systems ( FIGURE 3.8 ). Serological Tests. Microorganisms are antigenic, meaning they are capable of triggering the production of antibodies. Solutions of
FIGURE 3.8 A Biolog MicroPlate®. The BIOLOG system is capable of identifying bacteria by assessing the bacterium’s ability to use any of 95 different substrates in a 96-well microtiter plate. The use of any substrate results in a reduction of the dye in each well, resulting in purple color development. The intensity of the purple coloration indicates the degree of substrate usage and is read by a computer-linked automated microtiter reader. The first well (upper left) is a negative control with no substrate. »» Of the methods described on this page, which is/are most likely to be used in this more automated system? Explain.
62582_CH03_064_096.pdf 80
such collected antibodies, called antisera, are commercially available for many medically important pathogens. For example, mixing a Salmonella antiserum with Salmonella cells will cause the cells to clump together or agglutinate. If a foodborne illness occurs, the antiserum may be useful in identifying if Salmonella is the pathogen. More information about serological testing will be presented in Chapter 22. Nucleic Acid Analysis. In 1984, the editors of Bergey’s Manual of Systematic Bacteriology noted that there is no “official” classification of bacterial species and that the closest approximation to an official classification is the one most widely accepted by the community of microbiologists. The editors stated that a comprehensive classification might one day be possible. Today, the fields of molecular genetics and genomics have advanced the analysis and sequencing of nucleic acids. This has given rise to a new era of molecular taxonomy. Molecular taxonomy is based on the universal presence of ribosomes in all living organisms. In particular, it is the RNAs in the ribosome, called ribosomal RNA (rRNA), which are of most interest and the primary basis of Woese’s construction of the three-domain system. Many scientists today believe the genes for rRNA are the most accurate measure for precise bacterial classification in all taxonomic classes. Other techniques, including the polymerase chain reaction and nucleic acid hybridization, will be mentioned in later chapters. The vast number of tests and analyses available for bacterial cells can make it difficult to know which are relevant for pathogen identification purposes. One widely used technique in many disciplines is the dichotomous key. There are various forms of dichotomous keys, but one very useful construction is a flow chart where a series of positive or negative test procedures are listed down the page. Based on the dichotomous nature of the test (always a positive or negative result), the flow chart immediately leads to the next test result. The result is the identification of a specific organism. A simplified example is shown in MICROFOCUS 3.4. CONCEPT AND REASONING CHECKS
3.8 Why are so many tests often needed to identify a specific bacterial species?
2/4/10 2:00 PM
3.2 Classifying Microorganisms
81
3.3: Tools
Rapid Identification of Enteric Bacteria In recent years, a number of miniaturized systems have been made available to microbiologists for the rapid identification of enteric bacteria. One such system is the Enterotube II, a self-contained, sterile, compartmentalized plastic tube containing 12 different media and an enclosed inoculating wire. This system permits the inoculation of all media and the performance of 15 standard biochemical tests using a single bacterial colony. The media in the tube indicate by color change whether the organism can carry out the metabolic reaction. After 24 hours of incubation, the positive tests are circled and all the circled numbers in each boxed section are added to yield a 5-digit ID for the organism being tested. This 5-digit number is looked up in a reference book or computer software to determine the identity of the bacterium.
(A) An uninoculated tube.
(B) An inoculated tube incubated for 24 hours.
As seen from the reference, 24160 is Escherichia coli.
62582_CH03_064_096.pdf 81
2/4/10 2:00 PM
82
CHAPTER 3
Concepts and Tools for Studying Microorganisms
3.4: Tools
Dichotomous Key Flow Chart A medical version of a taxonomic key (in the form of a dichotomous flow chart) can be used to identify very similar bacterial species based on physical and biochemical characteristics. In this simplified scenario, an unknown bacterium has been cultured and several tests run. The test results are shown in the box at the top. Using the test results and the flow chart, identify the bacterial species that has been cultured. Microbiology Test Results • Gram stain: gram-negative rods Biochemical tests: • Citrate test: negative • Lactose fermentation: positive • Indole test: positive • Methyl red test: positive
UNKNOWN BACTERIUM Gram staining
Positive
Negative ability to ferment lactose
Positive
Negative
indole production
Positive
Negative
use of citrate as sole carbon source
Positive
Citrobacter intermedius
62582_CH03_064_096.pdf 82
Negative
Escherichia coli
Positive
methyl red reaction
Negative
Citrobacter Enterobacter freundii aerogenes
2/4/10 2:00 PM
3.3 Microscopy
3.3
Microscopy world. The measurement system is the metric system, where the standard unit of length is the meter and is a little longer than a yard (see Appendix A). To measure microorganisms, we need to use units that are a fraction of a meter. In microbiology, the common unit for measuring length is the micrometer (µm), which is equivalent to a millionth (10–6) of a meter. To appreciate how small a micrometer is, consider this: Comparing a micrometer to an inch is like comparing a housefly to New York City’s Empire State Building, 1,472 feet high. Microbial agents range in size from the relatively large, almost visible protozoa (100 µm) down to the incredibly tiny viruses (0.02 µm) ( FIGURE 3.9 ). Most bacterial and archaeal cells are about 1 µm to 5 µm in length, although notable exceptions have been discovered recently
The ability to see small objects all started with the microscopes used by Robert Hooke and Antony van Leeuwenhoek. By now, you should be aware that microorganisms usually are very small. Before we examine the instruments used to “see” these tiny creatures, we need to be familiar with the units of measurement. Many Microbial Agents Are In the Micrometer Size Range KEY CONCEPT
9.
83
Metric system units are the standard for measurement.
One physical characteristic used to study microorganisms and viruses is their size. Because they are so small, a convenient system of measurement is used that is the scientific standard around the
Protozoan
DNA double helix
Red blood cells
Mold Alga
Rod-shaped and spherical-shaped bacteria
Tapeworm
Poliovirus
Carbon atom HIV Fluke Glucose molecule
Rickettsiae
Cyanobacterium Yeast
Unicellular algae Molecules 0.1nm
Colonial algae
Viruses
Atoms
1nm
10nm
Bacterial and archaeal organisms 100nm
1µm
Protozoa 10µm
100µm
Electron microscope
Multicellular organisms
Fungi 1mm
1cm
0.1m
1m
10m
Unaided eye Light microscope
FIGURE 3.9 Size Comparisons Among Various Atoms, Molecules, and Microorganisms (not drawn to scale). Although tapeworms and flukes usually are macroscopic, the diseases these parasites cause are studied by microbiologists. »» Which domain on average has the smallest organisms and which has the largest?
62582_CH03_064_096.pdf 83
2/4/10 2:00 PM
84
CHAPTER 3
Concepts and Tools for Studying Microorganisms
(MICROFOCUS 3.5). Because most viruses are a fraction of one micrometer, their size is expressed in nanometers. A nanometer (nm) is equivalent to a billionth (10–9) of a meter; that is, 1/1,000 of a µm. Using nanometers, the size of the poliovirus, among the smaller viruses, measures 20 nm (0.02 µm) in diameter. CONCEPT AND REASONING CHECKS
3.9 If a bacterial cell is 0.75 µm in length, what is its length in nanometers?
Light Microscopy Is Used to Observe Most Microorganisms KEY CONCEPT
10. Light microscopy uses visible light to magnify and resolve specimens.
Total magnification: The magnification of the ocular multiplied by the magnification of the objective lens being used.
62582_CH03_064_096.pdf 84
The basic microscope system used in the microbiology laboratory is the light microscope, in which visible light passes directly through the lenses and specimen ( FIGURE 3.10A ). Such an optical configuration is called bright-field microscopy. Visible light is projected through a condenser lens, which focuses the light into a sharp cone ( FIGURE 3.10B ). The light then passes through the opening in the stage. When hitting the glass slide, the light is reflected or refracted as it passes through the specimen. Next, light passing through the specimen enters the objective lens to form a magnified intermediate image inverted from that of the specimen. This intermediate image becomes the object magnified by the ocular lens (eyepiece) and seen by the observer. Magnification thus refers to the increase in the apparent size of the specimen being observed. Because this microscope has several lenses, it also is called a compound microscope. A light microscope usually has at least three objective lenses: the low-power, high-power, and oil-immersion lenses. In general, these lenses magnify an object 10, 40, and 100 times, respectively. (Magnification is represented by the multiplication sign, ×.) The ocular lens then magnifies the intermediate image produced by the objective lens by 10×. Therefore, the total magnification achieved is 100×, 400×, and 1,000×, respectively. For an object to be seen distinctly, the lens system must have good resolving power; that is, it must transmit light without variation and allow
closely spaced objects to be clearly distinguished. For example, a car seen in the distance at night may appear to have a single headlight because at that distance the unaided eye lacks resolving power. However, using binoculars, the two headlights can be seen clearly as the resolving power of the eye increases. When switching from the low-power (10×) or high-power (40×) lens to the oil-immersion lens (100×), one quickly finds that the image has become fuzzy. The object lacks resolution, and the resolving power of the lens system appears to be poor. The poor resolution results from the refraction of light. Both low-power and high-power objectives are wide enough to capture sufficient light for viewing. The oil-immersion objective, on the other hand, is so narrow that most light bends away and would miss the objective lens FIGURE 3.10C . The index of refraction (or refractive index) is a measure of the light-bending ability of a medium. Immersion oil has an index of refraction of 1.5, which is almost identical to the index of refraction of glass. Therefore, by immersing the 100× lens in oil, the light does not bend away from the lens as it passes from the glass slide and the specimen. The oil thus provides a hom*ogeneous pathway for light from the slide to the objective, and the resolution of the object increases. With the oilimmersion lens, the highest resolution possible with the light microscope is attained, which is near 0.2 µm (200 nm) (MICROFOCUS 3.6). CONCEPT AND REASONING CHECKS
3.10 What are the two most important properties of the light microscope?
Staining Techniques Provide Contrast KEY CONCEPT
11. Specimens stained with a dye are contrasted against the microscope field.
Microbiologists commonly stain bacterial cells before viewing them because the cytoplasm lacks color, making it hard to see the cells on the bright background of the microscope field. Several staining techniques have been developed to provide contrast for bright-field microscopy.
2/4/10 2:00 PM
3.3 Microscopy
85
WITHOUT OIL
100X 1.25 160/0.17
Lost light Glass slide Stage
Ocular
Condenser
Light
Objective
WITH OIL
Stage Condenser
Oilimmersion lens
Light source
Oil
Light (A)
(C)
Eyeball Light rays
Ocular lens Intermediate image Image magnified Objective lens Object Bacterium (object)
Condenser lens Light
(B) FIGURE 3.10 The Light Microscope. (A) The light microscope is used in many instructional and clinical laboratories. Note the important features of the microscope that contribute to the visualization of the object. (B) Image formation in the light microscope requires light to pass through the objective lens, forming an intermediate image. This image serves as an object for the ocular lens, which further magnifies the image and forms the final image the eye perceives. (C) When using the oil immersion lens (100⫻), oil must be placed between and continuous with the slide and objective lens. »» Why must oil be used with the 100⫻ oil-immersion lens?
62582_CH03_064_096.pdf 85
2/4/10 2:00 PM
86
CHAPTER 3
Concepts and Tools for Studying Microorganisms
3.5: Environmental Microbiology
Biological Oxymorons An oxymoron is a pair of words that seem to refer to opposites, such as jumbo shrimp, holy war, old news, and sweet sorrow. One of the characteristics we used for microorganisms is that most are invisible to the naked eye; you need a microscope to see them. Always true? So how about the oxymoron: macroscopic microorganism? In 1993, researchers at Indiana University discovered near an Australian reef macroscopic bacterial cells in the gut of surgeonfish. Each cell was so large that a microscope was not needed to see it. The spectacular giant, measuring over 0.6 mm in length (that’s 600 µm compared to 2 µm for Escherichia coli) even dwarfs the protozoan Paramecium. While on an expedition off the coast of Namibia (western coast of southern Africa) in 1997, Heide Schultz and teammates from the Max Planck Institute for Marine Microbiology in Bremen, Germany, found another bacterial monster in sediment samples from the sea floor. These bacterial cells were spherical being about 0.1 mm to 0.3 mm in diameter—but some as large as 0.75 mm—about the diameter of the period in this sentence (see figure). Their volume is about 3 million times greater than that of E. coli. The cells, shining white with enclosed sulfur granules, were held together in chains by a mucus sheath looking like a string of pearls. Thus, the bacterial species was named Thiomargarita namibiensis (meaning “sulfur pearl of Namibia”). Another closely related strain was discovered in the Gulf of Mexico in 2005. How does a bacterial cell survive in so large a size? The trick is to keep the cytoplasm as a thin layer plastered against the edge of the cell so materials do not need to travel (diffuse) far to get into or out of the cell. The rest of the cell is a giant “bubble,” called a vacuole, in which nitrate and sulfur are stored as potential energy sources. Thus, the actual cytoplasmic layer is microscopic and as close to the surface as possible. Yes, the vast majority of microorganisms are microscopic, but exceptions have been found in A phase microscopy image showing a chain of some exotic places. Thiomargarita namibiensis cells. (Bar = 250 µm.)
To perform the simple stain technique, bacterial cells in a droplet of water or broth are smeared on a glass slide and the slide air-dried. Next, the slide is passed briefly through a flame in a process called heat fixation, which bonds the cells to the slide, kills any organisms still alive, and increases stain absorption. Now the slide is flooded with a basic (cationic) dye such as methylene blue ( FIGURE 3.11A ). Because cationic dyes have a positive charge, the dye is attracted to the cytoplasm and cell wall, which primarily have negative charges. By contrasting the blue cells against the bright background, the staining procedure allows the observer to measure cell size and determine cell shape. It also can provide information about how cells are arranged with respect to one another (Chapter 4).
62582_CH03_064_096.pdf 86
The negative stain technique works in the opposite manner ( FIGURE 3.11B ). Bacterial cells are mixed on a slide with an acidic (anionic) dye such as nigrosin (a black stain) or India ink (a black drawing ink). The mixture then is pushed across the face of the slide and allowed to air-dry. Because the anionic dye carries a negative charge, it is repelled from the cell wall and cytoplasm. The stain does not enter the cells and the observer sees clear or white cells on a black or gray background. Because this technique avoids chemical reactions and heat fixation, the cells appear less shriveled and less distorted than in a simple stain. They are closer to their natural condition. The Gram stain technique is an example of a differential staining procedure; that is, it allows the observer to differentiate (separate) bacterial
2/4/10 2:00 PM
3.3 Microscopy
87
3.6: Tools
Calculating Resolving Power The resolving power (RP) of a lens system is important in microscopy because it indicates the size of the smallest object that can be seen clearly. The resolving power varies for each objective lens and is calculated using the following formula: RP =
λ 2 × NA
In this formula, the Greek letter λ (lambda) represents the wavelength of light; for white light, it averages about 550 nm. The symbol NA stands for the numerical aperture of the lens and refers to the size of the cone of light that enters the objective lens after passing through the specimen. This number generally is printed on the side of the objective lens (see Figure 3.10C). For an oil-immersion objective with an NA of 1.25, the resolving power may be calculated as follows: RP =
550 nm 2 × 1.25
=
550 2.5
= 220 nm or 0.22 µm
Because the resolving power for this lens system is 220 nm, any object smaller than 220 nm could not be seen as a clear, distinct object. An object larger than 220 nm would be resolved.
Dye attracted
Basic dye (+)
Bacterial cell
(A) Simple stain technique
Dye repelled
Cell stained
Acidic dye (–)
Bacterial cell
Cell unstained
(B) Negative stain technique
FIGURE 3.11 Important Staining Reactions in Microbiology. (A) In the simple stain technique, the cells in the smear are stained and contrasted against the light background. (B) With the negative stain technique, the cells are unstained and contrasted against a dark background. »» Explain how the simple and negative staining procedures stain and do not stain cells, respectively.
cells visually into two groups based on staining differences. The Gram stain technique is named for Christian Gram, the Danish physician who first perfected the technique in 1884. The first two steps of the technique are straightforward ( FIGURE 3.12A ). Air-dried, heatfixed smears are (1) stained with crystal violet, rinsed, and then (2) a special Gram’s iodine solution is added. All bacterial cells would appear blue-purple if the procedure was stopped and the sample viewed with the light microscope. Next, the smear is (3) rinsed with a decolorizer, such as 95% alcohol or an alcohol-acetone mixture.
62582_CH03_064_096.pdf 87
Observed at this point, certain bacterial cells may lose their color and become transparent. These are the gram-negative bacterial cells. Others retain the crystal violet and represent the grampositive bacterial cells. The last step (4) uses safranin, a red cationic dye, to counterstain the gram-negative organisms; that is, give them a orange-red color. So, at the technique’s conclusion, gram-positive cells are blue-purple while gram-negative cells are orange-red ( FIGURE 3.12B ). Similar to simple staining, gram staining also allows the observer to determine size, shape, and arrangement of cells.
2/4/10 2:00 PM
88
CHAPTER 3
Gram-positive bacterial cell
Gram-negative bacterial cell
Concepts and Tools for Studying Microorganisms
Step 1 Crystal violet
Step 2 Iodine
Step 3 Alcohol wash
Step 4 Safranin
Purple
Blue-purple
Remains blue-purple
Remains blue-purple
Purple
Blue-purple
Loses stain
Orange-red
(A) Gram stain technique
(B)
FIGURE 3.12 Important Staining Reactions in Microbiology. The Gram stain technique is a differential staining procedure. (A) All bacterial cells stain with the crystal violet and iodine, but only gram-negative cells lose the color when alcohol is applied. Subsequently, these bacterial cells stain with the safranin dye. Gram-positive cells remain blue purple. (B) This light micrograph demonstrates the staining results of a Gram stain for differentiating between gram-positive and gram-negative cells. (Bar = 10 µm.) »» Besides identifying the Gram reaction, what other characteristics can be determined using the Gram stain procedure?
Toxins: Chemical substances that are poisonous.
62582_CH03_064_096.pdf 88
Knowing whether a bacterial cell is Gram positive or Gram negative is important for microbiologists and clinical technicians who use the results from the Gram stain technique to classify it in Bergey’s Manual or aid in the identification of an unknown bacterial species (TEXTBOOK CASE 3). Gram-positive and gram-negative bacterial cells also differ in their susceptibility to chemical substances such as antibiotics (grampositive cells are more susceptible to penicillin, gram-negative cells to tetracycline). Also, gram-negative cells have more complex cell walls, as described in Chapter 4, and gram-positive and gram-negative bacterial species can produce different types of toxins. One other differential staining procedure, the acid-fast technique, deserves mention. This technique is used to identify members of the genus Mycobacterium, one species of which causes tuberculosis. These bacterial organisms are normally difficult to stain with the Gram stain because the cells have very waxy walls that resist the dyes. However, the cell will stain red when treated with carbol-fuchsin (red dye) and heat (or a lipid solubilizer) ( FIGURE 3.13 ). The cells then retain their color when washed with a dilute acid-alcohol solution. Other stained genera lose the red color easily during the acid-alcohol wash. The Mycobacterium species, therefore, is called acid resistant or “acid fast.” Because they stain red and break sharply
when they reproduce, Mycobacterium species often are referred to as “red snappers.” CONCEPT AND REASONING CHECKS
3.11 What would happen if a student omitted the alcohol wash step when doing the Gram stain procedure?
FIGURE 3.13 Mycobacterium tuberculosis. The acid-fast technique is used to identify species of Mycobacterium. The cells retain the red dye after an acid-alcohol wash. (Bar = 10 µm.) »» Why are cells of Mycobacterium resistant to Gram staining?
2/4/10 2:00 PM
3.3 Microscopy
Textbook
CASE
89
3
Bacterial Meningitis and a Misleading Gram Stain 1
A woman comes to the hospital emergency room complaining of severe headache, nausea, vomiting, and pain in her legs. On examination, cerebral spinal fluid (CFS) was observed leaking from a previous central nervous system (CNS) surgical site.
2
The patient indicates that 6 weeks and 8 weeks ago she had undergone CNS surgery after complaining of migraine headaches and sinusitis. Both surgeries involved a spinal tap. Analysis of cultures prepared from the CFS indicated no bacterial growth.
3
The patient was taken to surgery where a large amount of CFS was removed from underneath the old incision site. The pinkish, hazy fluid indicated bacterial meningitis, so among the laboratory tests ordered was a Gram stain.
4
The patient was placed on antibiotic therapy, consisting of vancomycin and cefotaxime.
5
Laboratory findings from the gram-stained CFS smear showed a few gram-positive, spherical bacterial cells that often appeared in pairs. The results suggested a Streptococcus pneumoniae infection.
6
However, upon reexamination of the smear, a few gram-negative spheres were observed.
7
When transferred to a blood agar plate, growth occurred and a prepared smear showed many gramnegative spheres (see figure). Further research indicated that several genera of gram-negative bacteria, including Acinetobacter, can appear gram-positive due to under-decolorization during the alcohol wash step.
8
Although complicated by the under-decolorization outcome, the final diagnosis was bacterial meningitis due to Acinetobacter baumanii. A gram-stained preparation from the blood agar plate.
Questions: (Answers can be found in Appendix D.) A.
From the gram-stained CSF smear, what color were the gram-positive bacterial spheres?
B.
After reexamination of the CFS smear, assess the reliability of the gram-stained smear.
C.
What reagent is used for the decolorization step in the Gram stain?
Adapted from: Harrington, B. J. and Plenzler, M., 2004. Misleading gram stain findings on a smear from a cerebrospinal fluid specimen. Lab. Med. 35(8): 475–478. For additional information see http://www.cdc.gov/ncidod/hip/aresist/acin_general.htm.
Light Microscopy Has Other Optical Configurations KEY CONCEPT
12. Different optical configurations provide detailed views of cells.
Bright-field microscopy provides little contrast ( FIGURE 3.14A ). However, a light microscope can be outfitted with other optical systems to improve contrast of microorganisms without staining.
62582_CH03_064_096.pdf 89
Three systems commonly employed are mentioned here. Phase-contrast microscopy uses a special condenser and objective lenses. This condenser lens on the light microscope splits a light beam and throws the light rays slightly out of phase. The separated beams of light then pass through and around the specimen, and small differences in the refractive index within the specimen show up as different degrees of brightness and contrast. With
2/4/10 2:00 PM
90
CHAPTER 3
Concepts and Tools for Studying Microorganisms
(A)
(B)
(C) FIGURE 3.14 Variations in Light Microscopy. The same Paramecium specimen seen with three different optical configurations: (A) bright-field, (B) phase-contrast, and (C) dark-field. (Bar = 25 µm.) »» What advantage is gained by each of the three microscopy techniques?
phase-contrast microscopy, microbiologists can see organisms alive and unstained ( FIGURE 3.14B ). The structure of yeasts, molds, and protozoa is typically studied with this optical configuration. Dark-field microscopy also uses a special condenser lens mounted under the stage. The condenser scatters the light and causes it to hit the specimen from the side. Only light bouncing off the specimen and into the objective lens
62582_CH03_064_096.pdf 90
makes the specimen visible, as the surrounding area appears dark because it lacks background light ( FIGURE 3.14C ). Dark-field microscopy provides good resolution and often illuminates parts of a specimen not seen with bright-field optics. Dark-field microscopy also is the preferred way to study motility of live cells. Dark-field microscopy helps in the diagnosis of diseases caused by organisms near the limit of resolution of the light microscope. For example, syphilis, caused by the spiral bacterium Treponema pallidum, has a diameter of only about 0.15 µm. Therefore, this bacterial species may be observed in scrapings taken from a lesion of a person who has the disease and observed with dark-field microscopy. Fluorescence microscopy is a major asset to clinical and research laboratories. The technique has been applied to the identification of many microorganisms and is a mainstay of modern microbial ecology and especially clinical microbiology. For fluorescence microscopy, microorganisms are coated with a fluorescent dye, such as fluorescein, and then illuminated with ultraviolet (UV) light. The energy in UV light excites electrons in fluorescein, and they move to higher energy levels. However, the electrons quickly drop back to their original energy levels and give off the excess energy as visible light. The coated microorganisms thus appear to fluoresce; in the case of fluorescein, they glow a greenish yellow. Other dyes produce other colors ( FIGURE 3.15 ). An important application of fluorescence microscopy is the fluorescent antibody technique used to identify an unknown organism. In one variation of this procedure, fluorescein is chemically attached to antibodies, the protein molecules produced by the body’s immune system. These “tagged” antibodies are mixed with a sample of the unknown organism. If the antibodies are specific for that organism, they will bind to it and coat the cells with the dye. When subjected to UV light, the organisms will fluoresce. If the organisms fail to fluoresce, the antibodies were not specific to that organism and a different tagged antibody is tried. More recently, such methods have revolutionized our understanding of the subcellular organi-
2/4/10 2:00 PM
3.3 Microscopy
FIGURE 3.15 Fluorescence Microscopy. Fluorescence microscopy of sporulating cells of Bacillus subtilis. DNA has been stained with a dye that fluoresces red and a sporulating protein with fluorescein (green). RNA synthesis activity is indicated by a dye that fluoresces blue. (Bar = 15 µm.) »» What advantage is gained by using fluorescence optics over the other light microscope optical configurations?
zation in bacterial cells. We will see the results in the next chapter. CONCEPT AND REASONING CHECKS
3.12 What optical systems can improve specimen contrast over bright-field microscopy?
Electron Microscopy Provides Detailed Images of Cells, Cell Parts, and Viruses KEY CONCEPT
13. Electron microscopy uses a beam of electrons to magnify and resolve specimens.
The electron microscope grew out of an engineering design made in 1932 by the German physicist Ernst Ruska (winner of the 1986 Nobel Prize in Physics). Ruska showed that electrons will flow in a sealed tube if a vacuum is maintained to prevent electron scattering. Magnets, rather than glass lenses, pinpoint the flow onto an object, where the electrons are absorbed, deflected, or transmitted depending on the density of structures within the object ( FIGURE 3.16 ). When projected onto a screen underneath, the electrons form a final image that outlines the structures. As mentioned
62582_CH03_064_096.pdf 91
in Chapter 1, the early days of electron microscopy produced electron micrographs that showed bacterial cells indeed were cellular but their structure was different from eukaryotic cells. The power of electron microscopy is the extraordinarily short wavelength of the beam of electrons. Measured at 0.005 nm (compared to 550 nm for visible light), the short wavelength dramatically increases the resolving power of the system and makes possible the visualization of viruses and detailed cellular structures, often called the ultrastructure of cells. The practical limit of resolution of biological samples with the electron microscope is about 2 nm, which is 100× better than the resolving power of the light microscope. The drawback of the electron microscope is that the method needed to prepare a specimen kills the cells or organisms. Two types of electron microscopes are commonly in use. The transmission electron microscope (TEM) is used to view and record detailed structures within cells ( FIGURE 3.17A ). Ultrathin sections of the prepared specimen must be cut because the electron beam can penetrate matter only a very short distance. After embedding the specimen in a suitable plastic mounting medium or freezing it, scientists cut the specimen into sections with a diamond knife. In this manner, a single bacterial cell can be sliced, like a loaf of bread, into hundreds of thin sections. Several of the sections are placed on a small grid and stained with heavy metals such as lead and osmium to provide contrast. The microscopist then inserts the grid into the vacuum chamber of the microscope and focuses a 100,000-volt electron beam on one portion of a section at a time. An image forms on the screen below or can be recorded on film. The electron micrograph may be enlarged with enough resolution to achieve a final magnification approaching 2 million ×. The scanning electron microscope (SEM) was developed in the late 1960s to enable researchers to see the surfaces of objects in the natural state and without sectioning. The specimen is placed in the vacuum chamber and covered with a thin coat of gold. The electron beam then scans across the specimen and knocks loose showers of electrons that are captured by a detector. An image builds line by line, as in a television receiver. Electrons
91
Electron micrographs: Images recorded on electron-sensitive film.
2/4/10 2:00 PM
92
CHAPTER 3
Concepts and Tools for Studying Microorganisms
Electron source Condenser lens Specimen Objective lens Intermediate image
Projector lens
Binoculars
Final image on photographic film or screen (A)
(B)
FIGURE 3.16 The Electron Microscope. (A) A transmission electron microscope (TEM). (B) A schematic of a TEM. A beam of electrons is emitted from the electron source and electromagnets are used to focus the beam on the specimen. The image is magnified by objective and projector lenses. The final image is projected on a screen, television monitor, or photographic film. »» How does the path of the image for the transmission electron microscope compare with that of the light microscope (Figure 3.10)?
(A)
(B)
Transmission and Scanning Electron Microscopy Compared. The bacterium Pseudomonas aeruginosa (false-color images) as seen with two types of electron microscopy. (A) A view of sectioned cells seen with the transmission electron microscope. (Bar = 1.0 µm.) (B) A view of whole cells seen with the scanning electron microscope. (Bar = 3.0 µm.) »» What types of information can be gathered from each of these electron micrographs? FIGURE 3.17
that strike a sloping surface yield fewer electrons, thereby producing a darker contrasting spot and a sense of three dimensions. The resolving power of the conventional SEM is about 10 nm and magnifications with the SEM are limited to about 20,000×. However, the instrument provides vivid
62582_CH03_064_096.pdf 92
and undistorted views of an organism’s surface details ( FIGURE 3.17B ). The electron microscope has added immeasurably to our understanding of the structure and function of microorganisms by letting us penetrate their innermost secrets. In the chapters ahead, we
2/4/10 2:00 PM
Summary of Key Concepts
93
TABLE
3.3
Comparison of Various Types of Microscopy
Type of Microscopy
Light Bright-field
Phase-contrast
Dark-field
Fluorescence
Electron Transmission
Scanning
Special Feature
Appearance of Object
Magnification Range
Objects Observed
Arrangement, shape, and size of killed microorganisms (except viruses) Internal structures of live, unstained eukaryotic microorganisms Live, unstained microorganisms; motility of live cells Outline of microorganisms coated with fluorescenttagged antibodies
Visible light illuminates object
Stained microorganisms on clear background
100×–1,000×
Special condenser throws light rays “out of phase” Special condenser scatters light
Unstained microorganisms with contrasted structures Unstained microorganisms on dark background Fluorescing microorganisms on dark background
100×–1,000×
Alternating light and dark areas contrasting internal cell structures Microbial surfaces
100×–2,000,000×
UV light illuminates fluorescent-coated objects Short-wavelength electron beam penetrates sections Short-wavelength electron beam knocks loose electron showers
will encounter many of the structures discovered with electron microscopy, and we will better appreciate microbial physiology as it is defined by microbial structures. The various types of light and electron microscopy are compared in TABLE 3.3 .
100×–1,000×
100×–1,000×
10×–20,000×
Ultrathin slices of microorganisms and internal components Surfaces and textures of microorganisms and cell components
CONCEPT AND REASONING CHECKS
3.13 What type of electron microscope would be used to examine (a) the surface structures on a Paramecium cell and (b) the organelles in an algal cell?
SUMMARY OF KEY CONCEPTS 3.1 The Bacteria/Eukaryotic Paradigm 1. All living organisms share the common emergent properties of life, attempt to maintain a stable internal state called homeostasis, and interact through a multicellular association (a biofilm) involving chemical communication and cooperation between cells. 2. Bacterial and eukaryotic cells share certain organizational patterns, including genetic organization, compartmentation, metabolic organization, and protein synthesis. 3. Although bacterial and eukaryotic cells carry out many similar processes, eukaryotic cells often contain membrane-enclosed compartments (organelles) to accomplish the processes. 3.2 Classifying Microorganisms 4. Many systems of classification have been devised to catalog organisms based on shared characteristics. 5. Based on several molecular and biochemical differences, Woese proposed a three-domain system where the prokaryotes are
62582_CH03_064_096.pdf 93
separated into two domains, the Bacteria and Archaea. The kingdoms Protista, Fungi, Plantae, and Animalia are placed in the domain Eukarya. 6. Part of an organism’s binomial name is the genus name; the remaining part is the specific epithet that describes the genus name. Thus, a species name consists of the genus and specific epithet. 7. Organisms are properly classified using a standardized hierarchical system from species (the least inclusive) to domain (the most inclusive). 8. Bergey’s Manual is the standard reference to identify and classify bacterial species. Criteria have included traditional characteristics, but modern molecular methods have led to a reconstruction of evolutionary events and organism relationships.
2/4/10 2:01 PM
94
CHAPTER 3
Concepts and Tools for Studying Microorganisms
3.3 Microscopy 9. Another criterion of a microorganism is its size, a characteristic that varies among members of different groups. The micrometer (lm) is used to measure the dimensions of bacterial, protozoal, and fungal cells. The nanometer (nm) is commonly used to express viral sizes. 10. The instrument most widely used to observe microorganisms is the light microscope. Light passes through several lens systems that magnify and resolve the object being observed. Although magnification is important, resolving power is key. The light microscope can magnify up to 1,000× and resolve objects as small as 0.2 µm. 11. For bacterial cells, staining generally precedes observation. The simple, negative, Gram, acid-fast, and other staining
techniques can be used to impart contrast and determine structural or physiological properties. 12. Microscopes employing phase-contrast, dark-field, and fluorescence optics have specialized uses in microbiology to contrast cells without staining. 13. To increase resolving power and achieve extremely high magnification, the electron microscope employs a beam of electrons to magnify and resolve specimens. To observe internal details (ultrastructure), the transmission electron microscope is most often used; to see whole objects or surfaces, the scanning electron microscope is useful.
LEARNING OBJECTIVES After understanding the textbook reading, you should be capable of writing a paragraph that includes the appropriate terms and pertinent information to answer the objective. 1. Assess the importance of homeostasis to cell (organismal) survival and contrast bacteria as unicellular and multicellular organisms. 2. Describe the four organizational patterns common to all organisms. 3. Identify the structural distinctions between bacterial and eukaryotic cells. 4. Explain how knowledge of shared characteristics changed the classification of living organisms from Linnaeus to Woese. 5. Explain the assignment of organisms to the three-domain system of classification.
6. Write scientific names of organisms using the binomial system. 7. Identify the taxa used to classify organisms from least to most inclusive taxa. 8. Contrast the determinative methods used to identify bacterial species. 9. Identify how microbial agents are measured using metric system units. 10. Assess the importance of magnification and resolving power to microscopy. 11. Summarize the Gram stain procedure. 12. Identify the optical configurations that provide contrast with light microscopy. 13. Compare the uses of the transmission and scanning electron microscopes.
STEP A: SELF-TEST Each of the following questions is designed to assess your ability to remember or recall factual or conceptual knowledge related to this chapter. Read each question carefully, then select the one answer that best fits the question or statement. Answers to even-numbered questions can be found in Appendix C. 1. What is the term that describes the ability of organisms to maintain a stable internal state? A. Metabolism B. Homeostasis C. Biosphere D. Ecotype 2. Which one of the following is NOT an organizational pattern common to all organisms? A. Genetic organization B. Protein synthesis C. Compartmentation D. Microcompartments 3. Which one of the following is NOT found in bacterial cells? A. Ribosomes B. DNA C. Mitochondria D. Cytoplasm
62582_CH03_064_096.pdf 94
4. Who is considered to be the father of modern taxonomy? A. Woese B. Whittaker C. Haeckel D. Linnaeus 5. ______ was first used to catalog organisms into one of three domains. A. Photosynthesis B. Ribosomal RNA genes C. Nuclear DNA genes D. Mitochondrial DNA genes 6. Which one of the following is the correct genus name for the bacterial organism that causes syphilis? A. pallidum B. Treponema C. pallidum D. T. pallidum 7. Several classes of organisms would be classified into one A. order. B. genus. C. phylum. D. family.
2/4/10 2:01 PM
Step B: Review
8. An important method used in the rapid identification of a pathogen is ______. A. rRNA gene sequencing B. polymerase chain reaction C. molecular taxonomy D. biochemical tests 9. Most bacterial cells are measured using what metric system of length? A. Millimeters (mm) B. Micrometers (µm) C. Nanometers (nm) D. Centimeters (cm) 10. Resolving power is the ability of a microscope to A. estimate cell size. B. magnify an image. C. see two close objects as separate. D. keep objects in focus.
95
11. Before bacterial cells are simple stained and observed with the light microscope, they must be A. smeared on a slide. B. heat fixed. C. air dried. D. All the above (A–C) are correct. 12. If you wanted to study bacterial motility you would most likely use A. a transmission electron microscope. B. a light microscope with dark-field optics. C. a scanning electron microscope. D. a light microscope with phase-contrast optics. 13. If you wanted to study the surface of a bacterial cell, you would use A. a transmission electron microscope. B. a light microscope with phase-contrast optics. C. a scanning electron microscope. D. a light microscope with dark-field optics.
STEP B: REVIEW Answers to even-numbered questions or statements can be found in Appendix C.
15. Construct a concept map for staining techniques using the following terms only once. acid-fast technique differential stain procedure acidic dye gram negative basic dye gram positive blue-purple cells gram stain technique cell arrangement Mycobacterium cell shape negative stain technique cell size orange-red cells contrast simple stain technique
14. Construct a concept map for Living Organisms using the following terms (terms can be used more than once). bacterial cells Golgi apparatus cell membrane lysosomes chloroplasts microcompartments cytoplasm mitochondria cytoskeleton nucleus cytosol RER DNA region ribosomes eukaryotic cells SER flagella Match the statement on the left to the term on the right by placing the letter of the term in the available space.
Term
Statement 16. _____ Major group of organisms whose cells have no nucleus or organelles in the cytoplasm. 17. _____ Bacterial organisms capable of photosynthesis. 18. _____ Type of electron microscope for which cell sectioning is not required. 19. _____ These structures carry out protein synthesis in all cells. 20. _____ The organelle, absent in bacteria, that carries out the conversion of chemical energy to cellular energy in eukaryotes.
A. B. C. D. E. F. G. H. I.
Bacteria Chloroplast Cyanobacteria Dark-field Eukarya Family Fluorescence Fungi Gram
J. K. L. M. N. O. P. Q. R.
Homeostasis Mitochondrion Negative Phase-contrast Ribosomes Scanning Simple Taxonomy Transmission
21. _____ Domain in which fungi and protista are classified. 22. _____ Staining technique that differentiates bacterial cells into two groups. 23. _____ Category into which two or more genera are grouped. 24. _____ The staining technique employing a single cationic dye. 25. _____ Type of microscopy using UV light to excite a dye-coated specimen.
62582_CH03_064_096.pdf 95
HTTP://MICROBIOLOGY.JBPUB.COM/9E The site features eLearning, an online review area that provides quizzes and other tools to help you study for your class. You can also follow useful links for in-depth information, read more MicroFocus stories, or just find out the latest microbiology news.
2/5/10 1:02 PM
96
CHAPTER 3
Concepts and Tools for Studying Microorganisms
STEP C: APPLICATIONS Answers to even-numbered questions can be found in Appendix C. 26. A student is performing the Gram stain technique on a mixed culture of gram-positive and gram-negative bacterial cells. In reaching for the counterstain in step 4, he inadvertently takes the methylene blue bottle and proceeds with the technique. What will be the colors of grampositive and gram-negative bacteria at the conclusion of the technique? 27. Would the best resolution with a light microscope be obtained using red light (λ = 680 nm), green light (λ = 520 nm), or blue light (λ = 500 nm)? Explain your answer. 28. Identify the cell structures (a–p) indicated in drawings (A) and (B) below.
29. The electron micrograph below shows a group of bacterial cells. The micrograph has been magnified 5,000×. At this magnification, the cells are about 10 mm in length. Calculate the actual length of the bacterial cells in micrometers (µm)?
a k
b
j
c d
l
p
i
m
e h (A)
n g
f
(B)
(A)
STEP D: QUESTIONS FOR THOUGHT AND DISCUSSION Answers to even-numbered questions can be found in Appendix C. 30. A local newspaper once contained an article about “the famous bacteria E. coli.” How many things can you find wrong in this phrase? Rewrite the phrase correctly. 31. Microorganisms have been described as the most chemically diverse, the most adaptable, and the most ubiquitous organisms on Earth. Although your knowledge of microorganisms still may be limited at this point, try to add to this list of “mosts.” 32. Bacteria lack the cytoplasmic organelles commonly found in the eukaryotes. Provide a reason for this structural difference. 33. A new bacteriology laboratory is opening in your community. What is one of the first books that the laboratory director will want to purchase? Why is it important to have this book?
62582_CH03_064_096.pdf 96
34. In a respected science journal, an author wrote, “Linnaeus gave each life form two Latin names, the first denoting its genus and the second its species.” A few lines later, the author wrote, “Man was given his own genus and species hom*o sapiens.” What is conceptually and technically wrong with both statements? 35. A student of general biology observes a microbiology student using immersion oil and asks why the oil is used. “To increase the magnification of the microscope” is the reply. Do you agree? Why? 36. Every state has an official animal, flower, or tree, but only Oregon has a bacterial species named in its honor: Methanohalophilus oregonese. The specific epithet oregonese is obvious, but can you decipher the meaning of the genus name?
2/4/10 2:01 PM
4 Chapter Preview and Key Concepts
Cell Structure and Function in the Bacteria and Archaea Our planet has always been in the “Age of Bacteria,” ever since the first fossils—bacteria of course—were entombed in rocks more than 3 billion years ago. On any possible, reasonable criterion, bacteria are—and always have been—the dominant forms of life on Earth. —Paleontologist Stephen J. Gould (1941–2002) “Double, double toil and trouble; Fire burn, and cauldron bubble” is the refrain repeated several times by the chanting witches in Shakespeare’s Macbeth (Act IV, Scene 1). This image of a hot, boiling cauldron actually describes the environment in which many bacterial, and especially archaeal, species happily grow! For example, some species can be isolated from hot springs or the hot, acidic mud pits of volcanic vents ( FIGURE 4.1 ). When the eminent evolutionary biologist and geologist Stephen J. Gould wrote the opening quote of this chapter, he as well as most microbiologists had no idea that embedded in these “bacteria” was another whole domain of organisms. Thanks to the pioneering studies of Carl Woese and his colleagues, it now is quite evident there are two distinctly different groups of “prokaryotes”—the Bacteria and the Archaea (see Chapter 3). Many of the organisms Woese and others studied are organisms that would live a happy life in a witch’s cauldron because they can grow at high temperatures, produce methane gas, or survive in extremely acidic and hot environments—a real cauldron! Termed extremophiles, these members of the domains Bacteria
1.1 The Beginnings of Microbiology 4.1 Diversity among the Bacteria and Archaea 1.1.•The Bacteria Theare discovery of microorganisms classified into several was dependent major phyla. on observations made with 2.the Themicroscope Archaea are currently classified into two 2. •major phyla. The emergence of experimental provided a means to test long held 4.2 Cellscience Shapes and Arrangements beliefs and resolve controversies 3. Many bacterial cells have a rod, spherical, or 3. MicroInquiry 1: Experimentation anda specific spiral shape and are organized into Scientifi c Inquiry cellular arrangement. 1.2 Microorganisms and Disease 4.3 An Overview to Bacterial andTransmission Archaeal 4. Early epidemiology studies Cell• Structure suggested how diseases could be spread and 4. Bacterial and archaeal cells are organized at be controlled the cellular and molecular levels. 5. • Resistance to a disease can come 4.4 External Cell Structures from exposure to and recovery from a mild 5.form Pili allow to attach to surfaces of (orcells a very similar) disease or other cells. 1.3 The Classical Golden Age of Microbiology 6. Flagella provide motility. 6. (1854-1914) 7. A glycocalyx protects against desiccation, 7. • The germ theory was based on the attaches cells to surfaces, and helps observations that different microorganisms pathogens evade the immune system. have distinctive and specific roles in nature 4.5 8. The• Cell Envelope Antisepsis and identification of the 8.cause Bacterial cell walls help reinforced maintain cell of animal diseases theshape germ and protect the cell membrane from rupture. theory walls have crystalline 9.9.•Archaeal cell Koch's postulates providedlayers. a way to 10.identify Molecules and ions cross the cellas membrane a specifi c microorganism causing a by facilitated diffusion or active transport. specifi c infectious disease 11. Archaeal membranes are structurally unique. 10. • Laboratory science and teamwork the discovery of additional 4.6 Thestimulated Cell Cytoplasm and Internal infectious disease agents Structures 11. Viruses also can 12.•The nucleoid contains thecause cell’s disease essential 12. •genetic information. Many beneficial bacteria recycle the environment 13.nutrients Plasmidsin contain nonessential genetic information. 14. Ribosomes, microcompartments, and inclusions carry out specific intracellular functions. 15. Cytoskeletal proteins regulate cell division and help determine cell shape. 4.7 The Bacteria/Eukaryote Paradigm—
Revisited 16. Cellular processes in bacterial cells can be similar to those in eukaryatic cells. MICROINQUIRY 4: The Prokaryote/Eukaryote Model
97
62582_CH04_097_130.pdf 97
2/4/10 2:14 PM
98
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
(A)
(B)
Life at the Edge. Bacterial and archaeal extremophiles have been isolated from the edges of natural cauldrons, including (A) the Grand Prismatic Spring in Yellowstone National Park, Wyoming, where the water of the hot spring is over 70ºC, or (B) the mud pools surrounding sulfurous steam vents of the Solfatara Crater in Pozzuoli, Italy, where the mud has a very low pH and a temperature above 90º. »» How do extremophiles survive under these extreme conditions? FIGURE 4.1
and Archaea have a unique genetic makeup and have adapted to extreme environmental conditions. In fact, Gould’s “first fossils” may have been archaeal species. Many microbiologists believe the ancestors of today’s archaeal species might represent a type of organism that first inhabited planet Earth when it was a young, hot place (see MicroFocus 2.1). These unique characteristics led Woese to propose these organisms be lumped together and called the Archaebacteria (archae = “ancient”). Since then, the domain name has been changed to Archaea because (1) not all members are extremophiles or related to these possible ancient ancestors and (2) they are not Bacteria—they are Archaea. Some might also debate using the term prokaryotes when referring to both domains, as organisms in the two domains are as different from each other as they are from the Eukarya.
4.1
Diversity among the Bacteria and Archaea
In this section, we discuss bacterial and archaeal diversity using the current classification scheme, which is based in large part on nucleotide sequence data. There are some 7,000 known
62582_CH04_097_130.pdf 98
As more microbes have had their complete genomes sequenced, it now is clear that there are unique as well as shared characteristics between species in the domains Bacteria and Archaea. In this chapter, we examine briefly some of the organisms in the domains Bacteria and Archaea. However, because almost all known “prokaryotic” pathogens of humans are in the domain Bacteria, we emphasize structure within this domain. As we see in this chapter, a study of the structural features of bacterial cells provides a window to their activities and illustrates how the Bacteria relate to other living organisms. As we examine bacterial and archaeal cell structure, we can assess the dogmatic statement that these cells are characterized by a lack of a cell nucleus and internal membrane-bound organelles. Before you finish this chapter, you will be equipped to revise this view.
bacterial and archaeal species and a suspected 10 million species. In this section, we will highlight a few phyla and groups using the phylogenetic tree in FIGURE 4.2 .
2/4/10 2:14 PM
4.1 Diversity among the Bacteria and Archaea
BACTERIA (>70 major phyla)
ARCHAEA (2 major phyla)
Chlamydia Spirochaetes
99
Euryarchaeota Methanogens
Extreme halophiles
Proteobacteria Gram-positive bacteria
Crenarchaeota Eukarya Hyperthermophiles
UNIVERSAL ANCESTOR FIGURE 4.2 The Phylogenetic Tree of Bacteria and Archaea. The tree shows several of the bacterial and archaeal phyla discussed in this chapter. »» What is common to the branch base of both the Bacteria and Archaea?
The Domain Bacteria Contains Some of the Most Studied Microbial Organisms KEY CONCEPT
1.
The Bacteria are classified into several major phyla.
There are about 18 phyla of Bacteria identified from culturing or nucleotide sequencing. It should come as no shock to you by now to read that the vast majority of these phyla play a positive role in nature (MICROFOCUS 4.1). Although not unique to just the bacterial phyla, they digest sewage into simple chemicals; they extract nitrogen from the air and make it available to plants for protein production; they break down the remains of all that die and recycle the carbon and other elements; and they produce oxygen gas that we and other animals breathe. Of course, we know from Chapter 1 and personal experience that some bacterial organisms are harmful—many human pathogens are members of the domain Bacteria. Certain species multiply within the human body, where they disrupt tissues or produce toxins that result in disease. The Bacteria have adapted to the diverse environments on Earth, inhabiting the air, soil, and water, and they exist in enormous numbers on the surfaces of virtually all plants and animals. They can be isolated from Arctic ice, thermal hot
62582_CH04_097_130.pdf 99
springs, the fringes of space, and the tissues of animals. Bacterial species, along with their archaeal relatives, have so completely colonized every part of the Earth that their mass is estimated to outweigh the mass of all plants and animals combined. Let’s look briefly at some of the major phyla and other groups. Proteobacteria. The Proteobacteria (proteo = “first”) contains the largest and most diverse group of species and includes many familiar gram-negative genera, such as Escherichia ( FIGURE 4.3A ). The phylum also includes some of the most recognized human pathogens, including species of Shigella, Salmonella, Neisseria (responsible for gonorrhea), Yersinia (responsible for plague), and Vibrio (responsible for cholera). It is likely that the mitochondria of the Eukarya were derived through endosymbiosis from an ancestor of the Proteobacteria (see MicroInquiry 3). The group also includes the rickettsiae (sing., rickettsia), which were first described by Howard Taylor Ricketts in 1909. These tiny bacterial cells can barely be seen with the most powerful light microscope. They are transmitted among humans primarily by arthropods, and are cultivated only in living tissues such as chick embryos. Different species cause a number of important diseases, including Rocky Mountain spotted fever and
Arthropods: Animals having jointed appendages and segmented body (e.g., ticks, lice, fleas, mosquitoes).
2/4/10 2:14 PM
100
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
4.1
Bacteria in Eight Easy Lessons1 Mélanie Hamon, an assistante de recherché at the Institut Pasteur in Paris, says that when she introduces herself as a bacteriologist, she often is asked, “Just what does that mean?” To help explain her discipline, she gives us, in eight letters, what she calls “some demystifying facts about bacteria.”
B
asic principles: Their average size is 1/25,000th of an inch. In other words, hundreds of thousands of bacteria fit into the period at the end of this sentence. In comparison, human cells are 10 to 100 times larger with a more complex inner structure. While human cells have copious amounts of membranecontained subcompartments, bacteria more closely resemble pocketless sacs. Despite their simplicity, they are self-contained living beings, unlike viruses, which depend on a host cell to carry out their life cycle.
A
stonishing: Bacteria are the root of the evolutionary tree of life, the source of all living organisms. Quite successful evolutionarily speaking, they are ubiquitously distributed in soil, water, and extreme environments such as ice, acidic hot springs or radioactive waste. In the human body, bacteria account for 10% of dry weight, populating mucosal surfaces of the oral cavity, gastrointestinal tract, urogenital tract and surface of the skin. In fact, bacteria are so numerous on earth that scientists estimate their biomass to far surpass that of the rest of all life combined.
C
rucial: It is a little known fact that most bacteria in our bodies are harmless and even essential for our survival. Inoffensive skin settlers form a protective barrier against any troublesome invader while approximately 1,000 species of gut colonizers work for our benefit, synthesizing vitamins, breaking down complex nutrients and contributing to gut immunity. Unfortunately for babies (and parents!), we are born with a sterile gut and “colic” our way through bacterial colonization.
T
ools: Besides the profitable relationship they maintain with us, bacteria have many other practical and exploitable properties, most notably, perhaps, in the production of cream, yogurt and cheese. Less widely known are their industrial applications as antibiotic factories, insecticides, sewage processors, oil spill degraders, and so forth.
E
vil: Unfortunately, not all bacteria are “good,” and those that cause disease give them all an often undeserved and unpleasant reputation. If we consider the multitude of mechanisms these “bad” bacteria—pathogens—use to assail their host, it is no wonder that they get a lot of bad press. Indeed, millions of years of coevolution have shaped bacteria into organisms that “know” and “predict” their hosts’ responses. Therefore, not only do bacterial toxins know their target, which is never missed, but bacteria can predict their host’s immune response and often avoid it.
R
esistant: Even more worrisome than their effectiveness at targeting their host is their faculty to withstand antibiotic therapy. For close to 50 years, antibiotics have revolutionized public health in their ability to treat bacterial infections. Unfortunately, overuse and misuse of antibiotics have led to the alarming fact of resistance, which promises to be disastrous for the treatment of such diseases.
I
ngenious: The appearance of antibiotic-resistant bacteria is a reflection of how adaptable they are. Thanks to their large populations they are able to mutate their genetic makeup, or even exchange it, to find the appropriate combination that will provide them with resistance. Additionally, bacteria are able to form “biofilms,” which are cellular aggregates covered in slime that allow them to tolerate antimicrobial applications that normally eradicate free-floating individual cells.
A
long tradition: Although “little animalcules” were first observed in the 17th century, it was not until the 1850s that Louis Pasteur fathered modern microbiology. From this point forward, research on bacteria has developed into the flourishing field it is today. For many years to come, researchers will continue to delve into this intricate world, trying to understand how the good ones can help and how to protect ourselves from the bad ones. It is a great honor to be part of this tradition, working in the very place where it was born. 1Republished
with permission of the author, the Institut Pasteur, and the Pasteur Foundation. The original article appeared in Pasteur Perspectives Issue 20 (Spring 2007), the newsletter of the Pasteur Foundation, which may be found at www.pasteurfoundation.org © Pasteur Foundation.
62582_CH04_097_130.pdf 100
2/4/10 2:15 PM
4.1 Diversity among the Bacteria and Archaea
(A)
(B)
(C)
(D)
(E)
(F)
101
Members of the Domain Bacteria. (A) Escherichia coli (Bar = 10 µm.), (B) Staphylococcus aureus (Bar = 10 µm.), (C) Mycoplasma species (Bar = 2 µm.), (D) Streptomyces species (Bar = 20 µm.), (E) Anabaena species (Bar = 100 µm.), and (F) Treponema pallidum (Bar = 10 µm.). All images are light micrographs except (C), a false-color scanning electron micrograph. »» What is the Gram staining result for E. coli and S. aureus? FIGURE 4.3
typhus fever. Chapter 12 contains a more thorough description of their properties. Firmicutes. The Firmicutes (firm = “strong”; cuti = “skin”) consists of many species that are grampositive. As we will see in this chapter, they share a similar thick “skin,” which refers to their cell wall structure. Genera include Bacillus and Clostridium,
62582_CH04_097_130.pdf 101
specific species that are responsible for anthrax and botulism, respectively. Species within the genera Staphylococcus and Streptococcus are responsible for several mild to life-threatening human illnesses ( FIGURE 4.3B ). Also within the Firmicutes is the genus Mycoplasma, which lacks a cell wall but is otherwise
2/4/10 2:15 PM
102
CHAPTER 4
Blooms: Sudden increases in the numbers of cells of an organism in an environment.
62582_CH04_097_130.pdf 102
Cell Structure and Function in the Bacteria and Archaea
phylogenetically related to the gram-positive bacterial species ( FIGURE 4.3C ). Possibly the smallest free-living bacterial cell, one species causes a form of pneumonia (Chapter 10) while another mycoplasmal illness represents a sexually-transmitted disease (Chapter 13). Actinobacteria. Another phylum of gram-positive species is the Actinobacteria. Often called the actinomycetes, these bacterial organisms form a system of branched filaments that somewhat resemble the growth form of fungi. The genus Streptomyces is the source for important antibiotics ( FIGURE 4.3D ). Another medically important genus is Mycobacterium, one species of which is responsible for tuberculosis. Cyanobacteria. In Chapter 3 we discussed the cyanobacteria. They are phylogenetically related to the gram-positive species and can exist as unicellular, filamentous, or colonial forms ( FIGURE 4.3E ). Once known as blue-green algae because of their pigmentation, pigments also may be black, yellow, green, or red. The periodic redness of the Red Sea, for example, is due to blooms of cyanobacteria whose members contain large amounts of red pigment. The phylum Cyanobacteria are unique among bacterial groups because they carry out photosynthesis similar to unicellular algae (Chapter 6) using the light-trapping pigment chlorophyll. Their evolution on Earth was responsible for the “oxygen revolution” that transformed life on the young planet. In addition, chloroplasts probably are derived from the endosymbiotic union with a cyanobacterial ancestor. Chlamydiae. Roughly half the size of the rickettsiae, members of the phylum Chlamydiae are so small that they cannot be seen with the light microscope and are cultivated only within living cells. Most species in the phylum are pathogens and one species causes the gonorrhea-like disease known as chlamydia. Chlamydial diseases are described in Chapter 13. Spirochaetes. The phylum Spirochaetes contains more than 340 gram-negative species that possess a unique cell body that coils into a long helix and moves in a corkscrew pattern. The ecological niches for the spirochetes is diverse: from free-living species found in mud and sediments, to symbiotic species present in the digestive tracts of insects, to the pathogens found in the urogenital tracts of vertebrates. Many spirochetes
are found in the human oral cavity; in fact, some of the first animalcules seen by Leeuwenhoek were probably spirochetes from his teeth scrapings (see Chapter 1). Among the human pathogens are Treponema pallidum, the causative agent of syphilis and one of the most common sexually transmitted diseases ( FIGURE 4.3F ; Chapter 13); and specific species of Borrelia, which are transmitted by ticks or lice and are responsible for Lyme disease and relapsing fever (Chapter 12). Other Phyla. There are many other phyla within the domain Bacteria. Several lineages branch off near the root of the domain. The common link between these organisms is that they are hyperthermophiles; they grow at high temperatures. Examples include Aquifex and Thermotoga, which typically are found in earthly cauldrons such as hot springs. CONCEPT AND REASONING CHECKS
4.1 What three unique events occurred within the Proteobacteria and Cyanobacteria that contributed to the evolution of the Eukarya and the oxygen-rich atmosphere on Earth?
The Domain Archaea Contains Many Extremophiles KEY CONCEPT
2.
The Archaea are currently classified into two major phyla.
Classification within the domain Archaea has been more difficult than within the domain Bacteria, in large part because they have not been studied as long as their bacterial counterparts. Archaeal organisms are found throughout the biosphere. Many genera are extremophiles, growing best at environmental extremes, such as very high temperatures, high salt concentrations, or extremes of pH. However, most species exist in very cold environments although there are archaeal genera that thrive under more modest conditions. The archaeal genera can be placed into one of two major phyla. Euryarchaeota. The Euryarchaeota contain organisms with varying physiologies, many being extremophiles. Some groups, such as the methanogens (methano = “methane”; gen = “produce”) are killed by oxygen gas and therefore are found in environments devoid of oxygen gas. The pro-
2/4/10 2:15 PM
4.1 Diversity among the Bacteria and Archaea
103
(A)
(B)
FIGURE 4.4 Members of the Domain Archaea. (A) A false-color transmission electron micrograph of the methanogen Methanospirillum hungatei. (Bar = 0.5 µm.) (B) An aerial view above Redwood City, California, of the salt ponds whose color is due to high concentrations of extreme halophiles. (C) A false-color scanning electron micrograph of Sulfolobus, a hyperthermophile that grows in waters as hot as 90ºC. (Bar = 0.5 µm.) »» What advantage is afforded these species that grow in such extreme environments?
(C)
duction of methane (natural) gas is important in their energy metabolism ( FIGURE 4.4A ). In fact, these archaeal species release more than 2 billion tons of methane gas into the atmosphere every year. About a third comes from the archaeal species living in the stomach (rumen) of cows (see Chapter 2). Another group is the extreme halophiles (halo = “salt”; phil = “loving”). They are distinct from the methanogens in that they require oxygen gas for energy metabolism and need high concentrations of salt (NaCl) to grow and reproduce. The fact that they often contain pink pigments makes their identification easy ( FIGURE 4.4B ). In addition, some extreme halophiles have been found in lakes where the pH is greater than 11. A third group is the hyperthermophiles that grow optimally at high temperatures approaching or surpassing 100°C.
62582_CH04_097_130.pdf 103
Crenarchaeota. The second phylum, the Crenarchaeota, are mostly hyperthermophiles growing at temperatures above 80°C. Hot sulfur springs are one environment where these archaeal species also thrive. The temperature is around 75°C but the springs are extremely acidic (pH of 2–3). Volcanic vents are another place where these organisms can survive quite happily ( FIGURE 4.4C ). Other species are dispersed in open oceans, often inhabiting the cold ocean waters (–3°C) of the deep sea environments and polar seas. TABLE 4.1 summarizes some of the characteristics that are shared or are unique among the three domains. CONCEPT AND REASONING CHECKS
4.2 Compared to the more moderate environments in which some archaeal species grow, why have others adapted to such extreme environments?
2/4/10 2:15 PM
104
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
TABLE
4.1
Some Major Differences between Bacteria, Archaea, and Eukarya
Characteristic
Bacteria
Archaea
Eukarya
Cell nucleus Chromosome form Histone proteins present Peptidoglycan cell wall Membrane lipids Ribosome sedimentation value Ribosome sensitivity to diphtheria toxin First amino acid in a protein Chlorophyll-based photosynthesis Growth above 80°C Growth above 100°C
No Single, circular No Yes Ester-linked 70S No Formylmethionine Yes (cyanobacteria) Yes No
No Single, circular Yes No Ether-linked 70S Yes Methionine No Yes Yes
Yes Multiple, linear Yes No Ester-linked 80S Yes Methionine Yes (algae) No No
4.2
Cell Shapes and Arrangements
Bacterial and archaeal cells come in a bewildering assortment of sizes, shapes, and arrangements, reflecting the diverse environments in which they grow. As described in Chapter 3, these three characteristics can be studied by viewing stained cells with the light microscope. Such studies show that most, including the clinically significant ones, appear in one of three different shapes: the rod, the sphere, or the spiral. Variations in Cell Shape and Cell Arrangement Exist KEY CONCEPT
3.
Many bacterial cells have a rod, spherical, or spiral shape and are organized into a specific cellular arrangement.
A bacterial cell with a rod shape is called a bacillus (pl., bacilli). In various species of rod-shaped bacteria, the cylindrical cell may be as long as 20 µm or as short as 0.5 µm. Certain bacilli are slender, such as those of Salmonella typhi that cause typhoid fever; others, such as the agent of anthrax (Bacillus anthracis), are rectangular with squared ends; still others, such as the diphtheria bacilli (Corynebacterium diphtheriae), are club shaped. Most rods occur singly, in pairs called diplobacillus, or arranged into a long chain called streptobacillus (strepto = “chains”) ( FIGURE 4.5A ). Realize there are two ways to use the word “bacillus”: to
62582_CH04_097_130.pdf 104
denote a rod-shaped bacterial cell, and as a genus name (Bacillus). A spherically shaped bacterial cell is known as a coccus (pl., cocci; kokkos = “berry”) and tends to be quite small, being only 0.5 µm to 1.0 µm in diameter. Although they are usually round, they also may be oval, elongated, or indented on one side. Many bacterial species that are cocci stay together after division and take on cellular arrangements characteristic of the species ( FIGURE 4.5B ). Cocci remaining in a pair after reproducing represent a diplococcus. The organism that causes gonorrhea, Neisseria gonorrhoeae, and one type of bacterial meningitis (N. meningitidis) are diplococci. Cocci that remain in a chain are called streptococcus. Certain species of streptococci are involved in strep throat (Streptococcus pyogenes) and tooth decay (S. mutans), while other species are harmless enough to be used for producing dairy products such as yogurt (S. lactis). Another arrangement of cocci is the tetrad, consisting of four cocci forming a square. A cube-like packet of eight cocci is called a sarcina (sarcina = “bundle”). Micrococcus luteus, a common inhabitant of the skin, is one example. Other cocci may divide randomly and form an irregular grape-like cluster of cells called a staphylococcus (staphylo = “cluster”). A well-known example, Staphylococcus aureus, is often a cause of food poisoning, toxic shock syndrome, and several skin infections. The latter are known in the modern vernacular as “staph” infections. Notice again that the words “streptococcus” and “staphy-
2/4/10 2:15 PM
4.2 Cell Shapes and Arrangements
105
(A) Bacillus (rod)
Single
Diplobacillus (pair)
Streptobacillus (chain)
(B) Coccus (sphere)
Single
Diplococcus (pair)
Tetrad (group of 4)
Staphylococcus (cluster)
Streptococcus (chain) (C) Spiral
Vibrio (comma-shaped)
Spirillum
Spirochete
FIGURE 4.5 Variation in Shape and Cell Arrangements. Many bacterial and archaeal cells have a bacillus (A) or coccus (B) shape. Most spiral shaped-cells (C) are not organized into a specific arrangement. »» In photomicrograph (C), identify the vibrio and the spirillum forms.
lococcus” can be used to describe cell shape and arrangement, or a bacterial genus (Streptococcus and Staphylococcus). The third common shape of bacterial cells is the spiral, which can take one of three forms ( FIGURE 4.5C ). The vibrio is a curved rod that
62582_CH04_097_130.pdf 105
resembles a comma. The cholera-causing organism Vibrio cholerae is typical. Another spiral form called spirillum (pl., spirilla) has a helical shape with a thick, rigid cell wall and flagella that assist movement. The spiral-shaped form known as spirochete has a thin, flexible cell wall but no flagella
2/4/10 2:15 PM
106
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
in the traditional sense. Movement in these organisms occurs by contractions of endoflagella that run the length of the cell. The organism causing syphilis, Treponema pallidum, typifies a spirochete. Spiral-shaped bacterial cells can be from 1 µm to 100 µm in length. In addition to the bacillus, coccus, and spiral shapes, other variations exist. Some bacterial spe-
cies have appendaged bacterial cells while others consist of branching filaments; and some archaeal species have square and star shapes. CONCEPT AND REASONING CHECKS
4.3 Propose a reason why bacilli do not form tetrads or clusters.
An Overview to Bacterial and Archaeal Cell Structure
4.3
In the last chapter we discovered that bacterial and archaeal cells appear to have little visible structure when observed with a light microscope. This, along with their small size, gave the impression they are hom*ogeneous, static structures with an organization very different from eukaryotic cells. However, the point was made that bacterial and archaeal species still have all the complex processes typical of eukaryotic cells. It is simply a matter that, in most cases, the structure and sometimes pattern to accomplish these processes is different from the membranous organelles typical of eukaryotic species.
Recent advances in understanding bacterial and archaeal cell biology indicate these organisms exhibit a highly ordered intracellular organization. This organization is centered on three specific processes that need to be carried out ( FIGURE 4.6 ). These are: • Sensing and responding to the surrounding environment. Because most bacterial and archaeal cells are surrounded by a cell wall, some pattern of “external structures” is necessary to sense their environment and respond to it or other cells. • Compartmentation of metabolism. As described in Chapter 3, cell metabolism must be segregated from the exterior environment and yet be able to transport materials to and from that environment.
Cell Structure Organizes Cell Function KEY CONCEPT
4.
Bacterial and archaeal cells are organized at the cellular and molecular levels.
Bacterial/archaeal cell is composed of External structures
Cell envelope
include
includes Cytoplasm
Glycocalyx
Flagella
Cytosol
Pili consists of Slime layer
includes
Cell wall Internal structures
Nucleoid Capsule
Cell membrane
Cytoskeleton
include
Ribosomes
Inclusions
Plasmids
FIGURE 4.6 A Concept Map for Studying Bacterial and Archaeal Cell Structure. Not all cells have all the structures shown here. »» Why can’t we see in the TEM image of a bacterial cell all the structures outlined in the concept map?
62582_CH04_097_130.pdf 106
2/4/10 2:15 PM
4.3 An Overview to Bacterial and Archaeal Cell Structure
In addition, protection from osmotic pressure due to water movement into cells must be in place. The “cell envelope” fulfills those roles. • Growth and reproduction. Cell survival demands a complex metabolism that occurs within the aqueous “cytoplasm.” These processes and reproduction exist as internal structures or subcompartments localized to specific areas within the cytoplasm. Our understanding of bacterial and archaeal cell biology is still an emerging field of study. However, there is more to cell structure than previously thought—smallness does not equate with simplicity. Although this chapter is primarily looking at bacterial cells at the cellular level, it also is important to realize that bacterial and archaeal cells, like their eukaryotic counterparts, are organized on the molecular level as well. Specific cellular proteins can be localized to specific regions of the cell. For example, as the name suggests, Streptococcus pyogenes has spherical cells. Yet many of the proteins that confer its pathogenic nature in causing dis-
107
eases like strep throat are secreted from a specific area of the surface. Yersinia pestis, which is the agent responsible for plague, contains a specialized secretion apparatus through which proteins are released. This apparatus only exists on the bacterial surface that is in contact with the target human cells. So, the cell biology studies are not only important in their own right in understanding cell structure, these studies also may have important significance to clinical microbiology and the fight against infectious disease. As more is discovered about these cells and how they truly differ from eukaryotic cells, the better equipped we will be to develop new antimicrobial agents that will target the subcellular organization of pathogens. In an era when we have fewer effective antibiotics to fight infections, the application of the understanding of cell structure and function may be very important. On the following pages, we examine some of the common structures found in an idealized bacterial cell, as no single species contains all the structures ( FIGURE 4.7 ). Our journey starts by examining the structures on or extending from Pili Cytoplasm Ribosome
Plasmid
Flagella Glycocalyx Cell wall Cell membrane Nucleoid (with DNA) Inclusion
FIGURE 4.7 Bacterial Cell Structure. The structural features of a composite, “idealized” bacterial cell. Structures highlighted in blue are found in all bacterial and archaeal species. »» Which structures represent (a) external structures, (b) the cell envelope, and (c) cytoplasmic structures?
62582_CH04_097_130.pdf 107
2/4/10 2:15 PM
108
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
the surface of the cell. Then, we examine the cell envelope and spend some time discussing the cell membrane. Our journey then plunges into the cell cytoplasm. All cells must control and coordinate many metabolic processes that need to be separated from one another. We will discover the
4.4
Mucosal: Referring to the mucous membranes lining many body cavities exposed to the environment. Virulence factor: A pathogen-produced molecule or structure that allows the cell to invade or evade the immune system and possibly cause disease.
CONCEPT AND REASONING CHECKS
4.4 What is gained by bacterial and archaeal cells being organized into three general sets of structures— external, envelope, and cytoplasmic?
External Cell Structures
Bacterial and archaeal cells need to respond to and monitor their external environment. This is made difficult by having a cell wall that “blindfolds” the cell. Many cells have solved this sensing problem by possessing structures that extend from the cell surface into the environment. Pili Are Protein Fibers Extending from the Cell Surface KEY CONCEPT
5.
cytoplasmic subcellular compartmentation that provides this function.
Pili allow cells to attach to surfaces or other cells.
Numerous short, thin fibers, called pili (sing., pilus; pilus = “hair”), protrude from the surface of most gram-negative bacteria ( FIGURE 4.8 ). The rigid fibers, composed of protein, act as scaffolding onto which specific adhesive molecules, called adhesins, are attached. Therefore, the function of pili is to attach cells to surfaces forming biofilms or, in the case of human pathogens, on human cell and tissue surfaces. This requires that the pili on different bacterial species have specialized adhes-
Pili
ins to “sense” the appropriate cell. For example, the pili adhesins on Neisseria gonorrhoeae cells specifically anchor the cells to the mucosal surface of the urogenital tract whereas the adhesins on Bordetella pertussis (causative agent of whooping cough) adhere to cells of the mucosal surface of the upper respiratory tract. In this way, the pili act as a virulence factor by enhancing attachment to host cells, facilitating tissue colonization, and possibly leading to disease development. Without the chemical mooring line lashing the bacterial cells to host cells, it is less likely the cells could infect host tissue (MICROFOCUS 4.2). Besides these attachment pili, some bacterial species produce flexible conjugation pili that establish contact between appropriate cells, facilitating the transfer of genetic material from donor to recipient through a process called conjugation (Chapter 9). Conjugation pili are longer than attachment pili and only one or a few are produced on a cell. Until recently, attachment pili were thought to be specific to only certain species of gram-negative bacteria. However, research now indicates that extremely thin pili are present on at least some gram-positive bacteria, including the pathogen Corynebacterium diphtheriae and Streptococcus species. However, very little is known about their function, although they probably play a very similar role to the pili on gram-negative cells. It should be noted that microbiologists often use the term “pili” interchangeably with “fimbriae” (sing., fimbria; fimbria = “fiber”). CONCEPT AND REASONING CHECKS
4.5 What would happen if pili lacked adhesins?
Flagella Are Long Appendages Extending from the Cell Surface FIGURE 4.8 Bacterial Pili. False-color transmission electron micrograph of an Escherichia coli cell (blue) with many pili (green). (Bar = 0.5 µm.) »» What function do pili play?
62582_CH04_097_130.pdf 108
KEY CONCEPT
6.
Flagella provide motility.
2/4/10 2:15 PM
4.4 External Cell Structures
109
4.2: Public Health
Diarrhea Doozies They gathered at the clinical research center at Stanford University to do their part for the advancement of science (and earn a few dollars as well). They were the “sensational sixty”—sixty young men and women who would spend three days and nights and earn $300 to help determine whether hair-like structures called pili have a significant place in disease. A number of nurses and doctors were on hand to help them through their ordeal. The students would drink a fruit-flavored co*cktail containing a special diarrhea-causing strain of Escherichia coli. Thirty co*cktails had E. coli with normal pili, while thirty had E. coli with pili mutated beyond repair. The hypothesis was that the bacterial cells with normal pili would latch onto intestinal tissue and cause diarrhea, while those with mutated pili would be unable to attach and would be swept away by the rush of intestinal movements and not cause intestinal distress. At least that’s what the sensational sixty would either verify or prove false. On that fateful day in 1997, the experiment began. Neither the students nor the health professionals knew who was drinking the diarrhea co*cktail and who was getting the “free pass”; it was a so-called double-blind experiment. Then came the waiting. Some experienced no symptoms, but others felt the bacterial onslaught and clutched at their last remaining vestiges of dignity. For some, it was three days of hell, with nausea, abdominal cramps, and numerous bathroom trips; for others, luck was on their side, and investing in a lottery ticket seemed like a good idea. When it was all over, the numbers appeared to bear out the hypothesis: The great majority of volunteers who drank the mutated bacterial cells experienced no diarrhea, while the great majority of those who drank the normal bacterial cells had attacks of diarrhea, in some cases real doozies. All appeared to profit from the experience: The scientists had some real-life evidence that pili contribute to infection; the students made their sacrifice to science and pocketed $300 each; and the local supermarket had a surge of profits from unexpected sales of toilet paper, Pepto-Bismol, and Imodium.
Numerous species in the domains Bacteria and Archaea are capable of some type of locomotion. This can be in the form of flagellar motility or gliding motility. Flagellar Motility. Many bacterial and archaeal cells are motile by using remarkable “nanomachines” called flagella (sing., flagellum). Depending on the species, one or more flagella may be attached to one or both ends of the cell, or at positions distributed over the cell surface ( FIGURE 4.9A ). Flagella range in length from 10 µm to 20 µm and are many times longer than the diameter of the cell. Because they are only about 20 nm thick, they cannot be seen with the light microscope unless stained. However, their existence can be inferred by using dark-field microscopy to watch the live cells dart about. In the domain Bacteria, each flagellum is composed of a helical filament, hook, and basal body ( FIGURE 4.9B ). The hollow filament is composed of long, rigid strands of protein while the hook attaches the filament to a basal body anchored in the cell membrane and cell wall.
62582_CH04_097_130.pdf 109
The basal body is an assembly of more than 20 different proteins that form a central rod and set of enclosing rings. Gram-positive bacteria have a pair of rings embedded in the cell membrane and one in the cell wall, while gram-negative bacteria have a pair of rings embedded in the cell membrane and another pair in the cell wall. In the domain Archaea, flagellar protein composition and structure differs from that of the Bacteria; motility appears similar though. The basal body represents a powerful biological motor or rotary engine that generates a propeller-type rotation of the flagellum. The energy for rotation comes from the diffusion of protons (hydrogen ions; H+) into the cell through proteins associated with the basal body. This energy is sufficient to produce up to 1,500 rpm by the filament, driving the cell forward. What advantage is gained by cells having flagella? In nature, there are many chemical nutrients in the environment that cells need to survive. Cells will move toward such attractants by using their flagella to move up the concentration gradient; that is, toward the attractant. The process is called chemotaxis.
2/4/10 2:15 PM
110
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
Filament Hook Outer membrane Peptidoglycan layer
Rotating basal body (A)
Cell wall
Cell membrane Cytoplasm
(B) (b)
FIGURE 4.9 Bacterial Flagella. (A) A light micrograph of Proteus vulgaris showing numerous flagella extending from the cell surface. (Bar = 10 µm.) Note that the length of a flagellum is many times the width of the cell. (B) The flagellum on a gram-negative bacterial cell is attached to the cell wall and membrane by two pairs of protein rings in the basal body. »» Why is the flagellum referred to as a “nanomachine“?
Temporal sensing: One that compares the chemical environment and concentration from one moment to the next.
62582_CH04_097_130.pdf 110
Being so small, the cells sense their chemical surroundings using a temporal sensing system. In the absence of a gradient, the flagella all rotate as a bundle counterclockwise and the cell moves straight ahead in short bursts called “runs” ( FIGURE 4.10A ). These runs can last a few seconds and the cells can move up to 10 body lengths per second (the fastest human can run about 5–6 body lengths per second). A reversal of flagellar rotation (clockwise rotation) causes the cell to “tumble” randomly for a second as the flagella become unbundled. Then, the motor again reverses direction and another run occurs in a new direction. If an attractant gradient is present, cell behavior changes; cells moving up the gradient now experience longer periods when the motor turns counterclockwise (lengthened runs) and shorter periods when it turns clockwise (shortened tumbles) ( FIGURE 4.10B ). The combined result is a net movement toward the attractant; that is, up the concentration gradient. Similar types of motile behavior are seen in photosynthetic organisms moving toward light (phototaxis) or other cells moving toward oxygen gas (aerotaxis). MICROFOCUS 4.3 investigates how flagella may have evolved. One additional type of flagellar organization is found in the spirochetes, a group of gramnegative, coiled bacterial species. The cells are motile by flagella that extend from one or both poles of the cell but fold back along the cell body
( FIGURE 4.11 ). Such endoflagella and the cell body are surrounded by an outer sheath membrane. Motility results from the torsion generated on the cell by the normal rotation of the flagella. The resulting motility is less regular and more jerky than with flagellar motility. Gliding Motility. Some bacterial cells can move about without flagella by gliding across a solid surface. The motility occurs along the long axis of bacillus- or filamentous-shaped cells and usually is slower than flagellar motility. The cyanobacteria and myxobacteria (see Chapter 3) are two examples of organisms with gliding motility. How the cells actually move is not completely understood. It appears that the force for gliding is generated by cytoplasmic proteins (motor proteins) that move along a helical track pushing the cell forward. CONCEPT AND REASONING CHECKS
4.6 Explain how flagella move cells during a “run.”
The Glycocalyx Is an Outer Layer External to the Cell Wall KEY CONCEPT
7.
A glycocalyx protects against desiccation, attaches cells to surfaces, and helps pathogens evade the immune system.
Many bacterial species secrete an adhering layer of polysaccharides, or polysaccharides and small
2/4/10 2:15 PM
4.4 External Cell Structures
Inserting capillary tube with an attractant (red dots) into a broth of motile bacterial cells produces a chemical gradient to which the bacterial cells are attracted (chemotaxis). Capillary tube
Inserting an empty capillary tube into a broth of motile bacterial cells does not cause chemotaxis. Capillary tube
Run
Attractant
No attractant Tumble
111
Run
Tumble (A)
(B)
Chemotaxis. Chemotaxis represents a behavioral response to chemicals. (A) Rotation of the flagellum counterclockwise causes the bacterial cell to “ run,” while rotation of the flagellum clockwise causes the bacterial cell to “tumble,” as shown. (B) During chemotaxis to an attractant, such as sugar, flagellum behavior leads to longer runs and fewer tumbles, which will result in biased movement toward the attractant. »» Predict the behavior of a bacterial cell if it sensed a repellant; that is a potential harmful or lethal chemical. FIGURE 4.10
Endoflagella Outer membrane Peptidoglycan layer Cell membrane
Endoflagella lie between the peptidoglycan and the outer membrane.
This spirochete has a single endoflagellum at each pole.
Endoflagella from the two poles overlap for much of the cell length. (A)
(B)
FIGURE 4.11 The Spirochete Endoflagella. (A) A light micrograph of Treponema pallidum shows the corkscrew-shaped spirochete cell. (Bar = 10 µm.) (B) Diagram showing the positioning of endoflagella in a spirochete. »» How are endoflagella different from true bacterial flagella?
proteins, called the glycocalyx (glyco = “sweet”; calyx = “coat”). The layer can be thick and covalently bound to the cell, in which case it is known as a capsule. A thinner, loosely attached layer is referred to as a slime layer. Colonies containing cells with a glycocalyx appear moist and glistening. The actual capsule can be seen by light microscopy when observing cells in a negative stain preparation or by transmission electron microscopy ( FIGURE 4.12 ). The glycocalyx serves as a buffer between the cell and the external environment. Because of its high water content, the glycocalyx can protect cells from desiccation. Another major role of the gly-
62582_CH04_097_130.pdf 111
cocalyx is to allow the cells to attach to surfaces. The glycocalyx of V. cholerae, for example, permits the cells to attach to the intestinal wall of the host. The glycocalyx of pathogens therefore represents another virulence factor. Other encapsulated pathogens, such as Streptococcus pneumoniae (a principal cause of bacterial pneumonia) and Bacillus anthracis, evade the immune system because they cannot be easily engulfed by white blood cells during phagocytosis. Scientists believe the repulsion between bacterial cell and phagocyte is due to strong negative charges on the capsule and phagocyte surface.
Encapsulated: A cell having a capsule.
Phagocytosis: A process whereby certain white blood cells (phagocytes) engulf foreign matter and often destroy microorganisms.
2/4/10 2:15 PM
112
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
4.3: Evolution
The Origin of the Bacterial Flagellum Flagella are an assembly of protein parts forming a rotary engine that, like an outboard motor, propel the cell forward through its moist environment. Recent work has shown how such a nanomachine may have evolved. Several bacterial species, including Yersinia pestis, the agent of bubonic plague, contain structures to inject toxins into an appropriate eukaryotic host cell. These bacterial cells have a hollow tube or needle to accomplish this process, just as the bacterial flagellum and filament are hollow (see diagram below). In addition, many of the flagellar proteins are similar to part of the injection proteins. In 2004, investigations discovered that Y. pestis cells actually contain all the genes needed for a flagellum—but the cells have lost the ability to use these genes. Y. pestis is nonmotile and it appears that the cells use a subset of the flagellar proteins to build the injection device. One scenario then is that an ancient cell evolved a structure that was the progenitor of the injection and flagellar systems. In fact, many of the proteins in the basal body of flagellar and injection systems are similar to proteins involved in proton (hydrogen ion; H+) transport. Therefore, a proton transport system may have evolved into the injection device and, through diversification events, evolved into the motility structure present on many bacterial cells today. The fascinating result of these investigations and proposals is it demonstrates that structures can evolve from other structures with a different function. It is not necessary that evolution “design” a structure from scratch but rather it can modify existing structures for other functions. Individuals have proposed that the complexity of structures like the bacterial flagellum are just too complex to arise gradually through a step-by-step process. However, the investigations being conducted illustrate that a step-by-step evolution of a specific structure is not required. Rather, there can be cooperation, where one structure is modified to have other functions. The bacterial flagellum almost certainly falls into that category. Outside of cell Filament Needle
L ring
Rotating hook Outer membrane Peptidoglycan
Rod
P ring
Rod
Basal body Cell membrane
MS ring
Cytosol
Protein export system
A bacterial injection device (left) compared to a bacterial flagellum (right). Both have a protein export system in the base of the basal body.
62582_CH04_097_130.pdf 112
2/4/10 2:15 PM
4.5 The Cell Envelope
113
Capsules
Cell
Capsule (A)
(B)
The Bacterial Glycocalyx. (A) Demonstration of the presence of a capsule in an Acinetobacter species by negative staining and observed by phase-contrast microscopy. (Bar = 10 µm.) (B) A false-color transmission electron micrograph of Escherichia coli. The cell is surrounded by a thick capsule (pink). (Bar = 0.5 µm.) »» How does the capsule provide protection for the bacterial cell? FIGURE 4.12
A slime layer usually contains a mass of tangled fibers of a polysaccharide called dextran (see Chapter 2). The fibers attach the bacterial cell to tissue surfaces. A case in point is Streptococcus mutans, an important cause of tooth decay previously discussed in MicroFocus 2.4. This species forms dental plaque, which represents a type
4.5
CONCEPT AND REASONING CHECKS
4.7 Under what circ*mstances might it be advantageous to a bacterial cell to have a capsule rather than a slime layer?
The Cell Envelope
The cell envelope is a complex structure that forms the two “wrappers”—the cell wall and the cell membrane—surrounding the cell cytoplasm. The cell wall is relatively porous to the movement of substances whereas the cell membrane regulates transport of nutrients and metabolic products. The Bacterial Cell Wall Is a Tough and Protective External Shell KEY CONCEPT
8.
of biofilm on the tooth surface. TEXTBOOK CASE 4 (p. 116) details a medical consequence of a biofilm.
Bacterial cell walls help maintain cell shape and protect the cell membrane from rupture.
The fact that most all bacterial and archaeal cells have a cell wall suggests the critical role this structure must play. By covering the entire cell surface, the cell wall acts as an exoskeleton to protect the
62582_CH04_097_130.pdf 113
cell from injury and damage. It helps, along with the cytoskeleton (see Section 4.6), to maintain the shape of the cell and reinforce the cell envelope against the high intracellular water (osmotic) pressure pushing against the cell membrane. As described in Chapter 3, most microbes live in an environment where there are more dissolved materials inside the cell than outside. This hypertonic condition in the cell means water diffuses inward, accounting for the increased osmotic pressure. Without a cell wall, the cell would rupture or undergo lysis ( FIGURE 4.13 ). It is similar to blowing so much air into a balloon that the air pressure bursts the balloon. The bacterial cell wall differs markedly from the walls of archaeal cells and cells of eukaryotic
Hypertonic: A solution with more dissolved material (solutes) than the surrounding solution.
2/4/10 2:15 PM
114
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
Autolytic enzymes: Enzymes that break bonds in the peptidoglycan, thereby causing lysis of the cell.
FIGURE 4.13 Cell Rupture (Lysis). A false-color electron micrograph showing the lysis of a Staphylococcus aureus cell. The addition of the antibiotic penicillin interferes with the construction of the peptidoglycan in new cells, and they quickly burst (top cell). (Bar = 0.25 µm.) »» Where is the concentration of dissolved substances (solutes) higher, inside the cell or outside? Explain how this leads to cell lysis.
Endotoxin: A poison that can activate inflammatory responses, leading to high fever, shock, and organ failure.
62582_CH04_097_130.pdf 114
microorganisms (algae and fungi) in containing peptidoglycan, which is a network of disaccharide chains (glycan strands) cross-linked by short peptides ( FIGURE 4.14A ). Each disaccharide in this very large molecule is composed of two monosaccharides, N-acetylglucosamine (NAG) and N-acetylmuramic acid (NAM) (see Chapter 2). The carbohydrate backbone can occur in multiple layers connected by side chains of four amino acids and peptide cross-bridges. There is more to a bacterial cell wall than just peptidoglycan, so several forms of cell wall architecture exist. Gram-Positive Walls. Most gram-positive bacterial cells have a very thick, rigid peptidoglycan cell wall ( FIGURE 4.14B ). The abundance and thickness (25 nm) of this material may be one reason why they retain the crystal violet in the Gram stain (see Chapter 3). The multiple layers of glycan strands are cross-linked to one another both in the same layer as well as between layers.
The gram-positive cell wall also contains a sugar-alcohol called teichoic acid. Wall teichoic acids, which are bound to the glycan chains, are essential for cell viability—if the genes for teichoic acid synthesis are deleted, cell death occurs. Still, the function of the teichoic acids remains unclear. They may help maintain a surface charge on the cell wall, control the activity of autolytic enzymes acting on the peptidoglycan, and/or maintain permeability of the cell wall layer. The bacterial genus Mycobacterium is phylogenetically related to the gram-positive bacteria. However, these rod-shaped cells have evolved another type of wall architecture to protect the cell membrane from rupture. The cell wall is composed of a waxy lipid called mycolic acid that is arranged in two layers that are covalently attached to the underlying peptidoglycan. Such a hydrophobic layer is impervious to the Gram stains, so stain identification of M. tuberculosis is carried out using the acid-fast stain procedure (see Chapter 3). Gram-Negative Walls. The cell wall of gram-negative bacterial cells is structurally quite different from that of the gram-positive wall ( FIGURE 4.14C ). The peptidoglycan layer is twodimensional; the glycan strands compose just a single layer or two. This is one reason why it loses the crystal violet dye during the Gram stain. Also, there is no teichoic acid present. The unique feature of the gram-negative cell wall is the presence of an outer membrane, which is separated by a gap, called the periplasm, from the cell membrane. This gel-like compartment contains digestive enzymes and transport proteins to speed entry of nutrients into the cell. The peptidoglycan layer is located in the periplasm and attached to lipoproteins in the cell membrane. The inner half of the outer membrane contains phospholipids similar to the cell membrane. However, the outer half is composed primarily of lipopolysaccharide (LPS), which consists of polysaccharide attached to a unique lipid molecule known as lipid A. The so-called O polysaccharide is used to identify variants of a species (e.g., strain O157:H7 of E. coli). On cell death, lipid A is released and represents an endotoxin that can be toxic if ingested (Chapter 19). The outer membrane also contains unique proteins called porins. These proteins form pores in the outer membrane through which small,
2/4/10 2:15 PM
4.5 The Cell Envelope
115
Amino acid side chain
-acetylglucosamine (NAG) -acetylmuramic acid (NAM)
Peptide cross-bridge
Carbohydrate "backbone" (A) (A) Structure of peptidoglycan
Gram-positive bacterial cell
Teichoic acid
Cell wall
Cell membrane Phospholipids
Protein Cytoplasm (B) (B) Gram-positive cell wall
Polysaccharide
Porins
Lipid A
Lipopolysaccharide (LPS)
Gram-negative bacterial cell Outer membrane Cell wall Peptidoglycan Periplasm Cell membrane Lipoprotein
Cytoplasm (C) (C) Gram-negative cell wall FIGURE 4.14 A Comparison of the Cell Walls of Gram-Positive and Gram-Negative Bacterial Cells. (A) The structure of peptidoglycan is shown as units of NAG and NAM joined laterally by amino acid cross-bridges and vertically by side chains of four amino acids. (B) The cell wall of a gram-positive bacterial cell is composed of peptidoglycan layers combined with teichoic acid molecules. (C) In the gram-negative cell wall, the peptidoglycan layer is much thinner, and there is no teichoic acid. Moreover, an outer membrane overlies the peptidoglycan layer such that both comprise the cell wall. Note the structure of the outer membrane in this figure. It contains porin proteins and the outer half is unique in containing lipopolysaccharide. »» Simply based on cell wall structure, assess the potential of gram-positive and gram-negative cells as pathogens.
62582_CH04_097_130.pdf 115
2/4/10 2:15 PM
116
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
Textbook
CASE
4
An Outbreak of Enterobacter cloacae Associated with a Biofilm Hemodialysis is a treatment for people with severe chronic kidney disease (kidney failure). The treatment filters the patient’s blood to remove wastes and excess water. Before a patient begins hemodialysis, an access site is created on the lower part of one arm. Similar to an intravenous (IV) site, a tiny tube runs from the arm to the dialysis machine. The patient’s blood is pumped through the dialysis machine, passed through a filter or artificial kidney called a dialyzer, and the cleaned blood returned to the patient’s body at the access site. The complete process can take 3 to 4 hours. 1
During September 1995, a patient at an ambulatory hemodialysis center in Montreal, Canada received treatment on a hemodialysis machine to help relieve the effects of kidney disease. The treatment was performed without incident.
2
The next day, a second patient received treatment on the same hemodialysis machine. His treatment also went normally, and he returned to his usual activities after the session was completed.
3
In the following days, both patients experienced bloodstream infections (BSIs). They had high fever, muscular aches and pains, sore throat, and impaired blood circulation. Because the symptoms were severe, the patients were hospitalized. Both patients had infections of Enterobacter cloacae, a gram-negative rod.
Textbook CASE months, an epidemiological investigation reviewed other hemodialysis patients 4 In the following at that center. In all, seven additional adult patients were identified who had used the same hemodialysis machine. They discovered all seven had similar BSIs. 5
Inspection of the hemodialysis machine used by these nine patients indicated the presence of biofilms containing Enterobacter cloacae, which was identical to those samples taken from the patients’ bloodstreams (see figure).
6
Further study indicated that the dialysis machine was contaminated with E. cloacae, specifically where fluid flows.
7
It was discovered that hospital personnel were disinfecting the machines correctly. The problem was that the valves in the drain line were malfunctioning, allowing a backflow of contaminated material.
8
Health officials began a hospital education program to ensure that further outbreaks of infection would be minimized.
Similar to the description in this textbook case, biofilms consisting of Staphylococcus cells can contaminate hemodialysis machines.
Questions: (Answers can be found in Appendix D.) A.
Suggest how the hemodialysis machine originally became contaminated.
B.
Why weren’t the other five cases of BSI correlated with the hemodialysis machine until the epidemiological investigation was begun?
C.
How could future outbreaks of infection be prevented?
For additional information see http://www.cdc.gov/mmwr/preview/mmwrhtml/00051244.htm.
62582_CH04_097_130.pdf 116
2/4/10 2:15 PM
4.5 The Cell Envelope
117
TABLE
4.2
A Comparison of Gram-Positive and Gram-Negative Cell Walls
Characteristic
Gram Positive
Gram Negative
Peptidoglycan Teichoic acids Outer membrane Lipopolysaccharides (LPS) Porin proteins Periplasm
Yes, thick layer Yes No No No No
Yes, thin layer No Yes Yes Yes Yes
hydrophilic molecules (sugars, amino acids, some ions) pass into the periplasm. Larger, hydrophobic molecules cannot pass, partly accounting for the resistance of gram-negative cells to many antimicrobial agents, dyes, disinfectants, and lysozyme. Before leaving the bacterial cell walls, a brief mention should be made of bacterial species that lack a cell wall. The mycoplasmas are a wall-less genus that is again phylogenetically related to the gram-positive bacteria. Taxonomists believe that the mycoplasmas once had a cell wall but lost it because of their parasitic relationship with their host. To help protect the cell membrane from rupture, the mycoplasmas are unusual in containing sterols in the cell membrane (see Chapter 2). TABLE 4.2 summarizes the major differences between the two major types of bacterial cell walls. CONCEPT AND REASONING CHECKS
4.8. Penicillin and lysozyme primarily affect peptidoglycan synthesis in gram-positive bacterial cells. Why are these agents less effective against gramnegative bacterial cells?
The Archaeal Cell Wall Also Provides Mechanical Strength KEY CONCEPT
9.
Archaeal cell walls have crystalline layers.
Archaeal species vary in the type of wall they possess. None have the peptidoglycan typical of the Bacteria. Some species have a pseudopeptidoglycan where the NAM is replaced by N-acetyltalosamine uronic acid (NAT). Other archaeal cells have walls made of polysaccharide, protein, or both.
62582_CH04_097_130.pdf 117
The most common cell wall among archaeal species is a surface layer called the S-layer. It consists of hexagonal patterns of protein or glycoprotein that self-assemble into a crystalline lattice 5 nm to 25 nm thick. Although the walls may be structurally different and the molecules form a different structural pattern, the function is the same as in bacterial species—to provide mechanical support and prevent osmotic lysis.
Hydrophilic: Pertaining to molecules or parts of molecules that are soluble in water. Hydrophobic: Pertaining to molecules or parts of molecules that are not soluble in water.
CONCEPT AND REASONING CHECKS
4.9 Distinguish between peptidoglycan and pseudopeptidoglycan cell walls.
The Cell Membrane Represents the Interface between the Cell Environment and the Cell Cytoplasm KEY CONCEPT
10. Molecules and ions cross the cell membrane by facilitated diffusion or active transport.
A cell (or plasma) membrane is a universal structure that separates external from internal (cytoplasmic) environments, preventing soluble materials from simply diffusing into and out of the cell. One exception is water, which due to its small size and overall lack of charge can diffuse slowly across the membrane. The bacterial cell membrane, which is about 7 nm thick, is 40% phospholipid and 60% protein. In illustrations, the cell membrane appears very rigid ( FIGURE 4.15 ). In reality, it is quite fluid, having the consistency of olive oil. This means the mosaic of phospholipids and proteins are not cemented in place, but rather they can move
2/4/10 2:15 PM
118
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
Outside of cell Hydrophilic Membrane protein
Hydrophobic Phospholipid Cytoplasm
Bilayer (7nm)
FIGURE 4.15 The Structure of the Bacterial Cell Membrane. The cell membrane of a bacterial cell consists of a phospholipid bilayer in which are embedded integral membrane proteins. Other proteins and ions may be associated with the integral proteins or the phospholipid heads. »» Why is the cell membrane referred to as a fluid mosaic structure?
High
Outside of cell
Solute Concentration Gradient
Solute molecule
Low
Cell membrane
Binding site
Transport protein
Cytoplasm
FIGURE 4.16 Facilitated Transport through a Membrane Protein. Many transport proteins facilitate the diffusion of nutrients across the lipid bilayer. The transport protein forms a hydrophilic channel through which a specific solute can diffuse. »» Why would a solute move through a membrane protein rather than simply across the lipid bilayer?
laterally in the membrane. This dynamic model of membrane structure therefore is called the fluid mosaic model. The phospholipid molecules, typical of most biological membranes, are arranged in two parallel layers (a bilayer) and represent the barrier function of the membrane. The phospholipids contain a charged phosphate head group attached to two hydrophobic fatty acid chains (see Chapter 2). The fatty acid “tails” are the portion that forms the permeability barrier. In contrast, the hydrophilic head groups are exposed to the aqueous external or cytoplasmic environments. Several antimicrobial substances act on the membrane bilayer. The antibiotic polymyxin
62582_CH04_097_130.pdf 118
pokes holes in the bilayer, while some detergents and alcohols dissolve the bilayer. Such action allows the cytoplasmic contents to leak out of bacterial cells, resulting in death through cell lysis. A diverse population of membrane proteins populates the phospholipid bilayer. These membrane proteins often have stretches of hydrophobic amino acids that interact with the hydrophobic fatty acid chains in the membrane. These proteins span the width of the bilayer and are referred to as “integral membrane proteins”. Other proteins, called “peripheral membrane proteins”, are associated with the polar heads of the bilayer. The membrane proteins carry out numerous important functions. Some represent enzymes needed for cell wall synthesis or for energy metabolism. As mentioned, bacterial and archaeal cells lack mitochondria and part of that organelle’s function is carried out by the cell membrane. Other membrane proteins help anchor the DNA to the membrane during replication or act as receptors of chemical information, sensing changes in environment conditions and triggering appropriate responses. Perhaps the largest group of integral membrane proteins is involved as transporters of charged solutes, such as amino acids, simple sugars, nitrogenous bases, and ions across the lipid bilayer. The transport systems are highly specific though, only transporting a single molecular species or a very similar class of molecules. Therefore, there are many different transport proteins to regulate the diverse molecular traffic that must flow into or out of a cell. The transport process can be passive or active. In facilitated diffusion, integral membrane proteins facilitate the movement of materials down their concentration gradient; that is, from an area of higher concentration to one of lower concentration ( FIGURE 4.16 ). By acting as a conduit for diffusion or as a transporter through the hydrophobic bilayer, hydrophilic solutes can enter or leave without the need for cellular energy. Unlike facilitated diffusion, active transport allows different concentrations of solutes to be established outside or inside of the cell against the concentration gradient. These membrane proteins act as “pumps” and, as such, demand an energy input from the cell. Cellular processes such as cell energy production and flagella rotation also depend on active transport.
2/4/10 2:15 PM
4.5 The Cell Envelope
CONCEPT AND REASONING CHECKS
4.10 Justify the necessity for phospholipids and proteins in the cell membrane.
The Archaeal Cell Membrane Differs from Bacterial and Eukaryal Membranes KEY CONCEPT
11. Archaeal membranes are structurally unique.
Besides the differences in gene sequences for ribosomal RNA in the domain Archaea, another major difference used to separate the archaeal organisms into their own domain is the chemical nature of the cell membrane. The manner in which the hydrophobic lipid tails are attached to the glycerol is different in
119
the Archaea. The tails are bound to the glycerol by “ether linkages” rather than the “ester linkages” found in the domains Bacteria and Eukarya ( FIGURE 4.17A ). Also, typical fatty acid tails are absent from the membranes; instead, repeating five-carbon units are linked end-to-end to form lipid tails longer than the fatty acid tails. The result is a lipid monolayer rather than a bilayer ( FIGURE 4.17B ). This provides an advantage to the hyperthermophiles by preventing a peeling in two of the membrane, which would occur with a typical phospholipid bilayer structure. CONCEPT AND REASONING CHECKS
4.11 What is unique about archaeal membrane structure?
Head group
Bacterial/Eukaryal O membranes
Archaeal membranes
O
CH2
H2C
CH2
Ester O C O C linkage
O Ether linkage C
O
R'
R'
H2C
CH
O
(A)
Glycerol
O
R
Tails
R
O O
O
O
O O
O
O
O
O
CH
C
O
O
Bacterial lipid bilayer
Archaeal lipid monolayer
O O
O
O
O O
O O
Bilayers
O
O O
O
(B)
Monolayers
FIGURE 4.17 Structure of Cell Membranes. (A) Bacterial and eukaryal cell membranes involve an ester linkage joining the glycerol to the fatty acid tails (R) while archaeal membranes have an ether linkage to the isoprenoid tails (R⬘). (B) Bacterial and eukaryal membranes form a bilayer while archaeal membranes are a monolayer. »» What identifies an ester linkage from an ether linkage?
62582_CH04_097_130.pdf 119
2/4/10 2:15 PM
120
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
4.6 Haploid: Having a single set of genetic information.
The Cell Cytoplasm and Internal Structures
The cell membrane encloses the cytoplasm, which is the compartment within which most growth and metabolism occurs. The cytoplasm consists of the cytosol, a semifluid mass of proteins, amino acids, sugars, nucleotides, salts, vitamins, and ions—all dissolved in water (see Chapter 2)—and several bacterial structures or subcompartments, each with a specific function. The Nucleoid Represents a Subcompartment Containing the Chromosome KEY CONCEPT
12. The nucleoid contains the cell’s essential genetic information.
The chromosome region in bacterial and archaeal cells appears as a diffuse mass termed the nucleoid ( FIGURE 4.18 ). The nucleoid does not contain a covering or membrane; rather, it represents a central subcompartment in the cytoplasm where the DNA aggregates and ribosomes are absent. Usually there is a single chromosome per cell and, with few exceptions, exists as a closed loop of DNA and protein. The DNA contains the essential hereditary information for cell growth, metabolism, and
Vectors: Genetic elements capable of incorporating and transferring genetic information.
FIGURE 4.18 The Bacterial Nucleoid. In this falsecolor transmission electron micrograph of Escherichia coli, nucleoids (orange) occupy a large area in a bacterial cell. Both longitudinal (center cells) and cross sections (cell upper right) of E. coli are visable. (Bar = 0.5 µm.) »» How does a nucleoid differ from the eukaryotic cell nucleus described in the previous chapter?
62582_CH04_097_130.pdf 120
reproduction. Because most cells only have one chromosome, the cells are genetically haploid. Unlike eukaryotic microorganisms and other eukaryotes, the nucleoid and chromosome do not undergo mitosis and having but the one set of genetic information cannot undergo meiosis. The complete set of genes in an organism, called the genome, varies by species. For example, the genome of E. coli, a typical bacterial species in the mid-size range, contains about 4,300 genes. In all cases, these genes determine what proteins and enzymes the cell can make; that is, what metabolic reactions and activities can be carried out. For E. coli, this equates to some 2,000 different proteins. Extensive coverage of bacterial DNA is presented in Chapter 8. CONCEPT AND REASONING CHECKS
4.12 Why do we say that the bacterial chromosome contains the “essential hereditary information”?
Plasmids Are Found in Many Bacterial and Archaeal Cells KEY CONCEPT
13. Plasmids contain nonessential genetic information.
Besides a nucleoid, many bacterial and archaeal cells also contain smaller molecules of DNA called plasmids. About a tenth the size of the chromosome, these stable, extrachromosomal DNA molecules exist as closed loops containing 5 to 100 genes. There can be one or more plasmids in a cell and these may contain similar or different genes. Plasmids replicate independently of the chromosome and can be transferred between cells during recombination. They also represent important vectors in industrial technologies that use genetic engineering. Both topics are covered in Chapter 9. Although plasmids may not be essential for cellular growth, they provide a level of genetic flexibility. For example, some plasmids possess genes for disease-causing toxins and many carry genes for chemical or antibiotic resistance. For this latter reason, these genetic elements often are called R plasmids (R for resistance). CONCEPT AND REASONING CHECKS
4.13 What properties distinguish the bacterial chromosome from a plasmid?
2/4/10 2:15 PM
4.6 The Cell Cytoplasm and Internal Structures
Other Subcompartments Exist in the Cell Cytoplasm KEY CONCEPT
14. Ribosomes, microcompartments, and inclusions carry out specific intracellular functions.
For a long time the cytoplasm was looked at as a bag enclosing the genetic machinery and biochemical reactions. As more studies were carried out with the electron microscope and with biochemical techniques, it became evident that the cytoplasm contained “more than meets the eye.” Ribosomes. One of the universal cell structures mentioned in Chapter 3 was the ribosome. There are hundreds of thousands of these nearly spherical particles in the cell cytoplasm, which gives it a granular appearance when viewed with the electron microscope ( FIGURE 4.19A ). Their relative size is measured by how fast they settle when spun in a centrifuge. Measured in Svedberg units (S), bacterial and archaeal ribosomes represent 70S particles. The ribosomes are built from RNA and protein and are composed of a small subunit (30S) and a large subunit (50S) ( FIGURE 4.19B ). For proteins to be synthesized, the two subunits come together to form a 70S functional ribosome (Chapter 8). Some antibiotics, such as streptomycin and tetracycline, prevent bacterial and archaeal ribosomes from carrying out protein synthesis.
Microcompartments. Recently, some bacterial species have been discovered that contain microcompartments. The microcompartments appear to be unique to the Bacteria and consist of a polyprotein shell 100 to 200 nm in diameter (see Chapter 3). The shell surrounds various types of enzymes and, in the cyanobacteria, microcompartments called “carboxysomes” function to enhance carbon dioxide fixation. In some non-photosynthetic species, microcompartments limit diffusion of volatile or toxic metabolic products. Inclusions. Cytoplasmic structures, called inclusions, can be found in the cytoplasm. Many of these bodies store nutrients or the monomers for cellular structures. For example, some inclusions consist of aggregates or granules of polysaccharides (glycogen), globules of elemental sulfur, or lipid. Other inclusion bodies can serve as important identification characters for bacterial pathogens. One example is the diphtheria bacilli that contain metachromatic granules, or volutin, which are deposits of polyphosphate (long chains of inorganic phosphate) along with calcium and other ions. These granules stain with dyes such as methylene blue. Some aquatic and marine forms float on the water surface, which is made possible by the presence of gas vesicles, cytoplasmic compartments built from a water-tight protein shell. These vesicles decrease the density of the cell, which generates and regulates their buoyancy.
121
Centrifuge: An instrument that spins particles suspended in liquid at high speed.
Subunits 70S Ribosome
50S The 50S subunit contains a 16S rRNA and 21 proteins.
+
(A) (A)
The 70S bacterial ribosome consists of a 50S and 30S subunit. (B) (B)
30S The 30S subunit contains a 23S rRNA, 5S rRNA, and 31 proteins.
FIGURE 4.19 The Bacterial Ribosome. (A) A false-color electron microscope image of Neisseria gonorrhoeae, showing the nucleoid (yellow) and ribosomes (blue). (Bar = 1µm.) (B) The functional 70S ribosome is assembled from a small (30S) and large (50S) subunit. »» How many rRNA molecules and proteins construct a 70S ribosome?
62582_CH04_097_130.pdf 121
2/4/10 2:15 PM
122
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
The magnetosome, another type of inclusion or subcompartment, is described in MICROFOCUS 4.4. These bacterial inclusions are invagin*tions of the cell membrane, which are coordinated and positioned by cytoskeletal filaments similar to eukaryotic microfilaments. CONCEPT AND REASONING CHECKS
4.14 Provide the roles for the subcompartments found in bacterial cells.
Many Bacterial/Archaeal Cells Have a “Cytoskeleton” KEY CONCEPT
15. Cytoskeletal proteins regulate cell division and help determine cell shape.
Until recently, the dogma was that bacterial and archaeal cells lacked a cytoskeleton, which is a common feature in eukaryotic cells (see Chapter 3). However, it now appears cytoskeletal
4.4: Environmental Microbiology
A “Not So Fatal” Attraction To get from place to place, humans often require the assistance of maps, GPS systems, or gas station attendants. In the microbial world, life is generally more simple, and traveling is no exception. In the early 1980s, Richard P. Blakemore and his colleagues at the University of New Hampshire observed mud-dwelling bacterial cells gathering at the north end of water droplets. On further study, they discovered each cell had a chain of aligned magnetic particles acting like a compass directing the organism’s movements (magnetotaxis). Additional interdisciplinary investigations by microbiologists and physicists have shown the magnetotactic bacteria contain a linear array of 15–20 membrane-bound vesicles along the cell’s long axis (see figure). Each vesicle, called a magnetosome, is an invagin*tion of the cell membrane and contains the protein machinery to nucleate and grow a crystal of magnetite (Fe3O4) or greigite (Fe3S4). The chain of magnetosomes is organized by filaments that are similar to eukaryotic actin. By running parallel to the magnetosome chain, the filaments organize the vesicles into a chain. As each vesicle accumulates the magnetite or greigite crystal to form a magnetosome, magnetostatic interactions between vesicles stabilizes the linear aggregation. To date, all magnetotactic bacterial cells are motile, gram-negative cells common in aquatic and marine habitats, including sediments where oxygen is absent. This last observation is particularly noteworthy because it explains why these organisms have magnetosomes. It originally was thought that magnetotaxis was used to guide cells to those regions of the habitat with no oxygen; in other words, they travel downward toward the sediment. More recent studies have shown that some magnetotactic bacteria actually prefer low concentrations of oxygen. So the opinion now is that both magnetotaxis and aerotaxis work together to allow cells to “find” the optimal point within an oxygen gradient. This “not so fatal” attraction permits the bacteria to Bacterial magnetosomes (yellow) are seen in this false-color reach a sort of biological nirvana and settle transmission electron micrograph of a magnetotactic marine spirillum. (Bar = 1 µm.) in for a life of environmental bliss.
62582_CH04_097_130.pdf 122
2/4/10 2:15 PM
4.6 The Cell Cytoplasm and Internal Structures
proteins hom*ologous to those in the eukaryotic cytoskeleton are present. The first protein discovered was a hom*olog of the eukaryotic protein tubulin, which forms filaments that assemble into microtubules. The hom*olog forms filaments similar to those in microtubules but the filaments do not assemble into microtubules. These tubulin-like proteins have been found in all bacterial and archaeal cells examined and appear to function in the regulation of cell division. During this process, the protein localizes around the neck of the dividing cell where it recruits other proteins needed for the deposition of a new cell wall between the dividing cells (MICROFOCUS 4.5).
Protein hom*ologs remarkably similar in threedimensional structure to eukaryotic microfilaments assemble into filaments that help determine cell shape in E. coli and Bacillus subtilis. These hom*ologs have been found in most non-spherical cells where they form a helical network beneath the cell membrane to guide the proteins involved in cell wall formation ( FIGURE 4.20A ). The hom*ologs also are involved with chromosome segregation during cell division and magnetosome formation. Intermediate filaments (IF), another component of the eukaryotic cytoskeleton in some metazoans, have a hom*olog as well. The protein, called crescentin, helps determine the characteristic crescent shape of Caulobacter crescentus cells.
123
hom*olog: An entity with similar attributes due to shared ancestry.
Metazoans: Members of the vertebrates, nematodes, and mollusks.
4.5: Public Health
The Wall-less Cytoskeleton Sometimes the lack of something can speak loudly. Take for example the mycoplasmas such as Mycoplasma pneumoniae that causes primary atypical pneumonia (walking pneumonia). This, as well as other Mycoplasma species, lack a cell wall. How then can they maintain a defined cell shape (see figure)? Transmission electron microscopy has revealed that mycoplasmal cells contain a very complex cytoskeleton and further investigations indicate the cytoskeletal proteins are very different from the typical cytoskeletal hom*ologs found in other groups of the Firmicutes. For example, Spiroplasma citri, which causes infections in other animals, has a fibril protein cytoskeleton that is laid down as a helical ribbon. This fibril protein has not been found in any other organisms. Because the cells are spiral shaped, the ribbon probably is laid down in such a way to determine cell shape, suggesting that shape does not have to be totally dependent on a cell wall. In Mycoplasma genitalium, which is closely related to M. pneumoniae and causes human urethral infections, a eukaryotic-like tubulin hom*olog has been identified, but none of the other proteins have been identified that it recruits at the division neck for cell division. Surprising? Not really. Important? Immensely! Because mycoplasmas do not have a cell wall, why would they require those proteins that lay down a peptidoglycan cross wall between cells? So the lack of something (wall-forming proteins) tells us what those proteins must do in their gram-positive False-color scanning electron micrograph of Mycoplasma pneumoniae cells. (Bar = 2.5 µm.) relatives that do have walls.
62582_CH04_097_130.pdf 123
2/4/10 2:15 PM
124
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
(A) FIGURE 4.20 A Bacterial Cytoskeleton. Bacterial cells have proteins similar to those that form the eukaryotic cytoskeleton. (A) Microfilament-like proteins form helical filaments that curve around the edges of these cells of Bacillus subtilis. (Bar = 1.5 µm.) (B) Three-dimensional model of a helical Caulobacter crescentus cell (green) with a helical cytoskeletal filament of crescentin (pink). »» What would be the shape of these cells without the cytoskeletal proteins?
(B)
In older cells that become filamentous, crescentin maintains the helical shape of the cells by aligning with the inner cell curvature beneath the cytoplasmic membrane ( FIGURE 4.20B ). Even though the evolutionary relationships are quite distant between bacterial/archaeal and eukaryotic cytoskeletal proteins based on pro-
4.7
CONCEPT AND REASONING CHECKS
4.15 Evaluate the relationship between the eukaryotic cytoskeleton and the cytoskeletal protein hom*ologs in bacterial and archaeal cells.
The Bacteria/Eukaryote Paradigm—Revisited
TABLE 4.3 summarizes the structural features of bacterial and archaeal cells. One of the takehome lessons from the table, and discussions of cell structure and function explored in this chapter (and the initial discussion of the bacteria/eukaryote paradigm in Chapter 3), is the ability of these organisms to carry out the “complex” metabolic and biochemical processes typically associated with eukaryotic cells—usually without the need for elaborate membrane-enclosed subcompartments.
What Is a Prokaryote? KEY CONCEPT
16. Cellular processes in bacterial cells can be similar to those in eukaryotic cells.
62582_CH04_097_130.pdf 124
tein sequence data, the similarity of their threedimensional structure and function is strong evidence supporting hom*ologous cytoskeletons.
Earlier in this chapter, the intricate subcellular compartmentation was discussed for several cell structures. What about other major cellular processes such as making proteins? This requires two processes, that of transcription and translation (Chapter 8). In eukaryotic cells, these processes are spatially separated into the cell nucleus (transcription) and the cytoplasm (translation). In bacterial and archaeal cells, there also can be spatial separation between transcription and translation FIGURE 4.21 . The RNA polymerase molecules needed for transcription are localized to a region separate from the ribosomes and other proteins that perform translation. So, even without a nuclear membrane, these cells can separate the process involved in
2/4/10 2:15 PM
4.7 The Bacteria/Eukaryote Paradigm—Revisited
125
TABLE
4.3
A Summary of the Structural Features of Bacterial and Archaeal Cells
Structure
Chemical Composition
Function
Comment
External Structures Pili
Protein
Flagella
Protein
Attachment to surfaces Genetic transfer Motility
Glycocalyx
Polysaccharides and small proteins
Found primarily in gram-negative bacteria Present in many rods and spirilla; few cocci; vary in number and placement Capsule and slime layer Contributes to disease development Found in plaque bacteria and biofilms
Cell Envelope Cell wall
Bacterial
Archaeal
Buffer to environment Attachment to surfaces
Cell protection Shape determination Cell lysis prevention Gram positives: thick peptidoglycan and teichoic acid Gram negatives: little peptidoglycan and an outer membrane Pseudopeptidoglycan Protein
Site of activity of penicillin and lysozyme Gram-negative bacteria release endotoxins S-layer
Cell membrane Bacterial Archaeal
Protein and phospholipid
Cell boundary Transport into/out of cell Site of enzymatic reactions
Lipid bilayer Lipid monolayer
Internal Structures Nucleoid
DNA
Site of essential genes
Plasmids Ribosomes
DNA RNA and protein
Site of nonessential genes Protein synthesis
Microcompartments
Various metabolic enzymes
Inclusions
Glycogen, sulfur, lipid
Carbon dioxide fixation Retention of volatile or toxic metabolites Nutrient storage
Exists as single, closed loop chromosome R plasmids Inhibited by certain antibiotics Enzymes are enclosed in a protein shell
Metachromatic granules
Polyphosphate
Gas vesicles Magnetosome habitat Cytoskeleton
Protein shells Magnetite/greigite
62582_CH04_097_130.pdf 125
Proteins
Storage of polyphosphate and calcium ions Buoyancy Cell orientation Cell division, chromosomal segregation, cell shape
Used as nutrients during starvation periods Found in diphtheria bacilli Helps cells float Helps locate preferred Functionally similar to eukaryotic cytoskeletal proteins
2/4/10 2:15 PM
126
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
INQUIRY 4
The Prokaryote/Eukaryote Model “It is now clear that among organisms there are two different organizational patterns of cells, which Chatton . . . called, with singular prescience, the eukaryotic and prokaryotic type. The distinctive property of bacteria and blue-green algae is the prokaryotic nature of their cells. It is on this basis that they can be clearly segregated from all other protists (namely, other algae, protozoa and fungi), which have eukaryotic cells.” Stanier and van Niel (1962) —The concept of a bacterium. The idea of a tree of life extends back centuries and originates not with scientific thinking, but rather with folklore and culture, and often focused on immortality or fertility (see figure). The development of the three-domain tree of life, on the other hand, represents the evolutionary relationships between species. Its development has made a profound change in biology. Instead of
Glass mosaic of tree of life on a wall of the 16th century Sim Wat Xiang Thong Luang Prabang UNESCO World Heritage Site, Laos.
FIGURE 4.21 Spatial Separation of Transcription and Translation. In these cells of Bacillus subtilis, fluorescence microscopy was used to identify RNA polymerase (transcription) using a red fluorescent protein and ribosomes (translation) using a green fluorescent protein. Separate subcompartments are evident. (Bar = 3 µm.) »» What does the spatial separation indicate concerning compartmentation?
62582_CH04_097_130.pdf 126
two kinds of organisms—prokaryotes and eukaryotes—there are three: Bacteria, Archaea, and Eukarya. In 2006, Norm Pace, a molecular biologist turned evolutionist at the University of Colorado, Boulder, suggested that the massive data bank of gene sequences identified since 1995 shows just how different archaeal organisms are from bacterial organisms and, in some ways, the archaeal ones are more similar to eukaryotic organisms. Therefore, Pace says, “we need to reassess our understanding of the course of evolution at the most fundamental level.” Among items needing reassessment is the prokaryotic/eukaryotic paradigm—the tradition (folklore) if you will—that if an organism is not a eukaryote, it must be a prokaryote. The quote at the top of the page refers to Edouard Chatton who coined the terms “prokaryotic” and “eukaryotic.” Interestingly, neither he, nor Stanier and van Niel, ever really made mention as to
making cellular proteins, in a manner similar to eukaryotic cells. Traditionally, a prokaryote was an organism without a cell nucleus; that is, without a membrane surrounding the DNA or chromosome. But is that a fair way to describe all bacterial and archaeal organisms? In this chapter, you have learned that there are many basic differences between bacterial and archaeal cells, yet do we lump them together just because they both lack a cell nucleus? Some scientists say no—the terms “prokaryote” and “prokaryotic” are not appropriate for these two domains of life. So, to finish this chapter, take a look at MICROINQUIRY 4, which discusses the prokaryotic/ eukaryotic model for living organisms. CONCEPT AND REASONING CHECKS
4.16 Make a list of the various subcompartments in bacterial cells.
2/5/10 1:02 PM
Summary of Key Concepts
what a prokaryotic cell is. Yet if you look in any introductory biology textbook, prokaryote is defined as a group of organisms that lack a cell nucleus. According to Pace, “the prokaryote/eukaryote model for biological diversity and evolution is invalid.” How can all organisms without a cell nucleus be called “prokaryotic,” especially because the eukaryotic cell nucleus appears to be descended from as ancient a line of cells as the Archaea? Yes, the concept of a nuclear membrane (or not) is important, but no more important than other cellular properties. And the problem is that the word “prokaryote” is so engrained in the culture of biology and in the scientific mind of biologists—and students—that inappropriate inferences about organisms are made using this term. Pace does not buy the argument that the term “prokaryote” can be used to identify
organisms that are not eukaryotes because the Bacteria are very different from the Archaea and, therefore, should not be put under the umbrella of “prokaryote.” Pace believes saying that prokaryotes lack a cell nucleus is a scientifically invalid description; although open to debate, he says no one can define what a prokaryote is—only what it is not (e.g., no nucleus, no mitochondria, no chloroplasts, no endomembrane system, etc.). Therefore, lumping the Bacteria and Archaea conceptually dismisses the fundamental and important differences between these two kinds of organisms and reinforces an incorrect understanding of biological organization and evolution. Pace believes it is time to delete the term prokaryote as a term for bacterial and archaeal organisms. Because it has long been used by all biology texts, including
127
this one (although in many cases “bacteria” and “archaea” have replaced the term prokaryote), Pace says he realizes “it is hard to stop using the word, prokaryote.” Discussion Point There is no doubt that bacterial and archaeal organisms are very different entities. So, if “prokaryote” is to be deleted from the biological vocabulary, what can we call the Bacteria and Archaea? Can you think of some positive characters that would define both bacterial and archaeal cells? If so, then how about inventing a common noun and adjective for both? Or do we simply speak of the bacteria, archaea, and eukaryotes separately?
SUMMARY OF KEY CONCEPTS 4.1 Diversity among the Bacteria and Archaea 1. The phylogenetic tree of life contains many bacterial phyla and groups, including the Proteobacteria, Gram-positive bacteria, Cyanobacteria, Chlamydiae, and Spirochaetes. 2. Many organisms in the domain Archaea live in extreme environments. The Euryarchaeota (methanogens, extreme halophiles, and the thermoacidophiles) and the Crenarchaeota are the two phyla. 4.2 Cell Shapes and Arrangements 3. Bacilli have a cylindrical shape and can remain as single cells or be arranged into diplobacilli or chains (streptobacilli). Cocci are spherical and form a variety of arrangements, including the diplococcus, streptococcus, and staphylococcus. The spiral-shaped bacteria can be curved rods (vibrios) or spirals (spirochetes and spirilla). Spirals generally appear as single cells. 4.3 An Overview to Bacterial and Archaeal Cell Structure 4. Cell organization is centered on three specific processes: sensing and responding to environmental changes, compartmentalizing metabolism, and growing and reproducing.
62582_CH04_097_130.pdf 127
4.4 External Cell Structures 5. Pili are short hair-like appendages found on many gramnegative bacteria to facilitate attachment to a surface. Conjugation pili are used for genetic transfer of DNA. 6. One or more flagella, found on many rods and spirals, provide for cell motility. Each flagellum consists of a basal body attached to the flagellar filament. In nature, flagella propel bacterial cells toward nutrient sources (chemotaxis). Spirochetes have endoflagella, while other bacterial species undergo gliding motility. 7. The glycocalyx is a sticky layer of polysaccharides that protects the cell against desiccation, attaches it to surfaces, and helps evade immune cell attack. The glycocalyx can be thick and tightly bound to the cell (capsule) or thinner and loosely bound (slime layer). 4.5 The Cell Envelope 8. The cell wall provides structure and protects against cell lysis. Gram-positive bacteria have a thick wall of peptidoglycan strengthened with teichoic acids. Gram-negative cells have a single layer of peptidoglycan and an outer membrane containing lipopolysaccharide and porin proteins.
2/4/10 2:16 PM
128
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
9. Archaeal cell walls lack peptidoglycan but may have either a pseudopeptidoglycan or S-layer. 10. The cell membrane represents a permeability barrier and the site of transfer for nutrients and metabolites into and out of the cell. The cell membrane reflects the fluid mosaic model for membrane structure in that the lipids are fluid and the proteins are a mosaic that can move laterally in the bilayer. 11. The archaeal cell membrane links lipids through an ether linkage and the lipid tails are bonded together into a single monolayer. 4.6 The Cell Cytoplasm and Internal Structures 12. The DNA (bacterial chromosome), located in the nucleoid, is the essential genetic information and represents the organism’s genome.
13. Bacterial and archaeal cells may contain one or more plasmids, circular pieces of nonessential DNA that replicate independently of the chromosome. 14. Ribosomes carry out protein synthesis, microcompartments carry out species-specific processes, while inclusions store nutrients or structural building blocks. 15. The cytoskeleton, containing protein hom*ologs to the cytoskeletal proteins in eukaryotic cells, helps determine cell shape, regulates cell division, and controls chromosomal segregation during cell division. 4.7 The Bacteria/Eukaryote Paradigm—Revisited 16. Cell biology investigations are showing that compartmentation in bacterial cells can occur; it simply does not require the diverse membranous organelles typical of eukaryotic cells.
LEARNING OBJECTIVES After understanding the textbook reading, you should be capable of writing a paragraph that includes the appropriate terms and pertinent information to answer the objective. 1. Identify the major bacterial phyla described in this chapter and provide characteristics for each group. 2. Explain why many archaeal organisms are considered extremophiles. 3. Compare the various shapes and arrangements of bacterial and archaeal cells. 4. Summarize how the processes of sensing and responding to the environment, compartmentation of metabolism, and growth and metabolism are linked to cell structure. 5. Assess the role of pili to bacterial colonization and infection. 6. Describe the structure of bacterial flagella and discuss how they function in chemotaxis. 7. Differentiate between a capsule and slime layer. Identify their roles in cell survival.
8. Compare and contrast the structure of a gram-positive cell wall with a gram-negative cell wall. 9. Summarize the differences between bacterial and archaeal cell walls. 10. Justify the need for a cell membrane surrounding all bacterial and archaeal cells. 11. Explain how the structure of archaeal cell membranes differs from bacterial cell membranes. 12. Describe the structure of the nucleoid. 13. Judge the usefulness of plasmids to cell metabolism and organismal survival. 14. List the typical inclusions found in the bacterial cell cytoplasm and identify their contents or roles. 15. Describe three roles that the bacterial cytoskeleton plays. 16. Justify the statement, “Bacterial cells are as highly organized subcellularly as are eukaryotic cells.”
STEP A: SELF-TEST Each of the following questions is designed to assess your ability to remember or recall factual or conceptual knowledge related to this chapter. Read each question carefully, then select the one answer that best fits the question or statement. Answers to even-numbered questions can be found in Appendix C. 1. Which one of the following is NOT a genus within the gram-positive bacteria? A. Staphylococcus B. Methanogens C. Mycoplasma D. Bacillus and Clostridium 2. The domain Archaea includes all the following groups except the A. mycoplasmas. B. extreme halophiles. C. Crenarchaeota. D. Euryarchaeota.
62582_CH04_097_130.pdf 128
3. Spherical bacterial cells in chains would be a referred to as a _____ arrangement. A. vibrio B. streptococcus C. staphylococcus D. tetrad 4. Intracellular organization in bacterial and archaeal species is centered around A. compartmentation of metabolism. B. growth and reproduction. C. sensing and responding to environment. D. All the above (A–C) are correct.
2/4/10 2:16 PM
Step B: Review
5. Which one of the following statements does NOT apply to pili? A. Pili are made of protein. B. Pili allow for attachment to surfaces. C. Pili facilitate nutrient transport. D. Pili contain adhesins. 6. Flagella are A. made of carbohydrate and lipid. B. found on all bacterial cells. C. shorter than pili. D. important for chemotaxis. 7. Capsules are similar to pili because both A. contain DNA. B. are made of protein. C. contain dextran fibers. D. permit attachment to surfaces. 8. Gram-negative bacteria would stain _____ with the Gram stain and have _____ in the wall. A. orange-red; teichoic acid B. orange-red; lipopolysaccharide C. purple; peptidoglycan D. purple; teichoic acid 9. The cell membrane of archaeal cells contains A. a monolayer. B. sterols. C. ester linkages. D. All the above (A–C) are correct. 10. The movement of glucose into a cell occurs by A. facilitated diffusion. B. active transport. C. simple diffusion. D. phospholipid exchange.
129
11. When comparing bacterial and archaeal cell membranes, only bacterial cell membranes A. have three layers of phospholipids. B. have a phospholipid bilayer. C. are fluid. D. have ether linkages. 12. Which one of the following statements about the nucleoid is NOT true? A. It contains a DNA chromosome. B. It represents a nonmembranous subcompartment. C. It represents an area devoid of ribosomes. D. It contains nonessential genetic information. 13. Plasmids A. replicate with the bacterial chromosome. B. contain essential growth information. C. may contain antibiotic resistance genes. D. are as large as the bacterial chromosome. 14. Which one of the following is NOT a structure or subcompartment found in bacterial cells? A. Microcompartments B. Volutin C. Ribosomes D. Mitochondria 15. The bacterial cytoskeleton A. transports vesicles. B. helps determine cell shape. C. is organized identical to its eukaryotic counterpart. D. centers the nucleoid. 16. The bacterial cell is capable of A. spatial separation of metabolic processes. B. carrying out complex metabolic processes. C. subcompartmentalizing biochemical processes. D. All the above (A–C) are correct.
STEP B: REVIEW Answers to even-numbered questions or statements can be found in Appendix C. 17. Construct a concept map for the domain Bacteria using the following terms. Actinobacteria hyperthermophiles Bacillus Mycoplasma blooms Proteobacteria Chlamydiae rickettsiae Cyanobacteria Spirochaetes Escherichia Staphylococcus Firmicutes Streptomyces gram-negative species Treponema gram-positive species
62582_CH04_097_130.pdf 129
18. Construct a concept map for the Cell Envelope using the following terms. active transport membrane proteins cell membrane NAG cell wall NAM endotoxin outer membrane facilitated transport peptidoglycan fluid-mosaic model periplasm gram-negative wall phospholipids gram-positive wall polysaccharide lipid A porin proteins lipopolysaccharide (LPS) teichoic acid
2/4/10 2:16 PM
130
CHAPTER 4
Cell Structure and Function in the Bacteria and Archaea
Identify and label the structure on the accompanying bacterial cell from each of the following descriptions. Some separate descriptions may apply to the same structure.
Descriptions 19. An essential structure for chemotaxis, aerotaxis, or phototaxis. 20. Contains nonessential genetic information that provides genetic variability. 21. The structure that synthesizes proteins. 22. The protein structures used for attachment to surfaces. 23. Contains essential genes for metabolism and growth. 24. Prevents cell desiccation. 25. A 70S particle. 26. Contains peptidoglycan. 27. Regulates the passage of substances into and out of the cell. 28. Extrachromosomal loops of DNA. 29. Represents a capsule or slime layer. 30. The semifluid mass of proteins, amino acids, sugars, salts, and ions dissolved in water.
STEP C: APPLICATIONS Answers to even-numbered questions can be found in Appendix C. 31. A bacterium has been isolated from a patient and identified as a grampositive rod. Knowing that it is a human pathogen, what structures would it most likely have? Explain your reasons for each choice. 32. Another patient has a blood infection caused by a gram-negative bacterium. Why might it be dangerous to prescribe an antibiotic to treat the infection?
33. In the research lab, the gene for the cytoskeletal protein similar to eukaryotic tubulin is transferred into the DNA chromosome of a coccusshaped bacterium. When this cell undergoes cell division, predict what shape the daughter cells will exhibit. Explain your answer.
STEP D: QUESTIONS FOR THOUGHT AND DISCUSSION Answers to even-numbered questions can be found in Appendix C. 34. In reading a story about a bacterium that causes a human disease, the word “bacillus” is used. How would you know if the article is referring to a bacterial shape or a bacterial genus? 35. Suppose this chapter on the structure of bacterial and archaeal cells had been written in 1940, before the electron microscope became available. Which parts of the chapter would probably be missing?
36. Why has it taken so long for microbiologists to discover microcompartments and a cytoskeleton in bacterial and archaeal cells? 37. Apply the current understanding of the bacteria/eukaryote paradigm to the following statement: “Studying the diversity of life only accentuates life’s unity.”
HTTP://MICROBIOLOGY.JBPUB.COM/9E The site features eLearning, an online review area that provides quizzes and other tools to help you study for your class. You can also follow useful links for in-depth information, read more MicroFocus stories, or just find out the latest microbiology news.
62582_CH04_097_130.pdf 130
2/4/10 2:16 PM
5 Chapter Preview and Key Concepts
Microbial Growth and Nutrition But who shall dwell in these worlds if they be inhabited? . . . Are we or they Lords of the World? . . . —Johannes Kepler (quoted in The Anatomy of Melancholy)
Books have been written about it; movies have been made; even a radio play in 1938 about it frightened thousands of Americans. What is it? Martian life. In 1877 the Italian astronomer, Giovanni Schiaparelli, saw lines on Mars, which he and others assumed were canals built by intelligent beings. It wasn’t until well into the 20th century that this notion was disproved. Still, when we gaze at the red planet, we wonder: Did life ever exist there? We are not the only ones wondering. Astronomers, geologists, and many other scientists have asked the same question. Today microbiologists have joined their scientific colleagues, wondering if microbial life once existed on the Red Planet or, for that matter, elsewhere in our Solar System. In 1996, NASA scientists reported finding what looked like fossils of microbes inside a meteorite thought to have come from Mars. Although most now believe these “fossils” are not microbial, it only fueled the debate. Could microbes, as we know them here on Earth, survive on Mars where the temperatures are far below 0°C and—as far as we know—there is little, if any, liquid water? Researchers, using a device to simulate the Martian environment, placed in it microbes known to survive extremely cold environments here on Earth. Their results indicated that members of the Archaea, specifically the methanogens, could grow at the cold temperatures and low pressures known to exist on Mars. They concluded that life could have existed on the Red Planet in the past or, as the quote says, “dwell in these worlds [today] if they be inhabited.”
1.1 Microbial The Beginnings of Microbiology 5.1 Reproduction
5.2
1.2
5.3
1.3
1.1.•Binary fission The discovery microorganisms produces of genetically identical was dependent daughter cells.on observations made with microscope and genetic factors affect a 2.the Environmental 2. •cell’s generation The emergence time. of experimental science provided a means to test long held Microbial Growth beliefs and resolve controversies Bacterial population growth goesand through 3.3. MicroInquiry 1: Experimentation four phases. Scientific Inquiry 4. Endospores are dormant structures that can Microorganisms and Disease Transmission endure times of nutrient stress. 4.5.•Growth ofEarly epidemiology studies microbial populations is sensitive suggested how diseases be spread to temperature, oxygencould gas, and pH. and be controlled Culture Media and Growth Measurements 5. • Resistance to a disease can come 6.from Culture media contain the nutrients exposure to and recovery from a needed mild for optimal growth. form of (or a microbial very similar) disease 7. Special chemical formulations are used to The Classical Golden Age of Microbiology isolate and identify some bacteria. 6. (1854-1914) MICROINQUIRY 5: Identification of Bacterial 7. • The germ theory was based on the Species observations that different microorganisms 8.have Two distinctive standard methods are cavailable to and specifi roles in nature produce pure cultures. 8. • Antisepsis and identification of the 9.cause Microbial growth can be reinforced measured by of animal diseases thedirect germ and indirect methods. theory
9. • Koch's postulates provided a way to identify a specific microorganism as causing a specific infectious disease 10. • Laboratory science and teamwork stimulated the discovery of additional infectious disease agents 11. • Viruses also can cause disease 12. • Many beneficial bacteria recycle nutrients in the environment
131
62582_CH05_131_157.pdf 131
2/4/10 2:16 PM
132
CHAPTER 5
Microbial Growth and Nutrition
TABLE
5.1
Some Microbial Record Holders
Hottest environment (Juan de Fuca ridge)—121°C (250°F): Strain 121 (Archaea) Coldest environment (Antarctica)—5°F (–15°C): Cryptoendoliths (Bacteria and lichens) Highest radiation survival—5MRad, or 5000× what kills humans: Deinococcus radiodurans (Bacteria) Deepest—3.2 km underground: Many Bacterial and Archaeal species Most acid environment (Iron Mountain, CA)—pH 0.0 (most life is at least a factor of 100,000 less acidic): Ferroplasma acidarmanus (Archaea) Most alkaline environment (Lake Calumet, IL)—pH 12.8 (most life is at least a factor of 1000 less basic): Proteobacteria (Bacteria) Longest in space (NASA satellite)–6 years: Bacillus subtilis (Bacteria) High pressure environment (Mariana Trench)—1200 times atmospheric pressure: Moritella, Shewanella and others (Bacteria) Saltiest environment (Eastern Mediterranean basin)—47% salt, (15 times human blood saltiness): Several Bacterial and Archaeal Species Source: http://www.astrobio.net/news/.
So, microbiologists have joined the search for extraterrestrial life. This seems a valid pursuit since the extremophiles found here on Earth survive, and even require, living in extreme environments ( TABLE 5.1 )—some not so different from Mars ( FIGURE 5.1 ). If life did or does exist on Mars, it almost certainly was or is microbial—most likely bacterial or archaeal-like organisms. In 2004, NASA sent two spacecrafts to Mars to look for indirect signs of past life. Scientists here on Earth monitored instruments on the Mars rovers, Spirit and Opportunity, designed to search for signs suggesting water once existed on the planet. Some findings suggest there are areas where salty seas once washed over the plains of Mars, creating a life-friendly environment. Opportunity found evidence for ancient shores of a large body of surface water that contained currents, which left their marks in rocks at the bottom of what once was a sea. Scientists reported in 2008 that a more recent spacecraft, the Mars Phoenix Lander, detected water ice near the Martian soil surface. Did or does life exist on Mars? Perhaps one day when human explorers or more sophisticated spacecraft reach Mars, we will know. Whether microorganisms are here on Earth in a moderate or extreme environment, or on Mars,
62582_CH05_131_157.pdf 132
FIGURE 5.1 The Martian Surface? This barren-looking landscape is not Mars but the Atacama Desert in Chile. It looks similar to photos taken by the Mars rovers Spirit and Opportunity. »» Does this area look like a habitable place for life, even microbial life?
there are certain physical and chemical requirements they must possess to survive, reproduce, and grow. In this chapter, we explore the process of cell reproduction in bacterial cells as compared to that in eukaryotic microbial cells. We also examine the physical and chemical conditions required for growth of bacterial and archaeal cells, and discover the ways that microbial growth can be measured. As we have been emphasizing in this text, the domains of organisms may have different structures and patterns, but they carry out many of the same processes.
2/4/10 2:16 PM
5.1 Microbial Reproduction
5.1
133
Microbial Reproduction
Growth in the microbial world usually refers to an increase in the numbers of individuals; that is, an increase in the population size with each cell carrying the identical genetic instructions of the parent cell. Asexual reproduction is a process to maintain genetic constancy while increasing cell numbers. In eukaryotic microbes, an elaborate interaction of microtubules and proteins with pairs of chromosomes in the cell nucleus allows for the precise events of mitosis and cytokinesis. Bacterial and archaeal cells divide without the microtubular involvement. Most Bacteria Reproduce by Binary Fission
Cell wall
1
Cell membrane
Cell elongates and DNA is replicated. Replicated DNA molecules
2
Cell wall and cell membrane begin to invagin*te. Fission ring apparatus
3
Cross-wall forms two distinct cells.
4
Cells separate.
KEY CONCEPT
1.
Binary fission produces genetically identical daughter cells.
Most bacterial organisms reproduce by an asexual process called binary fission, which usually occurs after a period of growth in which the cell doubles in mass. At this time, the chromosome (DNA) replicates and the two DNA molecules separate ( FIGURE 5.2A ). Chromosome segregation is not well understood. Unlike eukaryotic cells, bacterial cells lack a mitotic spindle to separate replicated chromosomes. The segregation process does involve specialized chromosomal-associated proteins but there is no clear picture describing how most of these proteins work to ensure accurate chromosome segregation. In any event, cell fission at midcell involves the synthesis of a partition, or septum, that separates the mother cell into two genetically identical daughter cells ( FIGURE 5.2B ). A eukaryotic tubulin hom*olog found in bacterial cells (see Chapter 4) is part of the fission ring apparatus that organizes the inward growth of the cell envelope. Cell separation then occurs by dissolution of the material in the septum. Depending on the growth conditions, the septum may dissolve at a slow enough rate for chains of connected cells (streptobacilli) to form. Reproduction by binary fission seems to confer immortality because there is never a moment at which the first bacterial cell has
62582_CH05_131_157.pdf 133
(A)
(B) FIGURE 5.2 The Process of Binary Fission. (A) Binary fission in a rod-shaped cell begins with DNA replication and segregation. Inward growth occurs at the midcell fission ring apparatus of the cell envelope separates the mother cell into two genetically-identical daughter cells. (B) A false-color transmission electron micrograph of a cell of Bacillus licheniformis undergoing binary fission. The inward growth of the cell wall and membrane is evident at midcell. (Bar = 0.25 µm.) »» How would binary fission differ for a prokaryotic organism having cells arranged in chains and another that forms single cells?
2/4/10 2:16 PM
134
CHAPTER 5
Microbial Growth and Nutrition
died. Each mother cell undergoes binary fission to become the two young daughter cells. However, the perception of immortality has been challenged by experiments suggesting bacterial cells do age (MICROFOCUS 5.1). CONCEPT AND REASONING CHECKS
5.1 Propose an explanation as to how a bacterial cell “knows” when to divide.
that sometime during the night you would know you have food poisoning. Bacterial and archaeal organisms are subject to the same controls on growth as all other organisms on Earth. Let’s examine the most important growth factors conferring optimal generation times. CONCEPT AND REASONING CHECKS
5.2 If it takes E. coli 7 hours to reach some 2 million cells, how long would it take T. pallidum to reach that same number under optimal conditions?
Bacterial and Archaeal Cells Reproduce Asexually KEY CONCEPT
2.
Environmental and genetic factors affect a cell’s generation time. 1,000,000
Incubation period: The time from entry of a pathogen into the body until the first symptoms appear.
62582_CH05_131_157.pdf 134
Time Number of (Hours: Min.) cells
900,000
0 :20 :40 1:00 1:20 1:40 2:00 2:20 2:40 3:00 3:20 3:40 4:00 4:20 4:40 5:00 5:20 5:40 6:00 6:20 6:40 7:00
800,000
Actual number of bacterial cells
The interval of time between successive binary fissions of a cell or population of cells is known as the generation time (or doubling time). Under optimal conditions, some species have a very fast generation time; for others, it is much slower. For example, the optimal generation time for Staphylococcus aureus is about 30 minutes; for Mycobacterium tuberculosis, the agent of tuberculosis, it is approximately 15 hours; and for the syphilis spirochete, Treponema pallidum, it is a long 33 hours. One enterprising mathematician calculated that if Escherichia coli binary fissions were to continue at their optimal generation time (15 minutes) for 36 hours, the bacterial cells would cover the surface of the Earth! Thankfully, this will not occur because of the limitation of nutrients and the loss of ideal physical factors required for growth. The majority of the bacterial cells would starve to death or die in their own waste. The generation time is useful in determining the amount of time that passes before disease symptoms appear in an infected individual; faster division times often mean a shorter incubation period for a disease. For example, suppose you eat an undercooked hamburger contaminated with the pathogen E. coli O157:H7, which has one of the shortest generation times—just 20 minutes under optimal conditions ( FIGURE 5.3 ). If you ingested one cell (more likely several hundred at least) at 8:00 PM this evening, two would be present by 8:20, four by 8:40, and eight by 9:00. You would have over 4,000 by midnight. By 3:00 AM, there would be over 2 million. Depending on the response of the immune system, it is quite likely
700,000
600,000
500,000
400,000
1 2 4 8 16 32 64 128 256 512 1,024 2,048 4,096 8,192 16,384 32,768 65,536 131,072 262,144 524,288 1,048,576 2,097,152
300,000
200,000
100,000
0 0
1
2
3 4 5 Time (hours)
6
7
FIGURE 5.3 A Skyrocketing Bacterial Population. The number of Escherichia coli cells progresses from 1 cell to 2 million cells in a mere 7 hours. The J-shaped growth curve gets steeper and steeper as the hours pass. Only a depletion of food, buildup of waste, or some other limitation will halt the progress of the curve. »» What is the generation time for the bacterial species in this figure?
2/4/10 2:16 PM
5.1: Evolution/Environmental Microbiology
A Microbe’s Life It used to be thought that bacteria do not age—they are immortal. This might seem obvious considering a mother cell divides at the mid-point by binary fission to become the two genetically equal daughter cells. However, new research suggests that although the DNA may be identical, after several generations of binary fission, the population consists of cells of different ages and the oldest ones have the longest generation time. Eric Stewart and his collaborators at INSERM, the National Institute of Health and Medical Research in Paris, filmed Escherichia coli cells as they divided into daughter cells on a specially designed microscope slide. A record of every daughter cell (total of 35,000 individual cells) was recorded for nine generations over a period of six hours. Then, a custom-designed computer system analyzed the micrographs. The group’s results suggest that although the cells may divide symmetrically, daughter cells are not morphologically or physiologically symmetrical. Each contains cellular poles of different ages. When a mother cell divides, each daughter cell inherits one end or pole of the mother cell. The region where the cells split develops into the other pole (see figure). For example, in the first division, the mother cell splits with a new wall (red). When the daughter cells grow in size they contain an old pole (brown) and a new one (red). When each of these cells divides, two have the oldest pole (brown) and youngest pole (green) while the two other cells have a younger pole (red) and a youngest pole (green). So after just two divisions, there are two populations of daughter cells: two have oldest and youngest poles while two have younger poles and youngest poles. According to Stewart’s group, the two cells with the oldest/youngest poles grew 2.2 percent slower than the cells with younger/youngest poles. As more and more binary fissions occur, the difference in age between daughter cells will continue to increase. The bottom line is that cells inheriting older and older poles experience longer generation times, reduced rates of offspring formed, and increased risk of dying compared to cells with younger, newer poles. This loss of fitness is called senescence. Note: Stewart’s group could not follow any cells to actual death because the cell populations eventually had so many cells, even their computer program could not keep them all independently recorded. Exactly why the older cells senesce is not understood. However, if the results from Stewart’s group are verified by others, it would at least appear that bacterial cells cannot escape the aging process. Even a microbe’s life is limited.
Mother cell
Daughter cells
Older pole
Younger pole
Slower
Faster Growth
Faster
Slower Growth
Two successive binary fissions produce daughter cells with various aged poles (brown = oldest; red = younger; green = youngest).
62582_CH05_131_157.pdf 135
2/4/10 2:16 PM
136
CHAPTER 5
Microbial Growth and Nutrition
5.2
Microbial Growth
In the previous section, we discovered how fast some bacterial cells can grow under ideal circ*mstances. Let’s look at the dynamics of bacterial growth in a little more detail. A Bacterial Growth Curve Illustrates the Dynamics of Growth KEY CONCEPT
3.
Bacterial population growth goes through four phases.
Logarithm (10n) of viable cells
A typical bacterial growth curve for a population illustrates the events occurring over time ( FIGURE 5.4 ). Whether several bacterial cells infect the human respiratory tract or are transferred to a tube of fresh growth medium in the laboratory, four distinct phases of growth occur: the lag phase; the logarithmic phase; the stationary phase; and the decline phase. 1. The Lag Phase. The first portion of the growth curve during which time no cell divisions occur is called the lag phase. At this time, bacterial cells are adapting to their new environment. In the respiratory tract, scavenging white blood cells may engulf and destroy some of the cells; in growth media, some cells may die from the shock of transfer or the inability to adapt to the new 10 9 8 7 6
environment. The actual length of the lag phase depends on the metabolic activity in the remaining cells. They must grow in size, store nutrients, and synthesize essential enzymes and other cell constituents—all in preparation for binary fission. 2. The Log Phase. The population now enters an active stage of growth called the logarithmic phase (or log phase). This is the exponential growth described above for E. coli. In the log phase, all cells are undergoing binary fission and the generation time is dependent on the species and environmental conditions present. As each generation time passes, the number of cells doubles and the graph rises in a straight line on a logarithmic scale. During an infection, disease symptoms usually develop during the log phase because the bacterial cells cause tissue damage. If the bacterial cells produce toxins, tissue destruction may become apparent. In a broth tube, the medium becomes cloudy (turbid) due to increasing cell numbers. If plated on solid growth medium, bacterial growth will be so vigorous that visible colonies appear and each colony may consist of millions of cells ( FIGURE 5.5 ). Vulnerability to antibiotics is also highest at this active stage of growth because many antibiotics affect actively metabolizing cells.
(3) Stationary phase
5
(4) Decline phase
(2) Log (exponential growth) phase
4
Some cells remain viable
3
2
(1) Lag phase
0 0
1
2
3
4
5 Time (hours)
6
7
8
Total cells in population: Few cells
Live cells
Dead cells
FIGURE 5.4 The Growth Curve for a Bacterial Population. (A) During the lag phase, the population numbers remain stable as bacterial cells prepare for division. (B) During the logarithmic (exponential growth) phase, the numbers double with each generation time. Environmental factors later lead to stationary phase (C), which involves a stabilizing population. (D) The decline phase is the period during which cell death becomes substantial. »» Why would antibiotics work best to kill or inhibit cells in the log phase?
62582_CH05_131_157.pdf 136
2/4/10 2:16 PM
5.2 Microbial Growth
(A)
137
quantities become exceedingly low, the population enters a decline phase (or logarithmic death phase). Now the number of dying cells far exceeds the number of new cells formed. A bacterial glycocalyx may forestall death by acting as a buffer to the environment, and flagella may enable organisms to move to a new location. For many species, though, the history of the population ends with the death of the last cell. When we discuss the progression of human diseases in Chapter 19, we will see a similar curve for the stages of a disease. For some bacterial species, especially soil bacteria, they can escape cell death by forming endospores. Let’s examine these amazing dormancy structures next. CONCEPT AND REASONING CHECKS
5.3 In a broth tube, describe the status of the bacterial cell population in each phase of the bacterial growth curve.
Endospores Are a Response to Nutrient Limitation KEY CONCEPT
4.
Endospores are dormant structures that can endure times of nutrient stress.
(B) FIGURE 5.5 Two Views of Bacterial Colonies. (A) Bacterial colonies cultured on blood agar in a culture dish. Blood agar is a mixture of nutrient agar and blood cells. It is widely used for growing bacterial colonies. (B) Close-up of typhoid bacteria (Salmonella typhi) colonies being cultured on a growth medium. »» How did each colony in (A) or (B) start?
3. The Stationary Phase. After some days (in an infection) or hours (in a culture tube), the vigor of the population changes and, as the reproductive and death rates equalize, the population enters a plateau, called the stationary phase. In the respiratory tract, antibodies from the immune system are attacking the bacterial cells, and phagocytosis by white blood cells adds to their destruction. In the culture tube, available nutrients become scarce and waste products accumulate. Factors such as oxygen also may be in short supply. This limitation of nutrients and buildup of waste materials leads to the death of many cells—but not all as MICROFOCUS 5.2 describes. 4. The Decline Phase. If nutrients in the external environment remain limited or the
62582_CH05_131_157.pdf 137
A few gram-positive bacterial species, especially soil bacteria belonging to the genera Bacillus and Clostridium, produce highly resistant structures called endospores or, simply, spores ( FIGURE 5.6 ). As described in the previous section, bacterial cells normally grow, mature, and reproduce as vegetative cells. However, when nutrients such as carbon or nitrogen are limiting and the population density reaches a critical mass, species of Bacillus and Clostridium enter stationary phase and begin spore formation or sporulation. Sporulation begins when the bacterial chromosome replicates and binary fission is characterized by an asymmetric cell division ( FIGURE 5.7 ). The smaller cell, the prespore, will become the mature endospore, while the larger mother cell will commit itself to maturation of the endospore before undergoing lysis. Depending on the exact asymmetry of cell division, the endospore may develop at the end of the cell, near the end, or at the center of the cell (the position is useful for species identification purposes).
Vegetative: Referring to cells actively metabolizing and obtaining nutrients.
2/4/10 2:16 PM
138
CHAPTER 5
Microbial Growth and Nutrition
5.2: Evolution/Environmental Microbiology
The Secret of Success Is Constancy to Purpose The title quote above was said by Benjamin Disraeli, a British statesman and literary figure in the mid1800s. It not only applies to human success in life but also to success of microbial species. Here’s how it applies in the bacterial world. As bacterial cells grow logarithmically, they eventually start running short of food and nutrients to sustain this log phase growth. Sensing that nutrients are becoming limited, as the population enters stationary phase, a few cells of many bacterial species enter a dormant (non-dividing) state and are referred to as persister (survivor) cells (see figure). Should the population go through a death phase, these persister cells “live on.” In this sense, the secret to evolutionary success for many species is constancy of purpose; always form some persister cells to ensure survival of the population should the species find itself in an unfamiliar or hostile environment. Indeed, such altruistic-like behavior may be responsible for some hard-to-treat infectious diseases, such as tuberculosis (TB), where persister cells can “hide out” in the body as a latent TB infection (Chapter 10). The constancy of purpose—to survive—also means persister cells would be unaffected by antibiotics, which tend to affect growing cells, not the dormant persister cells. The secret to successful survival here is antibiotic resistance, which, in part, would account for the recalcitrant properties exhibited by bacterial communities in a biofilm (see Chapter 3). In the case of the “hibernating” TB cells, persister cells could survive the antibiotic assault and later repopulate the infection. But genetic analysis of persister cells may have a solution. Biologist Kim Lewis at Northeastern University in Boston has discovered a gene in persister cells that codes for a protein that triggers dormancy. If a medical treatment could be devised to delete or deactivate the gene, the secret to success in pathogens could be defeated, possibly saving thousands of lives every year. So, in the end, the constancy of purpose carried out by medical researchers to understand the persister problem perhaps will be the ultimate secret of success.
Log (10n) viable cells
10
Normal growth cells
8
Persister cells
6 4 2 0 0
2
Lag phase
4
6 8 Time (h)
Log phase
10
12
Stationary phase
Persister cells increase as the growth curve progresses. Adapted from Lewis, K. 2007. Nature Reviews Microbiology 5: 48–56.
The prespore cell contains cytoplasm and DNA, and a large amount of dipicolinic acid, a unique organic substance that helps stabilize the proteins and DNA. After the cell is engulfed by the mother cell, thick layers of peptidoglycan form the cortex, followed by a series of pro-
62582_CH05_131_157.pdf 138
tein coats that further protect the contents. The mother cell then disintegrates and the spore is freed. It should be stressed that sporulation is not a reproductive process. Rather, the endospore represents a dormant stage in the life of the bacterial species.
2/4/10 2:16 PM
5.2 Microbial Growth
139
Coat layers
Core
Cortex
Endospores (A) (B) FIGURE 5.6 Three Different Views of Bacterial Endospores. (A) A light microscope image of Clostridium cells showing terminal spore formation. Note the characteristic drumstick appearance of the spores. (Bar = 5.0 µm.) (B) The fine structure of a Bacillus anthracis spore seen using the transmission electron microscope. The visible spore structures include the core, cortex, and coat layers. (Bar = 0.5 µm.) (C) A scanning electron microscope view of a germinating spore (arrow). Note that the spore coat divides equatorially along the long axis, and as it separates, the vegetative cell emerges. (Bar = 2.0 µm.) »» If an endospore is resistant to so many environmental conditions, how does a spore “know” conditions are favorable for germination?
(C)
Endospores are probably the most resistant living structures known. Desiccation has little effect on the spore. By containing little water, endospores also are heat resistant and undergo very few chemical reactions. These properties make them difficult to eliminate from contaminated medical materials and food products. For example, endospores can remain viable in boiling water (100°C) for 2 hours. When placed in 70% ethyl alcohol, endospores have survived for 20 years. Humans can barely withstand 500 rems of radiation, but endospores can survive one million rems. In this dormant condition, endospores can “survive” for extremely long periods of time (MICROFOCUS 5.3). When the environment is favorable for cell growth, the protective layers break down and each endospore germinates into a vegetative cell. A few serious diseases in humans are caused by spore formers. The most newsworthy has been Bacillus anthracis, the agent of the 2001 anthrax bioterror attack through the mail. This potentially deadly disease, originally studied by Koch and Pasteur, develops when inhaled spores germinate
62582_CH05_131_157.pdf 139
in the lower respiratory tract and the resulting vegetative cells secrete two deadly toxins. Botulism, gas gangrene, and tetanus are diseases caused by different species of Clostridium. Clostridial endospores often are found in soil, as well as in human and animal intestines. However, the environment must be free of oxygen for the spores to germinate to vegetative cells. Dead tissue in a wound provides such an environment for the development of tetanus and gas gangrene, and a vacuumsealed can of food is suitable for the development of botulism. Killing endospores can be a tough task. Heating them for many hours under high pressure will do the trick. If they contaminate machinery, such as they did in mail sorting equipment in the 2001 anthrax attacks, there are potent but highly dangerous chemical methods to kill the spores (Chapter 7). Postal workers who were exposed to the spores were effectively treated with antibiotics that can kill any newly germinated endospores before the vegetative cells can produce and secrete the deadly toxins.
Rems (Roentgen Equivalent Man): A measure of radiation dose related to biological effect.
2/4/10 2:16 PM
140
CHAPTER 5
Microbial Growth and Nutrition
B Binary fission occurs.
ASEXUAL CYCLE (nutrients plentiful)
A The DNA of the vegetatlve cell replicates and the cell elongates. G The free spore is released. The spore is seen within the enclosed spore coat. Under favorable nutrient conditions, the spore will germinate and develop into a vegetative cell.
DNA
Cell wall
C One replicated chromosome condenses at the end of the cell. As a result of an asymmetrical cell division, a transverse septum separates the prespore from the mother cell.
Cell membrane
Vegetative cell
Spore coat DNA
Cortex Cell membrane Free spore
Transverse septum SPORULATION CYCLE (carbon/nitrogen limitation)
F The walls of the spore are completed, and the mother cell disintegrates.
Cortex
Mother cell Prespore
Spore coat pieces
D The transverse septum forms and the prespore is engulfed by the mother cell.
E The outer layer, the cortex, develops around the prespore, and pieces of the spore coat form. FIGURE 5.7 The Formation of a Bacterial Spore by Bacillus subtilis. (A, B) When nutrient conditions can support growth and reproduction, vegetative cells continue through cycles of binary fission. (C-G) When nutrient conditions become limiting (e.g., carbon, nitrogen), endospore formers, such as B. subtilis, enter the sporulation cycle shown here. »» Hypothesize how a vegetative cell “knows” nutrient conditions are limiting.
62582_CH05_131_157.pdf 140
2/4/10 2:17 PM
5.2 Microbial Growth
141
5.3: Being Skeptical
Germination of 25 Million-Year-Old Endospores? Endospores have been recovered and germinated from various archaeological sites and environments. Living spores have been recovered and germinated from the intestines of Egyptian mummies several thousand years old. In 1983, archaeologists found viable spores in sediment lining Minnesota’s Elk Lake. The sediment was over 7,500 years old. All these reports though pale in comparison to the controversial discovery reported in 1995 by researcher Raul Cano of California Polytechnic State University, San Louis Obispo. Cano found bacterial spores in the stomach of a fossilized bee trapped in amber—a hardened resin—produced from a tree in the Dominican Republic. The fossilized bee was about 25 million-years-old. When the amber was cracked open and the material from the abdomen of the bee extracted and placed in nutrient medium, the equally ancient spores germinated. With microscopy, the cells from a colony were very similar to Bacillus sphaericus, which is found today in bees in the Dominican Republic. Is it possible for an endospore to survive for 25 million years—even if it is encased in amber? Critics were quick to claim the bacterial species may represent a modern-day species that contaminated the amber sample being examined. However, Professor Cano had carried out appropriate and rigorous decontamination procedures and sterilized the amber sample before cracking it open. He also carried out all the procedures in a class II laminar flow hood, which prevents outside contamination from entering the working area. In addition, the hood had never been used for any other bacterial extraction processes. Several other precautions were added to eliminate any chance that the spores were modern-day contaminants from an outside source. Still, many scientists question whether all contamination sources had been identified. The major question that remains is whether DNA can remain intact and functional after so long a period of dormancy. Does it really have a capability of replication and producing new vegetative growth? Granted, the DNA presumably was protected in a resistant spore, but could DNA remain intact for 25 million years? Research on bacterial DNA suggests the maximum survival time is about 400,000 to 1.5 million years. If true, then the 25 million-year-old spores could not be viable. But that is based on current predictions and they may be subject to change as more research is carried out with ancient DNA. The verdict? It seems unlikely that such ancient endospores could germinate after 25 million years. Perhaps new evidence will change that perception.
CONCEPT AND REASONING CHECKS
5.4 Hypothesize why gram-negative and most grampositive bacterial species cannot produce endospores.
Optimal Microbial Growth Is Dependent on Several Physical Factors KEY CONCEPT
5.
Growth of microbial populations is sensitive to temperature, oxygen gas, and pH.
Now that we have examined reproduction and growth, let’s examine the essential physical and chemical factors influencing cell growth. Temperature. Temperature is one of the most important factors governing growth. Every microbial species has an optimal growth temperature and an approximate 30°C operating
62582_CH05_131_157.pdf 141
range, from minimum to maximum, over which the cells will grow albeit with a slower generation time ( FIGURE 5.8 ). In general, most microbes can be assigned to one of three groups—psychrophiles, mesophiles, or thermophiles—based on their optimal growth temperature as well as their minimal and maximal growth temperatures. Microbes that have their optimal growth rates below 15°C but can still grow at 0°C to 20°C are called psychrophiles (psychro = “cold”). Because about 70% of the Earth is covered by oceans having deep water temperatures below 5°C, psychrophiles represent a group of bacterial and archaeal extremophiles that make up a large portion of the global microbial community. In fact, many psychrophiles can grow as fast at 4°C as E. coli does at 37°C. On the other hand, at these low temperatures, psychrophiles could not be human
2/4/10 2:17 PM
142
CHAPTER 5
Microbial Growth and Nutrition
Archaea Bacteria Eukarya Thermophiles Hyperthermophiles Rate of growth
Mesophiles Psychrotrophs Psychrophiles
–10
10
20
30
40 50 60 70 Temperature (˚C)
80
90
100
110
FIGURE 5.8 Growth Rates for Different Microorganisms in Response to Temperature. Temperature optima and ranges define the growth rates for Bacteria, Archaea, and Eukarya. Notice that the growth rates decline quite rapidly to either side of the optimal growth temperature. »» Propose what adaptations are needed for prokaryotes to survive at the psychrophilic or thermophilic extremes.
pathogens because they cannot grow at the warmer 37°C body temperature. Another group of “cold-loving” microbes are the psychrotrophs or psychrotolerant microorganisms. These species have a higher optimal growth temperature as well as a higher minimal and maximal growth temperature. Psychrotrophs can be found in water and soil in temperate regions of the world but are perhaps most commonly encountered on spoiled refrigerated foods (4°C). Some bacterial and archaeal species are psychrotolerant as are several microbial eukaryotic species, including fungi (molds). When such foods are consumed without heating, the toxins may cause food poisoning. One example is Campylobacter, the most frequently identified cause of infective diarrhea (TEXTBOOK CASE 5). At the opposite extreme are the thermophiles (thermo = “heat”) that multiply best at temperatures around 60°C but still multiply from 40°C to 70°C. Thermophiles are present in compost heaps and hot springs, and are important contaminants in dairy products because they survive pasteurization temperatures. However, thermophiles pose little threat to human health because they do not grow well at the cooler temperature of the body.
62582_CH05_131_157.pdf 142
Opposite to the psychrophiles, thermophiles have highly saturated fatty acids in their cell membranes to stabilize these structures. They also contain heat-stable proteins and enzymes. There also are many archaeal species that grow optimally at temperatures that exceed 80°C. These hyperthermophiles have been isolated from seawater brought up from hot-water vents along rifts on the floor of the Pacific Ocean. Because the high pressure keeps the water from boiling, some archaeal species can grow at an astonishing 121°C (Table 5.1). Most of the best-characterized bacterial species are mesophiles (meso = “middle”), which thrive at the middle temperature range of 10°C to 45°C. This includes the pathogens that grow in warm-blooded animals, including humans, as well as those species found in aquatic and soil environments in temperate and tropical regions of the world. E. coli is a typical mesophile. Oxygen. The growth of many microbes depends on a plentiful supply of oxygen, and in this respect, such obligate aerobes must use oxygen gas as a final electron acceptor to make cellular energy (Chapter 6). Other species, such as Treponema pallidum, the agent of syphilis, are termed microaerophiles because they survive in environments where the concentration of oxygen is relatively low. In the body, certain microaerophiles cause disease of the oral cavity, urinary tract, and gastrointestinal tract. Conditions can be established in the laboratory to study these microbes ( FIGURE 5.9A ). The anaerobes, by contrast, are microbes that do not or cannot use oxygen. Some are aerotolerant, meaning they are insensitive to oxygen. Many bacterial and archaeal species, as well as a few fungal and protozoal species, are obligate anaerobes, which are inhibited or killed if oxygen is present. This means they need other ways to make cell energy. Some anaerobic bacterial species, such as Thiomargarita namibiensis discussed in MicroFocus 3.5, use sulfur in their metabolic activities instead of oxygen, and therefore they produce hydrogen sulfide (H2S) rather than water (H2O) as a waste product of their metabolism. Others we have already encountered, such as the ruminant archaeal organisms that produce methane as the by-product of the energy conversions. In fact, life originated on Earth in an anaerobic
2/4/10 2:17 PM
5.2 Microbial Growth
Textbook
CASE
143
5
An Outbreak of Campylobacteriosis Caused by Campylobacter jejuni 1
On August 15, a cook began his day by cutting up raw chickens to be roasted for dinner.
He also cut up lettuce, tomatoes, cucumbers, and other salad ingredients on the Textbook CASE same countertop. The countertop surface where he worked was unusually small. 2
3
For lunch that day, the cook prepared sandwiches on the same countertop. Most were garnished with lettuce.
4
Restaurant patrons enjoyed sandwiches for lunch and roasted chicken for dinner. Many patrons also had a portion of salad with their meal.
5
During the next three days, 14 people experienced stomach cramps, nausea, and vomiting.
Campylobacter jejuni agar culture.
6
Public health officials learned that all the affected patrons had eaten salad with lunch or dinner. Campylobacter, a bacterial pathogen of the intestines, was located in their stools.
7
On inspection, microbiologists concluded that the chicken was probably contaminated with Campylobacter jejuni (see figure). However, the microbiologists concluded that the cooked chicken was not the cause of the illness.
8
Rather, C. jejuni from the raw chicken was the source.
Questions: (Answers can be found in Appendix D.) A.
Why would the cooked chicken not be the source for the illness?
B.
Why was the raw chicken identified as the source?
C.
How, in fact, did the patrons become ill?
For additional information see http://www.cdc.gov/mmwr/preview/mmwrhtml/00051427.htm.
environment consisting of methane and other gases (MICROFOCUS 5.4). Some species of anaerobic bacteria cause disease in humans. For example, the Clostridium species that cause tetanus and gas gangrene multiply in the dead, anaerobic tissue of a wound and produce toxins causing tissue damage. Another species of Clostridium multiplies in the oxygenfree environment of a vacuum-sealed can of food, where it produces the lethal toxin of botulism. Among the most widely used methods to establish anaerobic conditions in the laboratory
62582_CH05_131_157.pdf 143
is the GasPak system, in which hydrogen reacts with oxygen in the presence of a catalyst to form water, thereby creating an oxygen-free atmosphere ( FIGURE 5.9B, C ). Many microbes are neither aerobic nor anaerobic but facultative, meaning they can grow in either the presence or a reduced concentration of oxygen. This group includes many staphylococci and streptococci as well as members of the genus Bacillus and a variety of intestinal rods, among them E. coli. A facultative aerobe prefers anaerobic conditions (but also grows aerobically), while a
2/4/10 2:17 PM
144
CHAPTER 5
Microbial Growth and Nutrition
Screw clamp
Candle
Gasket H2 + O2 Cork
H2O
Palladium catalyst Hydrogen gas generator
Liquid media in tubes Petri dishes Solid media in inverted Petri dishes (A) (a)
(B) (b)
(C)
Bacterial Cultivation in Different Gas Environments. Two types of cultivation methods are shown for bacterial species that grow poorly in an oxygen-rich environment. (A) A candle jar, in which microaerophilic bacterial species grow in an atmosphere where the oxygen is reduced by the burning candle. (B, C) An anaerobic jar, in which hydrogen is released from a generator and then combines with oxygen through a palladium catalyst to form water and create an anaerobic environment. »» In which jar would a microbe grow? FIGURE 5.9
Type of growth
Both aerobic and anaerobic growth
Aerobic growth requires low concentration of O2
Aerobic growth requires O2
Growth is insensitive to O2
Growth occurs only in the absence of O2
+O2
Bacterial growth in thioglycollate broth
–O2
(A) (a)
(B) (b)
(C) (c)
(D) (d)
(E) (e)
FIGURE 5.10 The Effect of Oxygen on Microbial Growth. Each tube contains a thioglycollate broth into which was inoculated a different bacterial species. »» Identify the O2 requirement in each thioglycollate tube based on the growth density [example: (A) represents facultative microbes].
facultative anaerobe prefers oxygen-rich conditions (but also grows anaerobically). A common way to test an organism’s oxygen sensitivity is to use a thioglycollate broth, which binds free oxygen so that only fresh oxygen entering at the top of the tube would be available ( FIGURE 5.10 ). Finally, there are bacterial species said to be capnophilic (capno = “smoke”); they require an atmosphere low in oxygen but rich in carbon dioxide. Members of the genera Neisseria and Streptococcus are capnophiles.
62582_CH05_131_157.pdf 144
pH. The cytoplasm of most microorganisms has a pH near 7.0. This means that the majority of species grow optimally at neutral pH (see Chapter 2) and have a growth pH range that covers three pH units. However, some pH-hearty bacterial species, such as Vibrio cholerae, can tolerate acidic conditions as low as pH 2.0 and alkaline conditions as high as pH 9.5. Acid-tolerant bacteria called acidophiles are valuable in the food and dairy industries. For example, certain species of Lactobacillus and Streptococcus produce the acid that converts milk
2/4/10 2:17 PM
5.2 Microbial Growth
145
5.4: Evolution
“It’s Not Toxic to Us!” It’s hard to think of oxygen as a poisonous gas, but billions of years ago, oxygen was as toxic as cyanide. One whiff by an organism and a cascade of highly destructive oxidation reactions was set into motion. Death followed quickly. Difficult to believe? Not if you realize that the ancient Bacteria and Archaea relied on fermentation and anaerobic chemistry for their energy needs. They took organic materials from the environment and digested them to release the available energy. The atmosphere was full of methane, hydrogen, ammonia, carbon dioxide, and other gases. But no oxygen. And it was that way for hundreds of millions of years. Then, some 3.5 billion years ago, along came the cyanobacteria with their ability to perform photosynthesis. Chlorophyll and chlorophyll-like pigments evolved, and the bacterial cells could now trap radiant energy from the sun and convert it to chemical energy in carbohydrates. But there was a downside: Oxygen was a waste product of the process—and it was deadly because the oxygen radicals (O2–, OH•) produced could disrupt cellular metabolism by “tearing away” electrons from other molecules. As millions of microbial species died off in the toxic oceans and atmosphere, others “escaped” to oxygen-free environments that are still in existence today. A few species survived because they evolved the enzymes to safely tuck away oxygen atoms in a nontoxic form—that form was water. Also coming into existence were millions of new microbial species, some merely surviving and others thriving in the oxygen-rich environment. One of the modern-day survivors of these first communities are the stromatolites. These rock-like looking structures are still found in a few places on Earth, such as Sharks Bay off the western coast of Australia (see figure). These structures formed from ocean sediments and calcium carbonate that became trapped in the microbial community, building a rock-like fortress dead on the inside but alive on the surface. The top few inches in the crown of a stromatolite contain the oxygenevolving, photosynthetic cyanobacteria, while below these species are other bacterial species that can tolerate oxygen and sunlight. Buried beneath these organisms are other bacterial species that survive the anaerobic, dark niche of the stromatolite where neither oxygen nor sunlight can reach. A couple of billion years would pass before one particularly well-known species of oxygen-breathing creature evolved: Stromatolites, Shark Bay, Western Australia. hom*o sapiens.
62582_CH05_131_157.pdf 145
2/4/10 2:17 PM
146
CHAPTER 5
Hydrostatic pressure: The pressure exerted by the weight of water.
Microbial Growth and Nutrition
to buttermilk and cream to sour cream. These species pose no threat to good health even when consumed in large amounts. The “active cultures” in a cup of yogurt are actually acidophilic bacterial species. Extreme acidophiles are found among the Archaea as we saw in MicroFocus 2.3. The majority of known bacterial species, however, do not grow well under acidic conditions. Thus, the acidic environment of the stomach helps deter disease, while providing a natural barrier to the organs beyond. In addition, you may have noted certain acidic foods such as lemons, oranges, and other citrus fruits as well as tomatoes and many vegetables are hardly ever contaminated by bacterial growth. However, such damaged produce may be subject to fungal growth because many fungi grow well at a pH of 5 or lower. Hydrostatic and Osmotic Pressure. Further environmental factors can influence the growth of microbial cells. Psychrophiles in deep ocean waters and sediments are under extremely high hydrostatic pressure. In some deep marine trenches the hydrostatic pressure is tremendous—as high as 16,000 pounds per square inch (psi). Some extremophiles may be the only organisms able to withstand the pressure. Such barophiles in fact will die quite quickly at normal atmospheric pressures (14.7 psi). We have discussed osmotic pressure previously in regard to the pressure water exerts on
5.3
Colloid: Aggregates of molecules in a finely divided state dispersed in a solid medium.
62582_CH05_131_157.pdf 146
cells and the necessity for many microbial cells to have cell walls to prevent rupture of the cell or plasma membrane (see Chapter 4). In a reverse scenario, should the environment have more dissolved materials, water would leave the cells and the cells would plasmolyze. This is the principle behind salting meats and other food products, and using sugar as a preservative in jams and jellies. A high salt or sugar concentration will prevent growth and may even kill the cells (Chapter 7). Microbes, like E. coli, that are unable to grow in the presence of salt (NaCl) are called nonhalophiles. There are microorganisms though that are salt-loving. These halophiles require salt to survive. Marine microoganisms represent halophiles surviving well in 3.5% NaCl. Staphylococcus and some other microbial species are considered halotolerant; that is, they grow best without NaCl but can tolerate low concentrations of NaCl. The extreme halophiles represent groups of the Archaea that tolerate salt concentrations of 15 to 30%. The ability of microbes to withstand some very extreme conditions suggests they could live on other worlds (MICROFOCUS 5.5). FIGURE 5.11 summarizes the physical factors influencing microbial growth. CONCEPT AND REASONING CHECKS
5.5 Identify what would be extremophile conditions for each of the physical factors described in this section.
Culture Media and Growth Measurements
In this chapter, we have been discussing microbial growth and the physical factors that control growth. To complete our analysis of growth and nutrition, we need to identify the chemical media used to grow and separate specific microorganisms, and consider the measurements used to evaluate growth. A critical development in the design of culture media and the analysis of cell growth was the introduction of agar by Robert Koch (see Chapter 1). Agar is a polysaccharide derived from marine red algae. It contains no essential nutrients and is a unique colloid that remains liquid until cooled to below approximately 36°C. The solidified medium can be used to cultivate many different types of microbes, isolate pure cultures,
or accomplish other tasks, such as a medium for measuring population growth. Culture Media Are of Two Basic Types KEY CONCEPT
6.
Culture media contain the nutrients needed for optimal microbial growth.
Since the time of Pasteur and Koch, microbiologists have been growing bacterial and other microbial species in laboratory cultures; that is, in ways to mimic the natural environment. Today, many of the media used in the medical diagnostic bacteriology laboratory have their origins in the first Golden Age of Microbiology (see Chapter 1). These early media often contain
2/4/10 2:17 PM
5.3 Culture Media and Growth Measurements
147
Physical factors controlling microbial growth include
which includes three groups preferring
microbes not using O2 are
microbes using O2 are Aerobic
“Cold” temperature
pH
Oxygen
Temperature
“Hot” temperature “Warm” temperature
with temperature optima near
microbes sensitive to O2 are
Obligate aerobes
Obligate anaerobes
microbes requiring reduced levels of O2 are
Mesophiles
microbes tolerating O2 are
microbes tolerating NaCl are
microbes not tolerating NaCl are
Acidophiles
Nonhalophiles up to 15% are Halophiles at 15–30% are
Aerotolerant
15°C
microbes requiring NaCl
Halotolerant
Anaerobic
microbes requiring O2 are
37°C
microbes growing below pH 6 are
Osmotic conditions
Extreme halophiles
25°C Microaerophiles
Psychrophiles
Psychrotrophs
60°C
95°C
Thermophiles
Hyperthermophiles
microbes growing with or without O2 are
Facultative
FIGURE 5.11 Classes of Microbes Based on Physical Factors. This concept map summarizes the classes of microbes requiring specific physical factors for growth. »» Escherichia coli is a mesophilic, facultative, nonhalophile. What specific physical factors does this organism require for optimal growth?
blood or serum to mimic the environment in the human body. For the isolation and identification of microorganisms, two types of culture media are commonly used. A chemically undefined medium, or complex medium contains nutrients in which the exact components or their quantity is not completely known. For example, in nutrient broth or nutrient agar media it is not known precisely what
62582_CH05_131_157.pdf 147
carbon and energy sources or other growth factors are present because complex media typically contain animal or plant digests (e.g., beef extract, soybean extract) or yeast extracts of an undefined nature ( TABLE 5.2A ). Complex media are commonly used in the teaching laboratory because the purpose is simply to grow microbes and not be concerned about what specific nutrients are needed to accomplish this action.
2/4/10 2:17 PM
148
CHAPTER 5
Microbial Growth and Nutrition
5.5: Environmental Biology
War of the Worlds—On Mars In Steven Spielberg’s 2005 film War of the Worlds, adapted from H. G. Wells’ 1898 novel, what were thought to be falling stars or meteorites turn out to be Martian spaceships fleeing a dying world. When the curious come to examine the crash sites in the countryside, they discover the alien spacecrafts are filled with tentacled Martian invaders and their robotic war machines. Metallic appendages emerge from the crash craters and begin to destroy everything in their path. The war between Mars and Earth has begun. Although this is science fiction, in reality the scenario could happen—only on Mars. The United States has sent several spacecraft to Mars since the first Viking landers in 1976. Recently, an international team of scientists carried out studies suggesting terrestrial microbes could hitch a ride to Mars on such a craft—and even survive the journey. The team believes most spacecraft that have touched down on Mars were not thoroughly sterilized by heat or radioactivity, so they could be carrying living microbes from Earth. NASA scientists have assumed Mars’ thin atmosphere, which allows intense ultraviolet (UV) radiation to reach the planet’s surface—triple Earth’s intensity—would kill any life inadvertently carried on the spacecraft. In laboratory tests, Martian-level doses of UV radiation destroyed most microbes in just seconds. The reason the international team has raised the microbe alarm is from the tests they carried out. They tested the endurance of a particularly hardy cyanobacterium that thrives in the dry deserts of Antarctica. The extremophile, called Chroococcidiopsis, inhabits porous rocks near the rock surface where temperature and humidity are very low. The team found that most dormant spores of Chroococcidiopsis were killed after five minutes of a Martian UV dose. However, a few spores remained alive if they were buried by just 1 mm of soil. So, microbes might survive—and potentially grow—if protected from UV radiation and deposited in an environment with water and nutrients. Until 2008, American spacecraft had not landed in areas known to have such “habitable” conditions. Then, NASA’s Mars lander, the Phoenix mission, landed in the northern arctic region. It dug into the subsurface and detected water ice—areas where earthly microbial aliens could establish a foothold from a contaminated spacecraft. If true, and Martian life also was present in these regions, is it possible that earthly tentacled (piliated) bacterial or radiation-resistant archaeal invaders might start a war of the worlds—on Mars?
TABLE
5.2
Composition of a Complex and a Synthetic Growth Medium
Ingredient
Nutrient Supplied
A. Complex Agar Medium Peptone Amino acids, peptides Beef extract Vitamins, minerals, other nutrients Sodium chloride (NaCl) Sodium and chloride ions Agar Water B. Synthetic Broth Medium Glucose Simple sugar Ammonium phosphate Nitrogen, phosphate ((NH4)2HPO4) Sodium chloride (NaCl) Sodium and chloride ions Magnesium sulfate Magnesium ions, sulphur (MgSO4·7H2O) Potassium phosphate Potassium ions, phosphate (K2HPO4) Water
62582_CH05_131_157.pdf 148
Amount
5.0 g 3.0 g 8.0 g 15.0 g 1.0 liter 5.0 g 1.0 g
The second type of medium is a chemically defined or synthetic medium. In this medium, the precise chemical composition and amount of all components are known ( TABLE 5.2B ). This medium is used when trying to determine an organism’s specific growth requirements. CONCEPT AND REASONING CHECKS
5.6 Compare and contrast complex and synthetic media.
Culture Media Can Be Devised to Select for or Differentiate between Microbial Species KEY CONCEPT
7.
5.0 g 0.2 g 1.0 g 1.0 liter
Special chemical formulations are used to isolate and identify some bacteria.
In the clinical laboratory, the basic ingredients of the growth media can be modified in one of three ways to provide fast and critical information about the organism causing an infection or disease ( TABLE 5.3 ).
2/4/10 2:17 PM
5.3 Culture Media and Growth Measurements
149
TABLE
5.3
A Comparison of Special Culture Media
Name
Components
Uses
Examples
Selective medium
Growth stimulants Growth inhibitors Dyes Growth stimulants Growth inhibitors Growth stimulants
Selecting certain microbes out of a mixture Distinguishing different microbes in a mixture
Mannitol salt agar for staphylococci MacConkey agar for gram-negative bacteria
Cultivating fastidious microbes
Blood agar for streptococci; chocolate agar for Neisseria species
Differential medium
Enriched medium
A selective medium contains ingredients to inhibit the growth of certain microbes in a mixture while allowing the growth of others. The basic growth medium may contain extra salt (NaCl) or a dye to inhibit the growth of intolerant or sensitive organisms but permits the growth of those species or pathogens one wants to isolate ( FIGURE 5.12A ). Another modification to a basic growth medium is the addition of one or more compounds that allow one to differentiate between very similar species based on specific biochemical or physiological properties. This differential medium contains
in the culture plate specific chemicals to indicate which species possess and which lack a particular biochemical process. Such indicators make it easy to distinguish visually colonies of one organism from colonies of other similar organisms on the same culture plate ( FIGURE 5.12B ). MICROINQUIRY 5 looks closer at these two approaches to identify or separate similar bacterial species. Although many microorganisms grow well in nutrient broth and nutrient agar, certain so-called fastidious organisms may require an enriched medium containing special nutrients (MICROFOCUS 5.6).
1
2
1
4
3
3
(A)
Fastidious: Having complex nutritional requirements.
(B)
Selective and Differential Media. (A) Four different bacterial species (1–4), two gram positive and two gram negative, were streaked onto separate sections of a special plate and allowed to incubate for 48 hours. This medium only supports the growth of gram-negative species. (B) Because the two gram-negative species cannot be visually distinguished from one another, they were then streaked into another special medium plate and incubated for 48 hours. This medium allows one to distinguish between human enteric bacteria, where Escherichia coli produces a green metallic sheen while species like Enterobacter aerogenes produce a pink color. »» Which special medium is selective and which is differential? Explain your reasoning. FIGURE 5.12
62582_CH05_131_157.pdf 149
2/4/10 2:18 PM
150
CHAPTER 5
Microbial Growth and Nutrition
INQUIRY 5
Identification of Bacterial Species It often is necessary to identify a bacterial species or be able to tell the difference between similar-looking species in a mixture. In microbial ecology, it might be necessary to isolate certain naturally growing species from others in a mixture. In the clinical and public health setting, microbes might be pathogens associated with disease or poor sanitation. In addition, some may be resistant to standard antibiotics normally used to treat an infection. In all these cases, identification can be accomplished by modifying the composition of a complex or synthetic growth medium. Let’s go through two scenarios.
■ Suppose you are an undergraduate student in a marine microbiology course. On a field trip, you collect some seawater samples and, now back in the lab, you want to grow only photosynthetic marine microbes. How would you select for photosynthetic microbes? First, you know the photosynthetic organisms manufacture their own food, so their energy source will be sunlight and not the organic compounds typically found in culture media (see Table 5.2). So, you would need to use a synthetic medium but leave out the glucose. Also, knowing the salts typically in ocean waters, you would want to add them to the medium. You would then inoculate a sample of the collected material into a broth tube, place the tube in the light, and incubate for one week at a temperature typical of where the organisms were collected. 5a. What would you expect to find in the broth tube after one week’s incubation? What you have used in this scenario is a selective medium; that is, one that will encourage the growth of photosynthetic microbes (light and sea salts) and suppress the growth of non-photosynthetic micro-
62582_CH05_131_157.pdf 150
organisms (no carbon = no energy source). So, only marine photosynthetic microbes should be present.
■ As an infection disease officer in a local hospital, you routinely swab critical care areas to determine if there are any antibiotic resistant bacteria present. You are especially concerned about methicillinresistant Staphylococcus aureus (MRSA) as it frequently can cause disease outbreaks in a hospital setting. One swab you put in a broth tube showed turbidity after 48 hours. 5b. Knowing that Staphylococcus species are halotolerant, how could you devise an agar medium to visually determine if any of the growth is due to Staphylococcus aureus? Again, a selective medium would be used. It would be prepared by adding 7.5% salt to a complex agar medium. A sample from the broth tube would be streaked on the plate and incubated at 37°C for 48 hours. 5c. What would you expect to find on the agar plate after 48 hours? Your selective medium contained 10 discrete colonies. You do a Gram stain and discover that all the colonies contain clusters of purple spheres; they are grampositive. However, there are other species of Staphylococcus that do not cause disease. One is S. epidermidis, a common skin bacterium. A Gram stain therefore is of no use to differentiate S. aureus from S. epidermidis. 5d. Knowing that only S. aureus will produce acid in the presence of the sugar mannitol, how could you design a differential broth medium to determine if any of the colonies are S. aureus? (Hint: phenol red is a pH indicator that is red at neutral pH and yellow at acid pH). You can identify each bacterial species by taking a complex broth medium, such as
nutrient broth, and adding salt and mannitol (mannitol salts broth) and phenol red. Next, you inoculate a sample of each colony into a separate tube. You inoculate the 10 tubes and incubate them for 48 hours at 37°C. 5e. The broth tubes are shown below. What do the results signify? Which tubes contain which species of Staphylococcus? This method is an example of a differential medium because it allowed you to visually differentiate or distinguish between two very similar bacterial species. Knowing which colonies on the original selective medium plate are S. aureus, you need to determine which, if any, are resistant to the antibiotic methicillin. 5f. How could you design an agar medium to identify any MRSA colonies? 5g. If the plates are devoid of growth, what can you conclude? Again, you have used a selective medium; the addition of methicillin will permit the growth of any MRSA bacteria and suppress the growth of staphylococci sensitive to methicillin. Answers can be found in Appendix D. 1
2
3
4
5
6
7
8
9
10
Results from differential broth tubes.
2/4/10 2:18 PM
5.3 Culture Media and Growth Measurements
151
5.6: Public Health
“Enriching” Koch’s Postulates On July 21–23, 1976, some 5,000 Legionnaires attended the Bicentennial Convention of the American Legion in Philadelphia, PA. About 600 of the Legionnaires stayed at the Bellevue Stratford Hotel. As the meeting was ending, several Legionnaires who stayed at the hotel complained of flu-like symptoms. Four days after the convention ended, an Air Force veteran who had stayed at the hotel died. He would be the first of 34 Legionnaires over several weeks to succumb to a lethal pneumonia, which became known as Legionnaires’ disease. As with any new disease, epidemiological studies look for the source of the disease. The Centers for Disease Control and Prevention (CDC) had an easy time tracing the source back to the Bellevue Stratford Hotel. Epidemiological studies also try to identify the causative agent. Using Koch’s postulates, CDC staff collected tissues from lung biopsies and sputum samples. However, no microbes could be detected on slides of stained material. By December 1976, they were no closer to identifying the infectious agent. How can you verify Koch’s postulates if you have no infectious agent? It was almost like being back in the times of Pasteur and Koch. Why was this bacterial species so difficult to culture on bacteriological media? Perhaps it was a virus. After trying 17 different culture media formulations, the infectious agent was finally cultured. It turns out it was a bacterial species, but one with fastidious growth requirements. The initial agar medium contained a beef infusion, amino acids, and starch. When this medium was enriched with 1% hemoglobin and 1% isovitalex, small, barely visible colonies were seen after five days of incubation at 37°C. Investigators then realized the hemoglobin was supplying iron to the bacterium and the isovitalex was a source of the amino acid cysteine. Using these two chemicals in pure form, along with charcoal to absorb bacterial waste, a pH of 6.9, and an atmosphere of 2.5% CO2, bacterial growth was significantly enhanced (see figure). From these cultures, a gram-negative rod was confirmed and the organism was appropriately named Legionella pneumophila. With an enriched medium to pure culture the organism, susceptible animals (guinea pigs) could be injected as required by Koch’s postulates. L. pneumophila then was recovered from infected guinea pigs, verifying the organism as the causative agent of Legionnaires’ disease. Today, we know L. pneumophila is found in many aquatic environments, both natural and artificial. At the Bellevue Stratford Hotel, epidemiological studies indicated guests were exposed to L. pneumophila as a fine aerosol emanating from the air-conditioning system. Through some type of leak, the organism gained access to the system from the water cooling towers. Koch’s postulates are still useful—it’s just hard sometimes to satisfy the postulates without an isolated pathogen.
Colonies of L. pneumophila on an enriched medium.
62582_CH05_131_157.pdf 151
2/4/10 2:18 PM
152
CHAPTER 5
Microbial Growth and Nutrition
Many of the Bacteria and Archaea are impossible to cultivate in any laboratory culture medium yet devised. In fact, less than 1% of the species in natural water and soil samples can be cultured. So, it is impossible to estimate accurately microbial diversity in an environment based solely on culturability. Such nonculturable organisms are said to be in a VBNC (viable but non-culturable) state. Procedures for identifying VBNC organisms include direct microscopic examination and, most commonly, amplification of diagnostic gene sequences or 16S rRNA sequences as mentioned in the introduction to Chapter 1. Why are these organisms non-culturable? Microbiologists believe that part of the reason may be due to their presence in a “foreign” environment because most species have adapted to their own familiar and specific environment; a complex or synthetic medium is not their typical home. Therefore, these species go into a type of dormancy state and do not divide; that is, they are viable, but not culturable (see MicroFocus 5.2). Studies on VBNC Bacteria and Archaea present a vast and as yet unexplored field, which is important not only for detection of human pathogens, but also to reveal the diversity of these domains. CONCEPT AND REASONING CHECKS
5.7 List reasons why many bacterial and archaeal species cannot be cultured in existing complex or synthetic growth media.
Aseptic technique: The practice of transferring microorganisms to a sterile culture medium without introducing other contaminating organisms.
Subculturing: The process of transferring bacteria from one tube or plate to another.
62582_CH05_131_157.pdf 152
Population Measurements Are Made Using Pure Cultures KEY CONCEPT
8.
Two standard methods are available to produce pure cultures.
Microorganisms rarely occur in nature as a single species. Rather, they are mixed with other species, in a so-called mixed culture most often as a biofilm (see Chapter 3). Therefore, to study a species, microbiologists and laboratory technologists must use a pure culture—that is, a population consisting of only one species. This is particularly important when trying to identify a pathogen, as Pasteur discovered when trying to identify the agent responsible for cholera (see Chapter 1).
FIGURE 5.13 A Pour Plate. The dispersed bacterial cells grow as individual, discrete colonies. »» By looking at this plate, how would you know the original broth culture was a mixture of bacterial species?
If one has a mixed broth culture of bacterial species, how can the organisms be isolated as pure colonies? Two established methods are available. The first is the pour-plate method. Here, a small volume of the mixed culture is placed in a sterile culture dish. A molten agar medium is then poured into the dish and allowed to harden. During a 24 to 48 hour incubation, the cells divide to form discrete colonies throughout the agar ( FIGURE 5.13 ). A second, more commonly used technique, called the streak-plate method, uses a single plate of nutrient agar ( FIGURE 5.14A–D ). An inoculum from a mixed culture is removed with a sterile loop or needle using aseptic technique, and a series of streaks is made on the surface of one area of the plate. The loop is flamed, touched to the first area, and a second series is made in a second area. Similarly, streaks are made in the third and fourth areas, thereby spreading out the individual cells so they grow as separated colonies. On incubation, each cell will grow exponentially to form a discrete colony on the plate ( FIGURE 5.14E ) In both methods, the researcher, technologist, or student can select samples of the colonies for further testing and subculturing. CONCEPT AND REASONING CHECKS
5.8 Explain the difference between the pour-plate and streak-plate methods.
2/4/10 2:18 PM
5.3 Culture Media and Growth Measurements
(A) (a)
First set of streaks
(B) (b)
Second set of streaks
153
(C) (c)
Third set of streaks
Fourth set of streaks
(D) (d)
(E) (e)
The Streak-Plate Method. (A) A loop is sterilized, (B) a sample of cells is obtained from a mixed culture, and (C) streaked near one edge of the plate of medium. (D) Successive streaks are performed, and the plate is incubated. (E) Well-isolated and defined colonies illustrate a successful isolation. »» Justify the need to streak a mixed sample over four areas on a culture plate. FIGURE 5.14
Population Growth Can Be Measured in Several Ways
Counting chamber
Coverslip
KEY CONCEPT
9.
Microbial growth can be measured by direct and indirect methods.
Microbial growth in a medium, can be measured by direct and indirect methods. Direct Methods. There are a number of ways to directly measure cell numbers. Scientists may wish to perform a direct microscopic count using a known sample of the culture on a specially designed counting chamber ( FIGURE 5.15 ). However, this procedure will count both live and dead cells. In the most probable number test, microbial samples are added to numerous lactose broth tubes and the presence or absence of gas formed in fermentation gives a rough statistical estimation of the cell number. This technique has been used
62582_CH05_131_157.pdf 153
A The counting chamber is a specially marked slide containing a grid of 25 large squares of known area. The total volume of liquid held is 0.00002 ml (2 x 10–5 ml).
Sample B The counting chamber is placed on the stage of a light microscope. The number of cells are counted in several of the large squares to determine the average number. One of the 25 large squares
FIGURE 5.15 Direct Microscopic Count. This procedure can be used to estimate the total number of live and dead cells in a culture sample. »» Suppose the average number of cells per square was 14. Calculate the number of cells in a 10 ml sample.
2/4/10 2:18 PM
154
CHAPTER 5
Microbial Growth and Nutrition
FIGURE 5.16 The Standard Plate Count. Individual bacterial colonies have grown on this blood agar plate. Each colony represents a colony-forming unit (CFU) since it developed from a single bacterial cell. »» If a 0.1 ml sample of a 104 dilution contained 250 colonies, how many bacterial cells were in 10 ml of the original broth culture?
for measuring water quality and is described in MicroInquiry 26 in Chapter 26. In the standard plate count procedure, samples of a broth culture are spread on agar plates mixed in agar using the pour-plate method ( FIGURE 5.16 ). The assumption is that each cell will undergo multiple rounds of cell division to produce separate colonies on the plate. Because two or more
cells could clump together on a plate and grow as a single colony, the standard plate count is expressed as the number of colony-forming units (CFUs). After incubation, the number of CFUs will be used to estimate the number of viable cells originally plated. Indirect Methods. Indirect methods include measuring the dry weight of the cell population, which gives an indication of the cell mass. Oxygen uptake in metabolism also can be measured as an indication of metabolic activity and therefore cell number. Another indirect method uses a spectrophotometer to measure the cloudiness, or turbidity, of a broth culture. This instrument detects the amount of light scattered by a suspension of cells placed in the spectrophotometer such that the amount of light scatter (optical density, OD) is a function of the cell mass; that is, the more cells present, the more light is scattered or absorbed, resulting in a higher absorbance reading on the spectrophotometer ( FIGURE 5.17 ). A standard curve can be generated to serve as a measure of cell numbers. However, because more than 10 million cells are needed to make a reading on the spectrophotometer, turbidity is not a useful way to study the growth of small populations of bacterial cells. CONCEPT AND REASONING CHECKS
5.9 Distinguish between direct and indirect methods to measure population growth.
(A)
(B) FIGURE 5.17 Using Turbidity to Measure Population Growth. (A) As light passes through a sterile broth tube in the spectrophotometer, the instrument is standardized at 0 absorbance. (B) As a bacterial population in a broth tube grows, the cells will scatter more of the light, which on the spectrophotometer is detected as an increase in absorbance. »» Why do turbidity measurements represent an indirect method to measure population growth?
62582_CH05_131_157.pdf 154
2/4/10 2:18 PM
Step A: Self-Test
155
SUMMARY OF KEY CONCEPTS 5.1
Microbial Reproduction 1. Bacterial reproduction involves DNA replication and binary fission to produce genetically identical daughter cells. 2. Binary fissions occur at intervals called the generation time, which may be as short as 20 minutes.
5.2
Microbial Growth 3. The dynamics of the bacterial growth curve show how a microbial population grows logarithmically, reaches a certain peak and levels off, and then may decline. 4. Sporulation is a dormancy response in a few bacterial species to nutrient limitation and high population density. The endospores formed are resistant to many harsh environmental conditions. 5. Temperature, oxygen, pH, and hydrostatic/osmotic pressure are physical factors that influence microbial growth. Away from the optimal condition, growth slows within a set range.
5.3
Culture Media and Growth Measurements 6. Complex and synthetic media contain the nutrients for microbial growth. 7. Complex or synthetic media can be modified to select for a desired microbial species, to differentiate between two similar species, or to enrich for species requiring special nutrients. 8. Pure cultures can be produced from a mixed culture by the pour-plate method or the streak-plate method. In both cases, discrete colonies can be identified that represent only one microbial species. 9. Microbial growth can be measured by direct microscopic count, the most probable number test, and the standard plate count procedure. Indirect methods include dry weight, oxygen uptake, and turbidity measurements.
LEARNING OBJECTIVES After understanding the textbook reading, you should be capable of writing a paragraph that includes the appropriate terms and pertinent information to answer the objective. 1. Describe the process of binary fission. 2. Summarize the uses for knowing a microbe’s generation time. 3. Compare the events of each phase of a bacterial growth curve. 4. Contrast the stages of bacterial sporulation and assess the importance of the process.
5. Identify the 4 major physical factors governing microbial growth and describe how microorganisms have adapted to these physical environments. 6. Contrast the chemical composition of complex and synthetic media. 7. Explain how selective and differential media are each constructed. 8. Explain the procedures used in the pour-plate and streak-plate methods. 9. Judge the usefulness of direct and indirect methods to measure microbial growth.
STEP A: SELF-TEST Each of the following questions is designed to assess your ability to remember or recall factual or conceptual knowledge related to this chapter. Read each question carefully, then select the one answer that best fits the question or statement. Answers to even-numbered questions can be found in Appendix C. 1. Which one of the following statements does NOT apply to bacterial reproduction? A. A fission ring apparatus is present. B. Septum formation occurs. C. A spindle apparatus is used. D. Symmetrical cell division occurs. 2. If a bacterial cell in a broth tube has a generation time of 40 minutes, how many cells will there be after 6 hours of optimal growth? A. 18 B. 64 C. 128 D. 512 3. A bacterial species generation time would be determined during the _____ phase. A. decline B. lag C. log D. stationary
62582_CH05_131_157.pdf 155
4. Which one of the following is NOT an event of sporulation? A. Symmetrical cell divisions B. Mother cell disintegration C. DNA replication D. Prespore engulfment by the mother cell 5. A microbe that is a microaerophilic mesophile would grow optimally at _____ and _____ . A. high O2; 30ºC B. low O2; 20ºC C. no O2; 30ºC D. low O2; 37ºC 6. If the carbon source in a growth medium is beef extract, the medium must be an example of a/an _____ medium. A. complex B. chemically defined C. enriched D. synthetic 7. A _____ medium would involve the addition of the antibiotic methicillin to identify methicillin-resistant bacteria. A. differential B. selective C. thioglycollate D. VBNC
2/4/10 2:18 PM
156
CHAPTER 5
Microbial Growth and Nutrition
8. Which one of the following is NOT part of the streak-plate method? A. Making four sets of streaks on a plate. B. Diluting a mixed culture in molten agar. C. Using a mixed culture. D. Using a sterilized loop.
9. Direct methods to measure bacterial growth would include all the following except the _____ . A. total bacterial count B. microscopic count C. turbidity measurements D. most probable number
STEP B: REVIEW Answers to even-numbered questions or statements can be found in Appendix C. 10. Use the log phase growth curves (1, 2, or 3) below to answer each of the following questions (a–c).
Growth curves Number of Cells
1
2
3 Time (min)
_____ a. Which curve (1, 2, or 3) best represents the growth curve for a mesophile incubated at 60ºC? _____ b. Which curve (1, 2, or 3) best represents a non-halophile growing in 5% salt? _____ c. Which curve (1, 2, or 3) best represents an acidophile growing at pH 4? 11. Construct a concept map for Growth Measurements using the following terms. cell mass colony-forming units direct methods direct microscopic count dry weight indirect methods
62582_CH05_131_157.pdf 156
On completing your study of these pages, test your understanding of their contents by deciding whether the following statements are true (T) or false (F). If the statement is false, substitute a word or phrase for the underlined word or phrase to make the statement true. 12. _____ Endospores are produced by some gram-negative bacterial species. 13. _____ Obligate aerobes use oxygen gas as a final electron acceptor in energy production. 14. _____ The most common growth medium used in the teaching laboratory is a complex medium. 15. _____ The majority of bacterial and archaeal organisms that have been discovered can be cultured in growth media. 16. _____ A standard plate count procedure is an example of a direct method to estimate population growth. 17. _____ In attempting to culture a fastidious bacterial pathogen, a differential medium would be used. 18. _____ Acidophiles grow best at pHs greater than 9. 19. _____ Mesophiles have their optimal growth near 37ºC. 20. _____ Bacterial and archaeal cells lack a mitotic spindle to separate chromosomes. 21. _____ The fastest doubling time would be found in the lag phase of a bacterial growth curve. 22. _____ If E. coli cells are placed in distilled water, they will lyse. 23. _____ Halophiles would dominate in marine environments.
metabolic activity most probable number test oxygen uptake standard plate count turbidity
2/4/10 2:18 PM
Step D: Questions for Thought and Discussion
157
STEP C: APPLICATIONS Answers to even-numbered questions can be found in Appendix C. 24. Consumers are advised to avoid stuffing a turkey the night before cooking, even though the turkey is refrigerated. A homemaker questions this advice and points out that the bacterial species of human disease grow mainly at warm temperatures, not in the refrigerator. What explanation might you offer to counter this argument?
25. Public health officials found that the water in a Midwestern town was contaminated with sewage bacteria. The officials suggested that homeowners boil their water for a couple of minutes before drinking it. (a) Would this treatment sterilize the water? Why? (b) Is it important that the water be sterile? Explain.
STEP D: QUESTIONS FOR THOUGHT AND DISCUSSION Answers to even-numbered questions can be found in Appendix C. 26. To prevent decay by bacterial species and to display the mummified remains of ancient peoples, museum officials place the mummies in glass cases where oxygen has been replaced with nitrogen gas. Why do you think nitrogen is used? 27. Extremophiles are of interest to industrial corporations, who see these organisms as important sources of enzymes that function at temperatures of 100°C and pH levels of 10 (the enzymes have been dubbed “extremozymes”). What practical uses can you foresee for these enzymes?
28. During the filming of the movie Titanic, researchers discovered at least 20 different bacterial and archaeal species literally consuming the ship, especially a rather large piece of the midsection. What type of environmental conditions are these bacterial and archaeal species subjected to at the wreck’s depth of 12,600 feet? 29. Although thermophilic bacteria are presumably harmless because they do not grow at body temperatures, they may still present a hazard to good health. Can you think of a situation in which this might occur?
HTTP://MICROBIOLOGY.JBPUB.COM/9E The site features eLearning, an online review area that provides quizzes and other tools to help you study for your class. You can also follow useful links for in-depth information, read more MicroFocus stories, or just find out the latest microbiology news.
62582_CH05_131_157.pdf 157
2/4/10 2:18 PM
6 Chapter Preview and Key Concepts
6.1 Enzymes and Energy in Metabolism 1. Enzyme catalysis means enzymes must have specific chemical properties. 2. Cellular chemical reactions occur at the enzyme’s active site. 3. Metabolism often involves a series of chemical reactions controlled by separate enzymes. 4. Metabolism can control and be controlled by enzymes. 5. ATP is the universal energy currency in cells. 6.2 The Catabolism of Glucose 6. Glucose is a primary source for generating ATP. 7. Glycolysis is a metabolic pathway yielding ATP and NADH. 8. The citric acid cycle yields additional ATP and NADH as well as FADH2. 9. NADH and FADH2 provide the starting materials for oxidative phosphorylation. 6.3 Other Aspects of Catabolism 10. Other carbohydrates as well as fats and proteins can supply chemical energy for ATP production. MICROINQUIRY 6: The Machine That Makes ATP 11. ATP can be produced through chemiosmosis without oxygen gas. 12. Fermentation generates ATP in the absence of exogenous electron acceptors. 6.4 The Anabolism of Carbohydrates 13. Photosynthesis converts light energy into chemical energy usually in the form of carbohydrates. 6.5 Patterns of Metabolism 14. Autotrophs and heterotrophs vary in their energy and carbon sources.
Metabolism of Microorganisms Life is like a fire; it begins in smoke and ends in ashes. —Ancient Arab proverb connecting energy to life
Charlie Swaart had been a social drinker for years. A few beers or drinks with his pals, but no lasting alcoholic consequences. Then, in 1945, he began a nightmare that would make medical history. One October day, while stationed in Tokyo after World War II, Swaart suddenly became drunk for no apparent reason. He had not had any alcohol for days, but suddenly he felt like he had been partying all night. After sleeping it off, he would be fine the next day. Unfortunately, this “behavior” returned time and time again. For years thereafter, the episodes continued—bouts of drunkenness and monumental hangovers without drinking so much as a beer! Doctors were puzzled as they could detect alcohol on his breath and in his blood. Was this some type of internal metabolism gone haywire? Was it the result of a bacterial infection? It didn’t seem likely. They warned him though not to drink any additional alcohol for fear of damaging his liver. Swaart followed their advice to the letter; still, he experienced periods of drunkenness. Twenty years passed before Swaart, known as the “drinkless drunk,” learned of a similar case in Japan. A Japanese businessman had endured years of social and professional disgrace before doctors discovered a yeastlike fungus in his intestine. Studying this eukaryotic microbe showed that the fungal cells were fermenting carbohydrates to alcohol right there in his intestine. The fungus was identified as Candida albicans ( FIGURE 6.1 ). Now having C. albicans in one’s intestine is not uncommon; but, finding fermenting C. albicans was historic. Swaart learned that an antibiotic had worked to kill the yeast cells in the Japanese man’s gut. With this knowledge, he approached his doctor. Sure enough, lab tests showed massive colonies of C. albicans in Swaart’s intestine too. The sugar in a cup of coffee or any carbohydrate in pasta, cake, or candy
158 158
62582_CH06_158_188.pdf 158
2/4/10 2:19 PM
6.1 Enzymes and Energy in Metabolism
159
TABLE
6.1 Anabolism
Catabolism
Buildup of small molecules Products are large molecules Photosynthesis
Breakdown of large molecules Products are small molecules Glycolysis, citric acid cycle Mediated by enzymes Energy generally is released (exergonic)
Mediated by enzymes Energy generally is required (endergonic)
FIGURE 6.1 Candida albicans Cells. This false-color scanning electron microscope image of C. albicans shows daughter cells (yellow) budding from the mother cells. (Bar = 10 µm.) »» To what domain of organisms does C. albicans belong?
could bring on drunkenness. However, to cure his illness, Swaart had to travel back to Japan to get the effective antibiotic. Researchers believed the atomic blasts of Hiroshima and Nagasaki in 1945 may have caused a normal C. albicans to mutate to a fermenting form, which somehow found its way into Swaart’s digestive system. One can only wonder if there are many other individuals who have become living fermentation vats for the fungus. For Charlie Swaart, though, the nightmare was finally over. The process of fermentation described here was in a eukaryotic microbe. However, many other types of fermentation processes also occur in microorganisms and they are but one aspect of the broad topic of microbial metabolism. Metabolism refers to all the biochemical reactions taking place in an organism. These processes are divided into two general categories. Anabolism builds larger organic compounds such as carbohydrates and proteins from simpler monomers, including glucose and amino acids. Catabolism
6.1
A Comparison of Two Key Aspects of Cellular Metabolism
hydrolyzes these polymers into simpler molecules such as carbon dioxide, ammonia, and water (see Chapter 2). From an energy perspective, anabolic reactions form bonds, which require energy. Such energy-requiring processes are endergonic (end = “inner”; ergon = “work”) reactions. In contrast, catabolic reactions break bonds, releasing energy. These processes are called exergonic (ex = “outside of”) reactions. TABLE 6.1 compares anabolism and catabolism, which are reactions often taking place simultaneously in cells and organisms. Realize metabolism also includes conversion reactions that transform one molecule into another without any type of catabolic or anabolic event. In this chapter, we examine the types of metabolism exhibited by microorganisms. Much of the chapter discusses the catabolic reactions involved in energy conversions forming adenosine triphosphate (ATP). Because the chapter emphasizes the role of carbohydrates in the energy conversions, it might be worthwhile to revisit Chapter 2 and refresh yourself with these types of organic compounds.
Enzymes and Energy in Metabolism
The growth we examined in the previous chapter depends on metabolic processes that occur in the cell cytosol, on the cell (plasma) membrane, in the periplasmic space (gram-negative bacteria), in eukaryotic organelles, and outside the cell. To
62582_CH06_158_188.pdf 159
carry out these reactions, cells need a large variety of enzymes. Therefore, we begin our study of metabolism with a discussion of these essential proteins, which have been known only since the early 1900s (MICROFOCUS 6.1).
2/4/10 2:19 PM
160
CHAPTER 6
Metabolism of Microorganisms
6.1: History
“Hans, Du Wirst Das Nicht Glauben!” Louis Pasteur’s discovery of the role yeast cells play in fermentation heralded the beginnings of microbiology because it showed that tiny organisms could bring about important chemical changes. However, it also opened debate on how yeasts accomplished fermentation. Lively controversies ensued among scientists; some suggesting sugars from grape juice entered yeast cells to be fermented; others believing fermentation occurred outside the cells. The question would not be resolved until a fortunate accident happened in the late 1890s. In 1897, two German chemists, Eduard and Hans Buchner, were preparing yeast as a nutritional supplement for medicinal purposes. They ground yeast cells with sand and collected the cell-free “juice.” To preserve the juice, they added a large quantity of sugar (as was commonly done at that time) and set the mixture aside. Several days later Eduard noticed an unusual alcoholic aroma coming from the mixture. Excitedly, he called to his brother, “Hans, Du Wirst Das Nicht Glauben!” (“Hans, you’ll never believe this!”) One taste confirmed their suspicion: The sugar had fermented to alcohol. The discovery by the Buchner brothers was momentous because it demonstrated that a chemical substance inside yeast cells brings about fermentation, and that fermentation can occur without living cells. The chemical substance came to be known as an “enzyme,” meaning “in yeast.” In 1905, the English chemist Arthur Haden expanded the Buchner study by showing that “enzyme” is really a multitude of chemical compounds and should better be termed “enzymes.” Thus, he added to the belief that fermentation is a chemical process. Soon, many chemists became biochemists, and biochemistry gradually emerged as a new scientific discipline.
Enzymes Catalyze All Chemical Reactions in Cells KEY CONCEPT
1.
Enzyme catalysis means enzymes must have specific chemical properties.
Enzymes are proteins (or in a few instances RNA molecules) that increase the probability of chemical reactions while themselves remaining unchanged. They accomplish in fractions of a second what otherwise might take hours, days, or longer to happen spontaneously under normal biological conditions. For example, even though organic molecules like amino acids have functional groups, it is highly unlikely they would randomly bump into one another in the precise way needed for a chemical reaction (dehydration synthesis) to occur and for a new peptide bond to be formed (see Chapter 2). Thus, the reaction rate would be very slow were it not for the activity of enzymes. Enzymes have several common characteristics. 1. Enzymes are reusable. Once a chemical reaction has occurred, the enzyme is released to participate in another identical reaction. In fact, the same enzyme can catalyze the same reaction 100 to 1,000 times each second. 2. Enzymes are highly specific. An enzyme that functions in one type of chemical reaction
62582_CH06_158_188.pdf 160
usually will not participate in another type of reaction. That means there must be thousands of different enzymes to catalyze the thousands of different chemical reactions of metabolism occurring in a microbial organism. 3. Enzymes have an active site. Each enzyme has a special pocket or cleft called an active site, which has a specific three-dimensional shape complementary to a reactant (called a substrate). The active site positions the substrate such that it is highly likely a chemical reaction will occur to form one or more products. 4. Enzymes are required in minute amounts. Because an enzyme can be used thousands of times to catalyze the same reaction, only minute amounts of a particular enzyme are needed to ensure that a fast and efficient metabolic effect occurs. Many enzymes can be identified by their names, which often end in “-ase.” For example, sucrase is the enzyme that breaks down sucrose and ribonuclease digests ribonucleic acid. In terms of anabolic metabolism, polymerases link together nucleotides and transferases link together the NAG and NAM units to build the bacterial cell wall peptidoglycan. CONCEPT AND REASONING CHECKS
6.1 List the characteristics of enzymes.
2/4/10 2:19 PM
6.1 Enzymes and Energy in Metabolism
161
Substrate: sucrose A A An enzyme molecule has an active site where it binds the substrate molecule. Enzyme-substrate complex Active site
Enzyme
B A The reaction between enzyme and substrate molecules forms a complex and temporarily may alter the active site slightly.
E A The enzyme molecule remains unchanged and is recycled. Products:
glucose
Enzyme and product
C A The enzyme breaks apart the substrate molecule.
fructose D A Two end products result from the reaction. FIGURE 6.2 The Mechanism of Enzyme Action. Although this example shows an enzyme hydrolyzing a substrate (sucrose), enzymes also catalyze dehydration reactions, which, in this case, would combine glucose and fructose into sucrose. »» How do enzymes recognize specific substrates?
Enzymes Act through Enzyme-Substrate Complexes KEY CONCEPT
2.
Cellular chemical reactions occur at the enzyme’s active site.
Enzymes function by aligning substrate molecules in such a way that a reaction is highly favorable. In the hydrolysis reaction shown in FIGURE 6.2 , the three-dimensional shape of the enzyme’s active site recognizes and holds the substrate in an enzyme-substrate complex. While in the complex, chemical bonds in the substrate are stretched or weakened by the enzyme, causing the bond to break. In a synthesis reaction, by contrast, the electron shells of the substrates in the enzyme-substrate complex are forced to overlap in the spot where the chemical bond will form. Thus, in a hydrolysis or dehydration reaction, recognition of the substrate(s) is a precisely controlled, nonrandom event.
62582_CH06_158_188.pdf 161
Looking at sucrose again, the bonds holding glucose and fructose together will not break spontaneously. The reason is the bond between the monosaccharides is stable and there is a substantial energy barrier preventing a reaction ( FIGURE 6.3A ). The job of sucrase is to bind the substrate and lower the energy barrier so that it is much more likely that the reaction will occur. In other words, the bond holding glucose to fructose needs to be destabilized (i.e., stretched, weakened) by the enzyme ( FIGURE 6.3B ). This energy barrier is called the activation energy. Enzymes, then, play a key role in metabolism because they provide an alternate reaction pathway of less resistance; that is, with a lower activation energy barrier. They assist in the destabilization of chemical bonds and the formation of new ones by separating or joining atoms in a carefully orchestrated fashion. Some enzymes are made up entirely of protein. An example is lysozyme, the enzyme in human tears and saliva that hydrolyzes the bond between
2/4/10 2:19 PM
162
CHAPTER 6
Metabolism of Microorganisms
Sucrose CH2OH O
HOCH2
Sucrase (enzyme) CH2OH O
O
O
O
O
CH2OH
(A) (a)
Active site HOCH2
CH2OH
(B) (b)
T
Energy
Activation energy with enzyme
Activation energy without enzyme
Energy of reactant Energy of product
CH2OH O
HOCH2
OH
Glucose
Progress of reaction
O
+ HO
CH2OH
Fructose
FIGURE 6.3 Enzymes and Activation Energy. Enzymes lower the activation energy barrier required for chemical reactions of metabolism. (A) The hydrolysis of sucrose is unlikely because of the high activation energy barrier. (B) When sucrase is present, the enzyme effectively lowers the activation energy barrier at the transition state (T), making the hydrolysis reaction highly favorable. »» How does the enzyme lower the activation energy of a stable substrate?
NAG and NAM in the cell walls of gram-positive bacterial cells. Other enzymes, however, may contain small, nonprotein substances, called cofactors, that participate in the catalytic reaction. Inorganic cofactors are metal ions, such as magnesium (Mg2+), iron (Fe2+), and zinc (Zn2+). When the nonprotein cofactor is a small organic molecule, it is referred to as a coenzyme, most of which are derived from vitamins. Examples of two important coenzymes are nicotinamide adenine dinucleotide (NAD+) and flavin adenine dinucleotide (FAD). These coenzymes play a significant role as electron carriers in metabolism, and we shall encounter them in our ensuing study of microbial metabolism. CONCEPT AND REASONING CHECKS
6.2 Assess the role of the active site in “stimulating” a chemical reaction.
Enzymes Often Team Up in Metabolic Pathways KEY CONCEPT
3.
gle substrate to product reaction. However, cells more often use metabolic pathways. A metabolic pathway is a sequence of chemical reactions, each reaction catalyzed by a different enzyme, in which the product (output) of one reaction serves as a substrate (input) for the next reaction ( FIGURE 6.4A ). The pathway starts with the initial substrate and finishes with the final end product. The products of “in-between” stages are referred to as “intermediates.” Metabolic pathways can be anabolic, where larger molecules are synthesized from smaller monomers. In contrast, other pathways are catabolic because they break larger molecules into smaller ones. Such pathways may be linear, branched, or cyclic. We will see many of these pathways in the microbial metabolism sections ahead. CONCEPT AND REASONING CHECKS
6.3 If a metabolic pathway has eight intermediates, how many different enzymes are involved?
Metabolism often involves a series of chemical reactions controlled by separate enzymes.
Enzyme Activity Can Be Inhibited There are many examples, such as the sucrose example, where an enzymatic reaction is a sin-
62582_CH06_158_188.pdf 162
KEY CONCEPT
4.
Metabolism can control and be controlled by enzymes.
2/4/10 2:19 PM
6.1 Enzymes and Energy in Metabolism
Both environmental factors by themselves and in concert with metabolic pathways can inhibit enzyme activity permanently or temporarily. Enzyme Inhibition by Environmental Factors. In the last chapter, we spent some time investigating the physical factors affecting microbial growth. For example, temperature affects an enzyme’s reaction rate, which slows down the further temperature deviates from the optimal. Since most enzymes are proteins, they are sensitive to changes in temperature; indeed, high temperature can denature a protein, perhaps bringing metabolism to a sudden halt. We also discussed pH and how it affects microbial growth. Again, an increase or decrease in protons (H+) will interfere with an enzyme’s reaction rate, extreme change leading to not only enzyme denaturation, but to enzyme and metabolic inhibition. In addition, chemicals applied “environmentally” may inhibit enzyme action. Alcohols and phenol inactivate enzymes and precipitate proteins, making these chemical agents effective antiseptics or disinfectants (Chapter 7). Other natural chemicals interfere with enzyme action (e.g., penicillin) or with a cell’s ability to carry out a critical enzyme reaction (e.g., sulfa drugs), making these agents effective antibiotics (Chapter 24). Enzyme Inhibition through Pathway Modulation. The same chemical reaction does not occur in a cell all the time, even if the substrate is present. Rather, cells regulate the enzymes so that they are present or active only at the appropriate time during metabolism. One of the most common ways of modulating enzyme activity is for the final end product of a metabolic pathway to inhibit an enzyme in that pathway ( FIGURE 6.4B ). If the first enzyme in the pathway is inhibited, then no product is available as input for the rest of the pathway. Such feedback inhibition is typical of many metabolic pathways in cells. In general, when the final end product or any molecule binds to a non-active site on the enzyme, the shape of the active site changes and can no longer bind substrate. This type of modulation is referred to as noncompetitive inhibition. Another way of modulating an enzyme is by blocking its active site so the normal substrate cannot bind. Such competitive inhibition occurs in the following way ( FIGURE 6.4C ). If a molecule resembles the normal substrate, it binds reversibly to the active site, competing with the normal sub-
62582_CH06_158_188.pdf 163
(A) (a)
(C) (c)
Competitive inhibitor
163
(B) (b)
Initial substrate
Active site Enzyme 1
Enzyme 1
Competitive inhibition
Enzyme 1
Noncompetitive inhibition Feedback inhibition
Intermediate A
Enzyme 2
Enzyme 2
Enzyme 2
Intermediate B
Enzyme 3
Enzyme 3
Enzyme 3
Final end product FIGURE 6.4 Metabolic Pathways and Enzyme Inhibition. (A) In a metabolic pathway, a series of enzymes transforms an initial substrate into a final end product. (B) If excess final end product accumulates, it “feeds back” on the first enzyme in the pathway and inhibits the enzyme by binding at another site on the enzyme. (C) In competitive inhibition, a substrate that resembles the normal substrate competes with the substrate for the enzyme’s active site. Competitive inhibition would reduce the productivity of the metabolic pathway by slowing down or stopping the pathway. In both (B) and (C), the whole pathway can become temporarily inoperative. »» Hypothesize why most substrates cannot be converted into a final end product in one enzymatic step.
strate for the active site. Sitting in the active site, this competitive inhibitor cannot be converted to product and does not allow the normal substrate to bind. The dogma in biology used to say that all enzymes were proteins. Although this statement usually is true, there are cases where ribonucleic acid (RNA) can have catalytic effects (MICROFOCUS 6.2). CONCEPT AND REASONING CHECKS
6.4 Describe how an enzyme could be modulated by competitive and noncompetitive inhibition.
2/4/10 2:19 PM
164
CHAPTER 6
Metabolism of Microorganisms
6.2: History/Biotechnology
Ribozymes—Telling Us about Our Past and Helping with Our Future Until the 1980s, one of the bedrock principles of biology held that nucleic acids (DNA and RNA) were the informational molecules responsible for directing the metabolic reactions in the cell. Proteins, specifically the enzymes, were the workhorses responsible for catalyzing the thousands of chemical reactions taking place in the cell. The dogma was, “All enzymes are proteins.” In 1981, new research evidence suggested that RNA molecules could act as catalysts in certain circ*mstances. Today, scientists believe RNA acting by itself can trigger specific chemical reactions. The seminal research on RNA was performed independently by Thomas R. Cech of the University of Colorado and Sidney Altman of Yale University. Altman had found an unusual enzyme in some bacterial cells, an enzyme composed of RNA and protein. Initially, he thought the RNA was a contaminant, but when he separated the RNA from the protein, the bacterial enzyme could not function. After several years, Altman and his colleagues showed that RNA was the enzyme’s key component because it could act alone. At about the same time, Cech discovered that RNA molecules from Tetrahymena, a protozoan, could catalyze certain reactions under laboratory conditions. He showed that a molecule of RNA could cut internal segments out of itself and splice together the remaining segments. Many biologists responded to the findings of Cech and Altman with disbelief. The implication of the research was that proteins and nucleic acids are not necessarily interdependent, as had been assumed. The research also opened the possibility that RNA could have evolved on Earth without protein. In fact, a number of scientists have proposed the hypothesis that life may have started in a primeval “RNA world.” This world would have been swarming with self-catalyzing forms of RNA having the ability to reproduce and carry genetic information. In essence, there arose a whole new way of imagining how life might have begun. The Nobel Prize committee was equally impressed. In 1989, it awarded the Nobel Prize in Chemistry to Cech and Altman. By 1990, these self-reproducing molecules of RNA had a name—ribozymes. They share many similarities with their protein counterparts, including the presence of binding pockets that, like active sites on enzymes, recognize specific molecular shapes. Biochemists at Massachusetts General Hospital showed that one type of ribozyme could join together separate short nucleotide segments. The research was a step toward designing a completely self-copying RNA molecule. Today, the understanding of catalytic ribozymes goes beyond the research laboratory. Several companies are using new molecular techniques to construct new catalytic ribozymes in what is termed “directed evolution.” Development of these ribozymes may have uses in clinical diagnostics and as therapeutic agents. For example, in diagnostic applications, ribozymes are being developed to identify potential new drugs. Other companies are using ribozymes as biosensors to detect viral contaminants in blood. These catalytic molecules also may be useful in fighting infectious diseases by inactivating RNA molecules in viruses or other pathogens. So, ribozymes have much to offer in understanding our very distant past as well as providing for a healthier future.
Energy in the Form of ATP Is Required for Metabolism KEY CONCEPT
5.
ATP is the universal energy currency in cells.
In many metabolic reactions, energy is needed, along with enzymes, for the reactions to oc cur. The cellular “energy currency” is a compound called adenosine triphosphate (ATP) ( FIGURE 6.5A ). In bacterial and archaeal cells, the ATP is formed on the cell membrane, while in eukaryotes the reactions occur primarily in the mitochondria. An ATP molecule acts like a por-
62582_CH06_158_188.pdf 164
table battery. It provides the needed energy for activities such as binary fission, flagellar motion, active transport, and spore formation. On a more chemical level, it fuels protein synthesis and carbohydrate breakdown. It is safe to say that a major share of microbial functions depends on a continual supply of ATP. Should the supply be cut off, the cell dies very quickly, as ATP cannot be stored. ATP molecules are relatively unstable. In Figure 6.5A, notice that the three phosphate groups all have negative charges on an oxygen atom. Like charges repel, so the phosphate groups in ATP, being tightly packed together, are very
2/4/10 2:19 PM
6.1 Enzymes and Energy in Metabolism
H
H N
Adenine
C
N H
165
C
N
C C
C
N
H
N
O–
H
O–
O–
P—O
P — O–
O
O
O C— O — P — O C H
C H
H
C
C
OH
O
H H
Phosphate groups
OH
Ribose
(A) (a) Adenosine
P Synthesis
P
P
ATP (Adenosine triphosphate)
Hydrolysis
P Energy Energy
P
P
P
ADP (Adenosine diphosphate) (b) (B)
X
X— P
(inactive)
(active)
Adenosine Triphosphate and the ATP/ADP Cycle. Adenosine triphosphate (ATP) is a key immediate energy source for all microbial cells and other living things. (A) The ATP molecule is composed of adenine and ribose bonded to one another and to three phosphate groups. (B) When the ATP molecule breaks down, it releases a phosphate group and energy, and becomes adenosine diphosphate (ADP). The freed phosphate can activate another chemical reaction through phosphorylation. For the synthesis of ATP, energy and a phosphate group must be supplied to an ADP molecule. »» What genetic molecule closely resembles ATP? FIGURE 6.5
unstable. Breaking the so-called “high-energy bond” holding the last phosphate group on the molecule produces a more stable adenosine diphosphate (ADP) molecule and a free phosphate group ( FIGURE 6.5B ). ATP hydrolysis is analogous to a spring compacted in a box. Open the box (hydrolyze the phosphate group) and you have a more stable spring (a more stable ADP molecule). The release of the spring (the freeing of a phosphate group) provides the means by which work can be done. Thus, the hydrolysis of the unstable phosphate groups in ATP molecules to a more stable condition is what drives other energy-requiring reactions through the transfer of
62582_CH06_158_188.pdf 165
phosphate groups (Figure 6.5B). The addition of a phosphate group to another molecule is called phosphorylation. Because ATP molecules are unstable, they cannot be stored. Therefore, microbial cells synthesize large organic compounds like glycogen or lipids for energy storage. As needed, the chemical energy in these molecules can be released in catabolic reactions and used to reform ATP from ADP and phosphate (Figure 6.5B). This ATP/ADP cycle occurs continuously in cells. It has been estimated that a typical bacterial cell must reform about 3 million ATP molecules per second from ADP and phosphate to supply its energy needs.
2/4/10 2:19 PM
166
CHAPTER 6
Metabolism of Microorganisms
A
Energyreleasing reaction ATP
Enzyme A P B
Energyrequiring reaction
ADP
P Enzyme B
P
Energyrequiring reaction
Energyreleasing reaction
C FIGURE 6.6 A Metabolic Pathway Coupled to the ATP/ADP Cycle. In this metabolic pathway, enzyme A catalyzes an energy-requiring reaction where the energy comes from ATP hydrolysis. Enzyme B converts the phosphorylated substrate to the end product. Being an energy-releasing reaction, the free phosphate can be coupled to the reformation of ATP. »» What are the terms for energy-requiring and energy-releasing reactions?
6.2
Glucose Contains Stored Energy That Can Be Extracted KEY CONCEPT
Mole: The molecular weight of a substance expressed in grams. Calories: Units of energy defined in the amount of heat required to raise one gram of water 1°C.
62582_CH06_158_188.pdf 166
CONCEPT AND REASONING CHECKS
6.5 Judge the importance of the ATP cycle to microbial metabolism.
The Catabolism of Glucose
Since the early part of the twentieth century, the chemistry of glucose catabolism has been the subject of intense investigation by biochemists because glucose is a key source of energy for ATP production. Moreover, the process of glucose catabolism is very similar in all organisms, making this “metabolic interlock” one feature that unites all life.
6.
It might be a good idea to review what we have covered to this point, which is summarized in FIGURE 6.6 . Enzymes regulate metabolic reactions by binding an appropriate substrate at its active site. Often a series of metabolic steps (metabolic pathway) are required to form the final product. Some steps in the pathway may require energy (endergonic); this energy is supplied by ATP as it is hydrolyzed to ADP. Other reactions release energy (exergonic), which may be used to reform ATP from ADP.
Glucose is a primary source for generating ATP.
A mole of glucose (180 g) contains about 686,000 calories of energy. This fact can be demonstrated in the laboratory by setting fire to a mole of glucose and measuring the energy released. In a cell, however, not all the energy is set free from glucose, nor can the cell trap all that is released. The process accounts for the transfer of about 40% of the glucose energy to ATP energy; that is, chemical energy to cellular energy. Virtually all cells make ATP by harvesting energy from exergonic metabolic pathways, such as the hydrolysis of food molecules. Such a process is called cellular respiration. If cells consume oxygen in making ATP, the process is called aerobic respiration. In other instances, cells can make almost equally substantial amounts of ATP without using oxygen, in which case it is called
anaerobic respiration. In these instances, another inorganic molecule will replace oxygen. A form of “anaerobic metabolism” is fermentation, which we will examine later in this chapter. The catabolism of glucose or another molecule does not take place in one chemical reaction, nor do ATP molecules form all at once. Rather, the energy in glucose is extracted and transferred slowly to ATP through metabolic pathways ( FIGURE 6.7 ). It is similar to the proverb quoted at the beginning of this chapter, “Life is like a fire; it begins in smoke and ends in ashes.” The catabolism of glucose starts with a little energy being converted to ATP (the smoke), which builds to a point where large amounts of energy are converted to ATP (the fire), and the original glucose molecule has been depleted of its useful energy (the ashes). To begin our study of cellular respiration, we shall follow the process of aerobic respiration as it occurs in obligate aerobes. The process is represented in the following summary form: C6H12O6 + 6 O2 + 38 ADP + 38 P Glucose
Oxygen ↓
6 CO2 + 6 H2O + 38 ATP Carbon Water dioxide
2/4/10 2:19 PM
6.2 The Catabolism of Glucose
The events summarized in the overall reaction are conveniently divided into three stages: glycolysis, the citric acid cycle, and oxidative phosphorylation. Let’s examine each of these in sequence. To simplify our discussion of glucose catabolism, we shall follow the fate of one glucose molecule.
167
Glucose
(a) Glycolysis Oxidizes glucose to pyruvate
NADH
CONCEPT AND REASONING CHECKS
6.6 In the summary equation for cellular respiration, identify where in the products each of the substrate atoms ends up.
ADP H 2O
Acids, alcohols, gasses
ATP Pyruvate
Glycolysis Is the First Stage of Energy Extraction
CO 2
Glycolysis is a metabolic pathway yielding ATP and NADH.
The splitting of glucose, called glycolysis (glyco = “sweet”), occurs in the cytosol of all microorganisms and involves a metabolic pathway that converts an initial 6-carbon substrate, glucose, into two 3-carbon molecules called pyruvate. Between glucose and pyruvate, there are eight intermediates formed, each catalyzed by a specific enzyme. FIGURE 6.8 illustrates the process. For easy referral, numbers in circles identify each reaction, and it would be helpful to refer to the figure as the discussion proceeds. The first part of glycolysis is endergonic; one molecule of ATP is hydrolyzed (consumed) in reaction (1) and a second in reaction (3). In both cases, the phosphate group from ATP attaches to the product. Thus, reaction (1) produces glucose6-phosphate, and reaction (3) yields fructose-1,6bisphosphate (bis means “two separate;” that is, two separate phosphate molecules). After the splitting of fructose-1,6-bisphosphate into two 3-carbon molecules, each passes through an additional series of conversions that ultimately form pyruvate. During reactions (7) and (10), ATP is generated. In both exergonic steps, enough energy is released to synthesize an ATP molecule from ADP and phosphate, resulting in a total of four ATP molecules. Because these ATP molecules were the result of the transfer of a phosphate from a substrate to ADP, we say these ATP molecules were the result of substrate-level phosphorylation. Considering two ATP molecules were consumed in reactions (1) and (3), the net gain from glycolysis is two molecules of ATP.
62582_CH06_158_188.pdf 167
NADH
Acetyl CoA
KEY CONCEPT
7.
(b2) Fermentation Reduces pyruvate to an end product
(b1) Transition Step Converts pyruvate to acetyl CoA
(d) Electron Transport System Takes electrons from NADH and FADH2 to power ATP synthesis (c) Citric Acid Cycle Uses acetyl CoA and releases CO2
CO 2
NADH H 2O
ADP
ADP ATP
FADH2
ATP
Cellular Respiration
FIGURE 6.7 A Metabolic Map of Aerobic and Anaerobic Pathways for ATP Production. The production of ATP by microorganisms can be achieved through glycolysis (a) following a cellular respiration pathway (b1, c, d) or fermentation pathway (b2). »» Using this map, show how “Life is like a fire; it begins in smoke and ends in ashes.”
Before we proceed, take note of reaction (6). This enzymatic reaction releases two highenergy electrons and two protons (H+), which are picked up by the coenzyme NAD+, reducing each to NADH. This and similar events will have great significance shortly as an additional source to generate ATP.
Reducing (reduction): Referring to the process of a substance gaining electron pairs.
CONCEPT AND REASONING CHECKS
6.7 At the end of glycolysis, where is the energy that was originally in glucose?
The Citric Acid Cycle Extracts More Energy from Pyruvate KEY CONCEPT
8.
The citric acid cycle yields additional ATP and NADH, as well as FADH2.
2/4/10 2:19 PM
168
CHAPTER 6
Metabolism of Microorganisms
Glucose
C C C C C C ATP
HOH2C
1
Metabolic map key
OH H C
H C
C H
H C
CHO
OH
OH OH
ADP
Preparatory Reactions of Glycolysis • Two ATP molecules are used to phosphorylate glucose (1) and fructose6-phosphate (3); • Fructose-1,6-bisphosphate is then split into two 3-carbon intermediates (4); • The DHAP is converted into another G3P (5).
C C C C C C P
Glucose-6-phosphate
2 C C C C C C P ATP
Fructose-6-phosphate
3
ADP P C C C C C C P
Dihydroxyacetone phosphate (DHAP)
4
Split of F-1,6-P
Fructose-1,6-bisphosphate
C C C P
5
Glyceraldehyde-3P C C C phosphate (G3P) P C C C NAD+ To electron transport
NADH
P
2H+
P
2e
2H+ 2e
6
NAD+ NADH
1,3-bisphosphoglycerate
To electron transport
P C C C P
P C C C P
ADP
ADP 7 ATP
ATP 3-phosphoglycerate P C C C
P C C C 8
C C C
2-phosphoglycerate
C C C P
P 9
H2O
H2 O
Energy Harvesting Reactions of Glycolysis • Two protons (H+) and two electrons are removed from each G3P and used in the formation of 2NADH coenzymes (6); • Substrate-level phosphorylation of ADP occurs, forming four molecules of ATP (7, 10); • Two molecules of pyruvate are the final end product of glycolysis (10).
C C C Phosphoenolpyruvate C C C P P ADP
ADP 10
ATP
ATP C C C
Pyruvate O H3C
C
C C C
COO–
FIGURE 6.8 The Reactions of Glycolysis. Glycolysis is a metabolic pathway that converts glucose, a 6-carbon sugar, into two 3-carbon pyruvate products. In the process, two NADH coenzymes and a net gain of two ATP molecules occur. Carbon atoms are represented by circles. The dark circles represent carbon atoms bonded to phosphate groups. »» How many substrate-level phosphorylation events occurred during glycolysis?
62582_CH06_158_188.pdf 168
2/4/10 2:19 PM
6.2 The Catabolism of Glucose
The citric acid cycle (also called the Krebs cycle in honor of Hans Krebs and colleagues who worked out the pathway) is a series of chemical reactions that are referred to as a cycle because the end product formed is used as one substrate to initiate the pathway. All of the reactions are catalyzed by enzymes, and all take place along the cell membrane of bacterial and archaeal cells. In eukaryotic microbes, including the protozoa, algae, and fungi, the cycle occurs in the mitochondria. The citric acid cycle is somewhat like a constantly turning wheel. Each time the wheel comes back to the starting point, something must be added to spin it for another rotation. That something is the pyruvate molecule derived from glycolysis. FIGURE 6.9 shows the citric acid cycle. The reactions are identified by capital letters in circles to guide us through the cycle. Before pyruvate molecules enter the cycle, they undergo oxidation, indicated in reaction (A). An enzyme removes a carbon atom from each of the two pyruvate molecules and releases the carbons as two carbon dioxide molecules (2 CO2). The remaining two carbon atoms of pyruvate are combined with coenzyme A (CoA) to form acetyl-CoA. Equally important, the lost electrons from pyruvate, along with two protons are transferred to NAD+ to form NADH. The two remaining carbons from pyruvate are now ready to enter the citric acid cycle. In reaction (B), each acetyl-CoA unites with a 4-carbon oxaloacetate to form citrate, a 6-carbon molecule. (Citrate, or citric acid, may be familiar to you as a component of soft drinks.) Citrate undergoes a series of reactions (C, D), forming a 4-carbon succinate. The two last carbons from glucose are released as CO2. Succinate then undergoes a series of modifications (reactions E, F, and G) reforming oxaloacetate. The cycle is now complete, and oxaloacetate is ready to unite with another molecule of acetyl-CoA. Several features of the cycle merit closer scrutiny. First, we shall follow the carbon. Pyruvate, with three carbon atoms, emerges from glycolysis, but after one turn of the cycle, its carbon atoms exist in three molecules of CO2. There are two molecules of pyruvate from glycolysis, so when the second molecule enters the cycle, its carbon atoms also will form three CO2 molecules. Remember that we began with a 6-carbon glucose molecule;
62582_CH06_158_188.pdf 169
169
six CO2 molecules now have been produced. This fulfills part of the equation for aerobic respiration: C6H12O6 + 6 O2 + 38 ADP + 38 P ↓ 6 CO2 + 6 H2O + 38 ATP
The second feature of the cycle is reaction (D). Here a molecule of ATP forms. Because we have two pyruvate molecules entering the cycle (per molecule of glucose), a second ATP molecule will form from GTP when the second pyruvate passes through the cycle. Last, and perhaps of most importance, are reactions C, D, E, and G. Reactions C, D, and G, like reaction 6 in glycolysis and the transition step, are associated with NAD+ and again are reduced to NADH. Two NADH molecules are produced in each step for a total of six. In addition, reaction E accomplishes much of the same result except it is associated with another coenzyme, FAD. It too receives two electrons and two protons from the reaction, being reduced to FADH2. For the two pyruvate molecules starting the process, two FADH2 molecules are formed. In summary, glycolysis and the citric acid cycle have extracted as much energy as possible from glucose and pyruvate ( FIGURE 6.10 ). This has amounted to a small gain of ATP molecules formed from one glucose molecule. However, the 10 NADH and 2 FADH2 molecules formed are most significant. Let’s see how.
Oxidation: The process of removing electron pairs from a substance.
CONCEPT AND REASONING CHECKS
6.8 Identify the initial substrates and final end products of the citric acid cycle.
Oxidative Phosphorylation Is the Process by Which Most ATP Molecules Form KEY CONCEPT
9.
NADH and FADH2 provide the starting materials for oxidative phosphorylation.
Oxidative phosphorylation refers to a sequence of reactions in which two events happen: Pairs of electrons are passed from one chemical substance to another (electron transport), and the energy released during their passage is used to combine phosphate with ADP to form ATP (ATP synthesis). The adjective “oxidative” is derived from the term
2/4/10 2:19 PM
170
CHAPTER 6
Metabolism of Microorganisms
Coenzyme A Pyruvate
Metabolic map key
Transition Step • Each pyruvate is converted into an acetyl CoA as CO2 is liberated and two NADH are formed (A); • Each acetyl CoA combines with an oxaloacetate to form citrate (B). Acetyl-CoA (C2)
CO2
HS-CoA S
CoA
A NAD+
2H+ 2e
B Citrate (6C)
NADH Oxaloacetate (4C)
G
To electron transport
NADH
2H+ 2e
NAD+
NADH To electron transport
Malate (4C)
Isocitrate (6C) NAD+
2H+ 2e
C
C
CO2
F H2O
2H+ 2e
FADH2 FAD
2H+ 2e
NADH NAD+
Fumarate (4C) CO2 Citric Acid Cycle (Part B) • Succinate is restructured into oxaloacetate (E–G); • Electrons and protons from these intermediates are used in the formation of FADH2 (E) and NADH (G).
ATP
E
Succinate (4C)
ADP D
Alpha-ketoglutarate (5C)
Citric Acid Cycle (Part A) • Citrate is converted into succinate as carbons are liberated as CO2 (C and D); • Electrons and protons from these intermediates are used in the formation of NADH; • Substrate-level phosphorylation of ADP occurs to form ATP (D) [some microbes phosphorylate GDP to GTP].
FIGURE 6.9 The Reactions of the Citric Acid Cycle. Pyruvate from glycolysis combines with coenzyme A to form acetyl-CoA (transition step). This molecule then joins with oxaloacetate to form citrate (citric acid cycle—Part A). Each turn of the cycle releases CO2, produces ATP, and forms NADH and FADH2 coenzymes as oxaloacetate is replaced (citric acid cycle—Part B). »» Why are so many reactions required to extract energy out of pyruvate?
62582_CH06_158_188.pdf 170
2/4/10 2:19 PM
6.2 The Catabolism of Glucose
oxidation, which, as defined earlier, refers to the loss of electron pairs from molecules. Its counterpart is reduction, which refers to a gain of electron pairs by molecules. Phosphorylation, as we already have seen, implies adding a phosphate to another molecule. So, in oxidative phosphorylation, the loss and transport of electrons will enable ADP to be phosphorylated to ATP. Oxidative phosphorylation takes place at the cell membrane in bacterial and archaeal cells and in the mitochondrial inner membrane of eukaryotic microbes. Oxidative phosphorylation is responsible for producing 34 molecules of ATP per glucose. The overall sequence involves the NAD+ and FAD coenzymes that underwent reduction to NADH and FADH2 during glycolysis and the citric acid cycle; remember, they gained two electrons in those metabolic pathways. In oxidative phosphorylation, the coenzymes will be reoxidized by transferring those two electrons to a series of electron carriers ( FIGURE 6.11 ). These carriers, called cytochromes (cyto = “cell”; chrome = “color”), are a set of proteins containing iron cofactors that accept and release electron pairs. Together, the cytochrome complexes (I–IV) form an electron transport chain. The last link in the chain is oxygen gas. In the oxidative phosphorylation process shown in Figure 6.11, the two electrons with each NADH and FADH2 are passed to cytochrome complex I in the chain (A). The reoxidized coenzymes, NAD+ and FAD, return to the cytosol (B) to be used again in glycolysis or the citric acid cycle. Like walking along stepping stones, each electron pair is passed from one cytochrome complex to the next down the chain (C) until the electron pair is finally transferred from complex IV to oxygen. Oxygen also acquires two protons (4 H+) from the cytosol (D) and becomes water (2 H2O). Oxygen’s role is of great significance because if oxygen were not present, there would be no way for cytochromes to unload their electrons and the entire system would soon back up like a jammed conveyer belt and come to a halt. Oxygen’s role also is reflected in the equation for aerobic respiration: C6H12O6 + 6 O2 + 38 ADP + 38 P ↓ 6 CO2 + 6 H2O + 38 ATP
62582_CH06_158_188.pdf 171
171
Glycolysis Glucose 2 ATP 2 NADH 4 ATP
2 Pyruvate
2 CO2
2 NADH
Transition step
Acetyl-CoA
2 CO2
2 NADH Citric acid cycle
2 ATP 2 FADH2
2 NADH 2 CO2 2 NADH
FIGURE 6.10 Summary of Glycolysis and the Citric Acid Cycle. Glycolysis and the citric acid cycle are metabolic pathways to extract chemical energy from glucose to generate cellular energy (ATP). »» Every time one glucose molecule is broken down to CO2 and water, how many ATP, NADH, and FADH2 molecules are gained?
So, what is the importance of the electron transport chain because no ATP has been made? The actual mechanism for ATP synthesis comes from the pumping of protons by a process called chemiosmosis (osmos = “push”). First proposed by Nobel Prize–winner Peter Mitchell, chemiosmosis uses the power of proton movement across a membrane to conserve energy for ATP synthesis. What happens in chemiosmosis also is shown in Figure 6.11. As the electrons pass between cytochrome complexes, the electrons gradually lose energy. The energy, however, is not lost in the sense that it is gone forever. Instead, the energy is used at three transition points to “pump” protons (H+) across the membrane from the cytosol to
2/4/10 2:20 PM
172
CHAPTER 6
Metabolism of Microorganisms
Electron Transfer • Electrons in each NADH and FADH2 from glycolysis, transition, and citric acid cycle reactions are transferred to the electron transport chain (A); • Reduced coenzymes can be reused (B). Electron Transport
NADH FADH2
ATP Synthesis
NAD+ FAD+
2 H 2O
B
H+
H+ H+
4 H+
G
D H+ Electron pair A
H+
Protons H+ + H+ H
H+
H+ C
I
Cytochromes II
Pumped protons + H+ H + H+ H
III
IV
Electron transport chain H+ H+
H+ H+
E
ATP
ADP + P O2 Electrons
H+
Cell membrane
ATP synthase
F H+ H + H+ H+
Chemiosmosis • As the protons (E) move through the ATP synthase (F), their energy is used to drive the synthesis of ATP (G).
+ H+ H
H+
Metabolic map key
Outside cell membrane Electron Transport • Energy from pairs of electrons moving through the electron transport chain pump protons (H+) from the cytoplasm, across the cell membrane, to the outside (C); • Electrons at the end of the chain combine with oxygen and protons to form water (D). FIGURE 6.11 Oxidative Phosphorylation in Bacterial Cells. (A) Originating in glycolysis and the citric acid cycle, coenzymes NADH and FADH2 transport electron pairs to the electron transport chain in the cell membrane, which fuels the transport of protons (H+) across the cell membrane. Protons then reenter the cytosol through a protein channel in the ATP synthase enzyme. ADP molecules join with phosphates as protons move through the channel, producing ATP. »» What would happen to the oxidative phosphorylation process if this cell were deprived of oxygen?
the area outside of the cell membrane (E). Soon a large number of protons have built up outside the membrane, and because they cannot easily reenter the cell, they represent a large concentration of potential energy (much like a boulder at the top of a hill). The protons are positively charged, so there also is a buildup of charges outside the membrane.
62582_CH06_158_188.pdf 172
Suddenly, a series of channels opens and the proton flow reverses (F). Each “channel” is contained within a large, membranespanning enzyme complex called ATP synthase, which has binding sites for ADP and phosphate. As the protons rush through the channel, they release their energy, and the energy is used to synthesize
2/4/10 2:20 PM
6.3 Other Aspects of Catabolism
ATP molecules from ADP and phosphate ions (G), as MICROINQUIRY 6 explains. Three molecules of ATP can be synthesized for each pair of electrons originating from NADH; two molecules of ATP are produced for each pair of electrons from FADH2 because the coenzyme interacts further down the chain. MICROFOCUS 6.3 highlights a novel way of using the bacterial respiratory process to generate electricity. If the cell membrane is damaged so chemiosmosis cannot take place, the synthesis of ATP ceases and the organism rapidly dies. This is one reason why damage to the bacterial cell membrane, such as with antibiotics or detergent disinfectants, is so harmful. The ATP yield from aerobic respiration is summarized in FIGURE 6.12 . The reactions can generate up to 38 ATP molecules from one glucose molecule. It also completes the equation for aerobic respiration: C6H12O6 + 6 O2 + 38 ATP + 38 P ↓ 6 CO2 + 6 H2O + 38 ATP CONCEPT AND REASONING CHECKS
6.9 Why are NADH and FADH2 so critical to cell energy metabolism?
6.3
173
GLYCOLYSIS
2 ATP
Glucose 2 NADH 4 ATP
6 ATP Net gain from glycolysis 2 ATP
Pyruvate 2 NADH Acetyl-CoA
Citric acid cycle
6 ATP
2 CO2
2 ATP
2 ATP
6 NADH
18 ATP
2 FADH2
4 ATP
(2 turns)
4 CO2 TOTAL
38 ATP
FIGURE 6.12 The ATP Yield from Aerobic Respiration. In a microbial cell, 38 molecules of ATP can result from the metabolism of a molecule of glucose. Each NADH molecule accounts for the formation of three molecules of ATP; each molecule of FADH2 accounts for two ATP molecules. »» From this diagram, what is the single most important reactant for ATP synthesis?
Other Aspects of Catabolism
The catabolism of glucose is a process central to the metabolism of all organisms as it provides a glimpse of how organisms obtain energy for life. In this section, we examine how cells obtain energy from other organic compounds (fats and proteins) by directing those compounds into the process of cellular respiration. We also discover how modifications to cellular respiration and glucose metabolism allow anaerobic organisms to use glucose and generate ATP without having oxygen gas as the final electron acceptor in electron transport. Other Nutrients Represent Potential Energy Sources KEY CONCEPT
10. Other carbohydrates as well as fats and proteins can supply chemical energy for ATP production.
62582_CH06_158_188.pdf 173
A wide variety of monosaccharides, disaccharides, and polysaccharides serve as useful energy sources. All must go through a series of preparatory conversions before they are processed in glycolysis, the citric acid cycle, and oxidative phosphorylation. In preparation for entry into the scheme of metabolism, different carbohydrates use different pathways ( FIGURE 6.13 ). Sucrose, for example, is first digested by the enzyme sucrase into its constituent molecules, glucose and fructose. The glucose molecule enters the glycolysis pathway directly, but the fructose molecule first is converted to fructose-1-phosphate. The latter then undergoes further conversions and a molecular split before it enters the scheme as DHAP [reaction (4)]. Lactose, another disaccharide, is broken in two by the enzyme lactase to glucose and
2/4/10 2:20 PM
174
CHAPTER 6
Metabolism of Microorganisms
INQUIRY 6
The Machine That Makes ATP Every day, an adult human weighing 160 pounds uses up about 80 pounds of ATP (about half of his or her weight). The ATP is changed to its two breakdown products, ADP and phosphate, and enormous amounts of energy are made available to do metabolic work. However, the body’s weight does not go down, nor does it change perceptibly because the cells are constantly regenerating ATP from the breakdown products. Discovering how this is accomplished and how the recycling works were the seminal achievements of 1997’s Nobel Prize winners in Chemistry. The Chemiosmotic Basis for ATP Synthesis One of the three 1997 winners was Paul D. Boyer at the University of California at Los Angeles. Boyer’s work expanded the pioneering work of Peter Mitchell, who developed the concept of chemiosmosis. Chemiosmosis proposes that electron transport between cytochrome complexes provides the energy to “pump” protons (H+) across the membrane; in the case of bacterial and archaeal cells, this is from the cytosol to the environment. As explained in the text, this proton gradient
provides the force or potential to drive the protons back into the cell through an enzyme called ATP synthase. This flow of rapidly streaming H+ brings together ADP and phosphate to form ATP. How Does Proton Flow Cause ATP Synthesis? The groundbreaking research as to how the ATP synthase works came from studies with Escherichia coli cells. Today, we know that the ATP synthase consists of two polypeptide complexes (see Figure A). The headpiece (F1) faces into the cytosol and consists of nine polypeptides of five different types (α, β, γ, ε, and δ) and represents the catalytic complex for converting ADP + P to ATP. The basal unit (F0) is embedded in the cell membrane and consists of 15 polypeptides of three different types (a, b, and c). The basal unit contains the proton-transporting channel through the membrane. So, an ATP synthase consists of 24 polypeptides—a veritable nanomachine. Boyer took the three complexes and hypothesized how they could manufacture ATP. His ideas plus newer findings have been merged into the current model (see Figure B):
1. The flow of protons through the basal unit c proteins causes the basal unit to spin (somewhat similar to the turning of a waterwheel). 2. The γ and ε polypeptides in the headpiece also spin and, as they spin, δ makes contact with each of the β subunits. 3. Each β subunit changes shape, and like an enzyme’s active site, allows the subunit to bind an ADP + P and catalyze the production of an ATP. 4. When a β subunit returns to its original shape, it releases the ATP. Because there are three β subunits in the headpiece, three ATP molecules are produced each time the basal unit and the γ and ε polypeptides make one complete rotation. Discussion Point Ribosomes, flagella, and ATP synthase all represent “nanomachines” to carry out specific functions in cells. Discuss the concept of a bacterial cell as being an assemblage of nanomachines.
Cytosol α β α δ
ATP
β ADP + P
b
α
β
γ
H+
Headpiece (F1)
ε
a
Basal unit (F0)
Rotation c H+
H+
Outside of cell ATP synthesis
62582_CH06_158_188.pdf 174
H+
Cell membrane FIGURE A A bacterial ATP synthase enzyme consists of 24 polypeptides in 2 complexes, the basal unit embedded in the cell membrane and the headpiece that projects into the cytosol.
2/4/10 2:20 PM
6.3 Other Aspects of Catabolism
175
ADP + P
β1 β3
A Contact between γ with subunit β1, causes the subunit to bind ADP+P.
γ ATP β2
ADP + P
β1 β3
β3
γ
γ
β2
β2
D Proton transport through the basal unit causes γ and ε to rotate away from β1, which returns to its original shape and releases the ATP molecule.
β1
ATP
ADP + P
β1
β3
β3
γ
β1
B Binding of ADP+P causes the subunit to change shape and tightly bind to ADP+P.
γ
β2 FIGURE B How the flow of protons through the basal unit brings about the ATP synthesis is shown for one of the three β subunits in the headpiece.
β2
C The tight binding state of the β-subunit favors ATP synthesis.
6.3: Biotechnology
Bacteria Not Included How many toys (child or adult) or electronic devices do you purchase each year where batteries are needed to run the device? And often batteries are not included. Today, a new type of battery is being developed—one that converts sugar not into ATP but rather into electricity. The battery is one packed with bacterial cells. Realize that cellular respiration involves the generation of minute electrical currents. During cellular respiration, electrons are transferred to cofactors like NAD+ and then passed along a chain of cytochrome complexes during oxidative phosphorylation. Swades Chaudhuri and Derek Lovely of the University of Massachusetts at Amherst have taken this idea and applied it to developing a new type of fuel cell or battery. The scientists mixed the bacterial species Rhodoferax ferrireducens, which they found in aquifer sediments in Virginia, with a variety of common sugars. When placed in a chamber with a graphite electrode, R. ferrireducens metabolized the sugar, stripped off the electrons, and transferred them directly to the electrode. The result: a current was produced. In addition, the bacterial cells continued to grow, so a stable current could be produced with high efficiency. Although it is still a long way from producing a reliable, long-lasting bacterial battery, researchers believe much of the agricultural or industrial waste produced today could be the “sugar” used in making these bacterial batteries. So, as Sarah Graham reported for Scientific American.com, “Perhaps one day electronics will be sold with the caveat ‘bacteria not included.’ ”
62582_CH06_158_188.pdf 175
2/5/10 1:03 PM
176
CHAPTER 6
Metabolism of Microorganisms
Proteins
Carbohydrates
Amino acids
Monosaccharides
Fats
Glycerol
Fatty acids
Glucose Glycolysis Deaminiation
Beta oxidation G3P ATP Pyruvate CO2 Acetyl-CoA
Citric acid cycle
CO2 ATP
Electrons
Oxidative phosphorylation
ATP O2
H2O FIGURE 6.13 Carbohydrate, Protein, and Fat Metabolism. Besides glucose, other carbohydrates as well as proteins and fats can be sources of energy by providing electrons and protons for cellular respiration. The intermediates enter the pathway at various points. »» Why would more ATP be produced from the products of one fatty acid entering the pathway at acetyl-CoA than from one amino acid entering at acetyl-CoA?
galactose. Galactose undergoes a series of changes before it is ready to enter glycolysis in the form of glucose-6-phosphate [reaction (2)]. Stored polysaccharides, such as starch and glycogen, are metabolized by enzymes that remove one glucose unit at a time and convert it to glucose-1-phosphate. An enzyme converts this compound to glucose-6-phosphate, ready for entry into the glycolysis pathway. The point is that carbohydrates other than glucose also are used as chemical energy sources.
62582_CH06_158_188.pdf 176
The economy of metabolism is demonstrated further when we consider protein and fat catabolism (Figure 6.13). Fats are extremely valuable energy sources because their chemical bonds contain enormous amounts of chemical energy. Although proteins are generally not considered energy sources, cells use them for energy when carbohydrates and fats are in short supply. Both fats and proteins are broken down through glucose catabolism as well as through other pathways. Basically, the proteins and fats undergo a
2/4/10 2:20 PM
6.3 Other Aspects of Catabolism
series of enzyme-catalyzed conversions and form components normally occurring in carbohydrate metabolism. These components then continue along the metabolic pathways as if they originated from carbohydrates. Proteins are broken down to amino acids (see Chapter 2). Enzymes then convert many amino acids to pathway components by removing the amino group and substituting a carbonyl group. This process is called deamination. For example, alanine is converted to pyruvate and aspartic acid is converted to oxaloacetate. For certain amino acids, the process is more complex, but the result is the same: The amino acids become pathway intermediates of cellular respiration. Fats consist of three fatty acids bonded to a glycerol molecule (see Chapter 2). To be useful for energy purposes, the fatty acids are separated from the glycerol by the enzyme lipase. Once this has taken place, the glycerol portion is converted to DHAP. For fatty acids, there is a complex series of conversions called beta oxidation, in which each long-chain fatty acid is broken by enzymes into 2-carbon units. Other enzymes then convert each unit to a molecule of acetyl-CoA ready for the citric acid cycle. We previously noted that for each turn of the cycle, 16 molecules of ATP are derived. A quick calculation should illustrate the substantial energy output from a 16-carbon fatty acid (eight 2-carbon units). In most habitats, microbes can use a large and diverse set of chemical compounds as potential energy sources. When competing for these food resources, some bacterial organisms can “raise a stink” (MICROFOCUS 6.4).
177
bacterial and archaeal organisms exist in environments where oxygen is scarce, such as in wetland soil and water, and within the human and animal digestive tracts. In these environments, the organisms have evolved a respiratory process called anaerobic respiration that relies on terminal, usually inorganic, electron acceptors other than oxygen for ATP production. Considering the immense number of species that live in such anaerobic environments, anaerobic respiration is extremely important ecologically. The facultative species Escherichia coli, for example, uses nitrate (NO3–) with which electrons combine to form nitrite (NO2–) or another nitrogen product. The obligate anaerobe Desulfovibrio uses sulfate (SO42–) for anaerobic respiration. The sulfate combines with the electrons from the cytochrome chain and changes to hydrogen sulfide (H2S). This gas gives a rotten egg smell to the environment (as in a tightly compacted landfill). A final example is exhibited by the archaeal methanogens, Methanobacterium and Methanococcus. These obligate anaerobes use carbonate (CO3) as a final electron acceptor and, with hydrogen nuclei, form large amounts of methane gas (CH4). In anaerobic respiration, the amount of ATP produced is less than in aerobic respiration. There are several reasons for this. First, only a portion of the citric acid cycle functions in anaerobic respiration, so fewer reduced coenzymes are available to the electron transport chain. Also, not all of the cytochrome complexes function during anaerobic respiration, so the ATP yield will be less. The exact amount of ATP produced therefore will depend on the organism and where in the respiratory pathway intermediates enter.
CONCEPT AND REASONING CHECKS
6.10 Describe how lipids and proteins are prepared for entry into the cellular respiration pathway.
Anaerobic Respiration Produces ATP Using Other Final Electron Acceptors KEY CONCEPT
11. ATP can be produced through chemiosmosis without oxygen gas.
Nearly all eukaryotic microbes, as well as multicellular animals and plants, carry out aerobic respiration, using oxygen as the final electron acceptor in the electron transport chain. However, many
62582_CH06_158_188.pdf 177
CONCEPT AND REASONING CHECKS
6.11 Why would obligate anaerobes tend to grow slower than obligate aerobes?
Fermentation Produces ATP Using an Organic Final Electron Acceptor KEY CONCEPT
12. Fermentation generates ATP in the absence of exogenous electron acceptors.
In environments that are anoxic and without the alternative electron acceptors needed by anaerobes, much of the organic material
Anoxic: Without oxygen gas (O2).
2/4/10 2:20 PM
178
CHAPTER 6
Metabolism of Microorganisms
6.4: Environmental Microbiology
Microbes “Raise a Stink” We are all familiar with body odor and bad breath. When one does not maintain a level of cleanliness or hygiene, bacterial species on the skin surface or in the mouth can grow out of proportion and, as they metabolize compounds like proteins, they produce noticeably unpleasant, smelly odors. On a more environmental level, there are the smells that often come from decaying or rotting foods. As decomposers, these microbes also give off foul odors caused by the presence of bacteria colonizing the dead carrion. Competing in the environment with other animal scavengers for food, do these bacteriallyproduced odors have a useful role in repelling or deterring animal species from consuming important food resources? This is what Mark Hay and collaborators at Georgia Institute of Technology wanted to know, especially with respect to marine ecosystems. Their hypothesis: Decaying food resources make these resources repugnant to larger animal species like crabs or fish. To test their hypothesis, the research team baited crab traps near Savannah, Georgia, with menhaden, a typical bait-fish for crabs. Some traps contained microbe-laden menhaden carrion that had been allowed to rot for one or two days, while other traps contained freshly thawed carrion having relatively few microbes. When the traps were inspected, those with fresh carrion had more than twice the number of animals per trap than did the traps with microbe-laden carrion. Lab studies with stone crabs showed they too avoided the microbe-laden, rotting food, but readily consumed the freshly thawed menhaden carrion. To examine the role of bacteria in the avoidance behavior by stone crabs (see figure), some menhaden was allowed to rot in water without the antibiotic chloramphenicol while other samples contained the antibiotic in the water to prevent or inhibit microbial growth. Again, the study observed that the crabs readily ate the antibiotic-incubated menhaden but avoided the menhaden without antibiotic; the bacteria were in some way responsible for the aversion. Finally, the researchers used organic extracts prepared from the microbe-laden carrion and mixed these chemical substances with freshly thawed menhaden. Again, the crabs were repelled. Exactly what chemical compounds were responsible for the behavior were not evident from the study. In summary, it appears that bacteria not only act as decomposers and pathogens in the environment, but also can compete very successfully with relatively large animal consumers for mutually attractive food sources. A stone crab.
will be catabolized through fermentation. Fermentation is the enzymatic process for producing ATP using endogenous organic compounds as both electron donors and acceptors—exogenous electron acceptors (O2, NO3–, SO42–, CO3) are absent. The chemical process of fermentation makes a few ATP molecules in the absence of cellular respiration. However, the citric acid cycle and oxidative phosphorylation are shut down, so the products of glycolysis (pyruvate) are shuttled through a pathway that produces other final end products. In these pathways, pyruvate is the intermediary accepting the electrons.
62582_CH06_158_188.pdf 178
In all cases, no matter what the end product, fermentation ensures a constant supply of NAD+ for glycolysis and the production of two ATP molecules per glucose ( FIGURE 6.14A ). For example, in the fermentation of glucose by Streptococcus lactis, the conversion of pyruvate to lactic acid is a way to reform NAD+ coenzymes so glycolysis can still make two ATP molecules for every glucose molecule consumed ( FIGURE 6.14B ). The diversity of fermentation chemistry extends to some eukaryotic microbes as well. In yeasts like Saccharomyces, when pyruvate is converted to ethyl alcohol (ethanol), NAD+ is reformed.
2/4/10 2:20 PM
6.3 Other Aspects of Catabolism
(A)
Glucose
2 NAD+
2 P + 2 ADP
2 ATP 2 NADH
2 NAD+
179
Metabolic map key
Fermentation • In the absence of an inorganic final electron acceptor for electron transport, through the formation of pyruvate, glucose is fermented into a variety of end products; • As a result, NADH is reoxidized to NAD+, which is essential for glycolysis and producing 2 ATP.
Pyruvate
Lactobacillus Streptococcus
Lactic acid (B)
Saccharomyces
Escherichia
Enterobacter
Propionibacterium
Clostridium
Ethanol, CO2
Acid end products, CO2
Neutral end products, CO2
Propionic and acetic acid, CO2
Butyric acid, butanol, acetone, CO2
Industrial solvents
Enteric bacterial species
Diary products Alcoholic beverages
Fermentation End Products • Different microorganisms have evolved a variety of metabolic pathways generating large amounts of end products that do not directly produce ATP; • Some microbial fermentation pathways have been controlled and are extremely useful to human culture and industry. • Other end products are useful in the identification of bacterial species, including enteric pathogens.
Cheeses
(C)
E. aerogenes E.coli Methyl red test
E. coli E. aerogenes Voges-Proskauer test
Microbial Fermentation. (A) Fermentation is an anaerobic process that reoxidizes NADH to NAD+ by converting organic materials into fermentation end products (B). Fermentation end products also provide a way to help identify bacterial species (C). »» How are lactic acid and alcohol fermentation identical in purpose? FIGURE 6.14
The energy benefits to fermentative organisms are far less than in cellular respiration. In fermentation, each glucose passing through glycolysis yields two ATP molecules and the production of fermentation end products. This is in sharp contrast to the 38 molecules from cellular respiration. It is clear that cellular respiration is the better choice for energy conservation, but under anoxic conditions, there may be little alternative if life
62582_CH06_158_188.pdf 179
for S. lactis, Saccharomyces, or any fermentative microorganism is to continue. Although fermentation end products are waste products to the microbes producing them, industries see many of these products in a very different light (Figure 6.14B). In a dairy plant, the process of lactic acid fermentation by S. lactis is carefully controlled so the acid will curdle fresh milk to make buttermilk
2/4/10 2:20 PM
180
CHAPTER 6
Enteric: Referring to the intestines.
Metabolism of Microorganisms
or yogurt. The liquor industry uses the ethyl alcohol produced in alcohol fermentation to make alcoholic beverages such as beer and wine (Chapter 27). Fermentation of carbohydrates to alcohol by C. albicans also may take place in the human body, such as that of Charlie Swaart’s, as described in the opener of this chapter. As indicated in Figure 6.14B, other industries also make use of microbial fermentations. For example, Swiss cheese develops its flavor from the propionic acid produced during fermentation and gets its holes from trapped carbon dioxide gas resulting from fermentation. The chemical industries also have harnessed the power of fermentation in the production of acetone, butanol, and other industrial solvents. Thus, fermentation is useful not only to microorganisms, but also to consumers who enjoy its products and industry that benefits from the products.
The ability of microbes to carry out different fermentation reactions that produce different end products can be very useful in species identification (see Chapter 3). Therefore, specific tests have been developed to detect particular end products. For example, with enteric species the “methyl red test” maintains a red colored solution if a species can ferment glucose to acid end products, while the “VogesProskauer test” produces a brownish-red colored solution if a species forms neutral end products from the acids produced through glucose fermentation ( FIGURE 6.14C ). These and other physiological and biochemical tests are often essential to the clinical lab microbiologist to identify a potential pathogen—and most likely for you in your microbiology lab class to identify an unknown bacterial species. CONCEPT AND REASONING CHECKS
6.12 Justify the need for some microbes to produce fermentation end products.
6.4 The Anabolism of Carbohydrates Although the anabolism or synthesis of carbohydrates takes place through various mechanisms in microorganisms, the unifying feature is the requirement for energy. Photosynthesis Is a Process to Acquire Chemical Energy KEY CONCEPT
13. Photosynthesis converts light energy into chemical energy usually in the form of carbohydrates.
Photosynthesis is a process by which light energy is converted to chemical energy that is then stored as carbohydrate or other organic compounds. In the cyanobacteria, the process takes place in special thylakoid membranes, which contain chlorophyll or chlorophyll-like pigments ( FIGURE 6.15A ). Among eukaryotes, photosynthesis occurs in the chloroplasts of such organisms as diatoms, dinoflagellates, and green algae ( FIGURE 6.15B ). In all cases, these microbes carry out oxygenic photosynthesis; that is, where oxygen gas (O2) is a by-product of the process. The phases of photosynthesis are shown in FIGURE 6.16 , where the sequence of stages is labeled by number.
62582_CH06_158_188.pdf 180
The Energy-Fixing Reactions. In the first part of photosynthesis, light energy is converted into or “fixed” as chemical energy in the form of ATP and NADPH. Thus, the process is referred to as energy-fixing reactions, or “light-dependent” reactions, because light energy is required for the process. Like the reactions of cellular respiration, the energy-fixing reactions of photosynthesis are dependent on electrons and protons. The source of these atomic particles is water. In the cyanobacteria and algae, the splitting of water not only produces the needed atomic particles, it releases oxygen as a by-product: 2H2O → 4H+ + 4e– + O2 As we have discussed in Chapters 2 and 5, the ability of the ancestors of modern-day cyanobacteria to generate oxygen gas profoundly changed the atmosphere of Earth some 3.5 billion years ago, leading to the evolution of aerobic organisms carrying out aerobic respiration. Light energy is absorbed by the green pigment chlorophyll a, a magnesium-containing, lipidsoluble compound (Figure 6.16A). Chlorophylls and accessory pigments make up light-receiving
2/4/10 2:20 PM
6.4 The Anabolism of Carbohydrates
(A)
(B) FIGURE 6.15 Photosynthetic Microbes. (A) False-color transmission electron micrograph of a cyanobacterium displaying the membranes (green) along which photosynthetic pigments are located. (Bar = 2 µm.) (B) A light micrograph of the colonial green alga Pediastrum. (Bar = 5 µm). »» What membranes in algae are analagous to the cyanobacterial membranes?
complexes called photosystems. The light excites pigment molecules in photosystem II, resulting in the loss of one electron (1). These electrons are replaced from the splitting of water. Excited electrons are immediately accepted by the first of a series of electron carriers (2). The electrons are passed along the membrane carriers and cytochrome complexes, and eventually the electrons are taken up by other chlorophyll pigments that form photosystem I. As the electrons move between cytochromes, energy is made available for proton pumping across the thylakoid membrane of the cyanobacterium, followed by chemiosmosis. As described for oxidative phosphorylation, ATP is formed when protons pass back across the membrane and release their energy. Because light was involved in the
62582_CH06_158_188.pdf 181
181
formation of ATP, this process is called photophosporylation. The electrons in photosystem I again are excited by light energy (3) and are boosted out of the pigment molecules to the first of another set of membrane carriers, and finally to a coenzyme called nicotinamide adenine dinucleotide phosphate (NADP+). The coenzyme functions much like NAD+ in that NADP+ receives pairs of electrons and protons from water molecules to form NADPH (4). The Carbon-Fixing Reactions. In the second stage of photosynthesis, another cyclic metabolic pathway forms carbohydrates (Figure 6.16B). The process is known as the carbon-fixing reactions because the carbon in carbon dioxide is trapped (or fixed) into carbohydrates and other organic compounds. It also is called the “Calvin cycle,” named after Melvin Calvin who worked out the sequence of reactions. An enzyme bonds carbon dioxide to a 5-carbon organic substance called ribulose 1,5-bisphosphate (RuBP)(5). (The enzyme is called ribulose bisphosphate carboxylase.) The resulting 6-carbon molecule then splits to form two molecules of 3-phosphoglycerate (3PG). In the next step, the products of the energyfixing reactions, ATP and NADPH, drive the conversion of 3PG to glyceraldehyde-3-phosphate (G3P)(6). Two molecules of G3P then condense with each other to form a molecule of glucose (7). Thus, the overall formula for photosynthesis may be expressed as: 6 CO2 + 6 H2O + ATP ↓ light C6H12O6 + 6 O2 + ADP + P Notice that this reaction is the reverse of the equation for aerobic respiration. The fundamental difference is that aerobic respiration is a catabolic, energy-yielding process, while photosynthesis is an anabolic, energy-trapping process. To finish off the cycle, most G3P molecules undergo a complex series of enzyme-catalyzed reactions that require ATP to reform RuBP (8). However, some G3P exits the cycle and combines in pairs to form glucose. The sugar then can be used for cell respiration, stored as glycogen, or used for other cellular purposes.
2/4/10 2:20 PM
182
CHAPTER 6
Metabolism of Microorganisms
Electron carrier
The Energy-Fixing Reactions
Chlorophyll NADP+ Electron carriers 4 Electrons
2
Chlorophyll
Energy-Fixing Reactions • Electrons released from the splitting of water are accepted into chlorophyll photosystem II; • Light excites some of the electrons in the photosystem (1) and as the excited electrons pass through an electron transport chain, ATP is produced (2) as the electrons pass to photosystem I; • Light again excites some of the electrons (3), which pass through another transport chain to the electron acceptor NADP+, combining with protons to form NADPH (4).
3 Light
Chlorophyll
ADP + P Electrons
O2
Photosystem I
ATP 1 Electrons
2 H2O
Chlorophyll
Light
(A)
P + ADP
Photosystem II
H+
ATP
NADPH
NADP+ Carbon-Fixing Reactions • CO2 combines with RuBP to form an unstable intermediate that splits into two 3PG molecules (5); • Through two molecular arrangements involving ATP and NAPDH from the energy-fixing reactions, two molecules of G3P are formed (6); • Some G3P is used to make glucose (7) while the remaining G3P goes through a complex set of reactions involving ATP to reform RuBP (8).
C C C 3PG
6
Unstable intermediate C C C C C C 5
C C C
C CO2
G3P
The Carbon-Fixing Reactions
C C C
C C C C C RuBP
NADPH
8
C C C
G3P 7
G3P C C C C C C
(B)
ADP +
Glucose
ATP
P FIGURE 6.16 Photosynthesis in Cyanobacteria and Algae. (A) The energy-fixing reactions generate ATP and NADPH. (B) The carbon-fixing reactions unite carbon dioxide with ribulose bisphosphate (RuBP) to form an unstable 6-carbon molecule. The latter splits to form two molecules of 3-phosphoglycerate (3PG) then glyceraldehyde-3-phosphate (G3P). ATP and NADPH from the energy-fixing reactions are used in the latter conversion. Condensations of two 3-carbon G3P molecules yields glucose, and the remainder are used to form RuBP to continue the process. »» How are the carbon-fixing reactions of photosynthesis dependent on the energy-fixing reactions?
62582_CH06_158_188.pdf 182
2/4/10 2:20 PM
6.5 Patterns of Metabolism
In addition to the cyanobacteria, a few other groups of bacteria trap energy by photosynthesis. Two such groups are the green bacteria and purple bacteria, so named because of the colors imparted by their pigments. These bacterial organisms have chlorophyll-like pigments known as bacteriochlorophylls to distinguish them from other chlorophylls. In the energy-fixing reactions, the organisms do not use water as a source of hydrogen ions and electrons. Consequently, no oxygen is liberated and the process is therefore called anoxygenic
6.5
183
photosynthesis. Instead of water, a series of inorganic or organic substances, such as hydrogen sulfide gas (H2S) and fatty acids, are used as a source of electrons and hydrogen ions. Thus, the green and purple bacteria commonly live under anaerobic conditions in environments such as sulfur springs and stagnant ponds. CONCEPT AND REASONING CHECKS
6.13 Compare and contrast the processes of glucose catabolism (aerobic respiration) with glucose anabolism (photosynthesis).
Patterns of Metabolism
Microorganisms must meet certain nutritional requirements for growth. Besides water, which is an absolute necessity, they need nutrients that can serve as energy sources and raw materials for the synthesis of cell components. These generally include proteins for structural compounds and enzymes, carbohydrates for energy, and a series of vitamins, minerals, and inorganic salts. Autotrophs and Heterotrophs Get Their Energy and Carbon in Different Ways KEY CONCEPT
14. Autotrophs and heterotrophs vary in their energy and carbon sources.
Two different patterns exist for satisfying an organism’s metabolic needs. These patterns are called autotrophy and heterotrophy. They are primarily based on the source of carbon used for making cell components ( FIGURE 6.17 ). Autotrophs. Organisms that synthesize their own foods from simple carbon sources such as CO2 are referred to as autotrophs (auto = “self”; troph = “nourish”). Those that use light as the energy source, such as the cyanobacteria, are photoautotrophs. Microorganisms, including the cyanobacteria and algae, can carry out photosynthesis using water and producing oxygen gas (oxygenic photosynthesis), while other bacterial species carry out anoxygenic photosynthesis; they use hydrogen sulfide (H2S) rather than water
62582_CH06_158_188.pdf 183
and produce sulfur granules (S) rather than oxygen gas (thus anoxygenic). light 2H2S CO2 –––→ Carbohydrates H2O 2S
Another group of autotrophs do not use light as an energy source. Instead, they use inorganic compounds and are referred to as chemoautotrophs. For example, species of Nitrosomonas convert ammonium ions (NH4+) into nitrite ions (NO2–) under aerobic conditions, thereby obtaining ATP. The genus Nitrobacter then converts the nitrite ions into nitrate ions (NO3–), also as an ATP-generating mechanism. In addition to providing energy to both bacterial species, these reactions have great significance in the environment as a critical part of the nitrogen cycle (Chapter 26). By preserving nitrogen in the soil in the form of nitrate or ammonia, it can be used by green plants to form amino acids. Another example of chemoautotrophy involving a symbiosis between animal and bacterial cells is described in MICROFOCUS 6.5. Heterotrophs. Many microorganisms are heterotrophs (hetero = “other”). Such heterotrophic organisms obtain their energy and carbon in one of two ways. The photoheterotrophs use light as their energy source and preformed organic compounds such as fatty acids and alcohols as sources of carbon. Photoheterotrophs include certain green nonsulfur and purple nonsulfur bacteria. The chemoheterotrophs use preformed organic compounds for both their energy and carbon sources. Glucose would be one example.
Nitrogen cycle: A biogeochemical cycle that cycles nitrogen gas into nitrogenous compounds and back again.
2/4/10 2:20 PM
184
CHAPTER 6
Metabolism of Microorganisms
Microorganism metabolism using CO2 as carbon source is called
using chemical compounds as carbon source is called
Autotrophy
Heterotrophy
and the organisms are
and the organisms are
Autotrophs
Heterotrophs
whose energy source is
whose energy source is
inorganic compounds
light Photoautotrophs
organic compounds
Chemoautotrophs
Chemoheterotrophs
Oxygenic photosynthesis
that do not use H2O carry out
Nitrosomonas, Nitrobacter
Anoxygenic photosynthesis
which includes the
Cyanobacteria and algae
Green and purple bacteria
Photoheterotrophs
which include
which include
that use H2O carry out
light
Many Bacteria, Archaea, and Eukarya
those feeding on dead organic matter Saprobes
Green and purple nonsulfur bacteria
those feeding on living organic matter Parasites
FIGURE 6.17 Microbial Metabolic Diversity. This concept map summarizes microbial metabolism based on carbon sources (CO2 or chemical compounds) and energy sources (light or inorganic/organic compounds). »» Why do the Bacteria and Archaea show such diversity of metabolic types?
Those chemoheterotrophic microorganisms that feed exclusively on dead organic matter are commonly called saprobes. In contrast, chemoheterotrophs that feed on living organic matter, such as human tissues, are commonly known as parasites.
62582_CH06_158_188.pdf 184
The term pathogen is used if the parasite causes disease in its host organism. We will certainly see many examples of this in upcoming chapters. CONCEPT AND REASONING CHECKS
6.14 Why are there no autotrophic parasites or pathogens?
2/4/10 2:20 PM
6.5 Patterns of Metabolism
185
6.5: Environmental Microbiology
Life in the Deep Deep-sea hydrothermal vents, or black smokers, are truly exotic places, representing volcanically active mid-ocean ridges several thousand meters below the ocean surface where the Earth’s crust has cracked as tectonic plates move apart. The vents in these extreme environments spew forth extremely hot water that can be as high as 300°C, compared to the chilling 2°C for the surrounding deep ocean water. And you guessed it—microbes are found here often in symbiotic association with one of the vent residents, the giant tube worm Riftia pachyptila. These deep-sea aliens share the cooler parts of the vent ecosystem (12–222°C) with other vent creatures like crabs, lobsters, and octopuses, and live in colonies made up of hundreds of individuals (see photo). Riftia lacks a mouth and a gut, yet somehow is able to grow to more than 7 feet in length. To accomplish this growth, they wave their bright red plumes, exposing and absorbing chemicals from the vent fluids, making these chemicals available to the symbiotic bacteria living within the tube worm, and the bacteria, in turn, using these chemicals to provide the tube worm with sustenance. O2
H 2O
Bacterial symbiont
Energy-fixing reactions NADP+ ADP
Carbon-fixing reactions
NADPH ATP
CO2 H 2S
Organic compounds
To Riftia cells
SO4
The energy- and carbon-fixing reactions in the bacterial symbiont of Riftia.
These communities represent chemoautotrophic proteobacteria (see Chapter 4). The cells receive inorganic compounds [hydrogen sulfide (H2S) and O2] from Riftia’s circulatory system, the chemicals then serving as the energy source, along with carbon dioxide gas as the carbon source, for growth (see drawing). Specifically, the worms remove hydrogen sulfide and oxygen from the vent seawater and deliver it to the bacteria that have been gathered together in an organ called the trophosome to population densities surpassing 10 billion bacterial cells per gram of worm tissue. The bacterial symbionts oxidize the sulfide and use some of the released energy to fix CO2 via the carbon-fixing reactions into organic compounds, some of which are translocated back to the tube worm’s tissues, supporting its growth. Life in the deep is truly remarkable—and microbes will always be there.
Tube worms on a hydrothermal vent.
62582_CH06_158_188.pdf 185
2/4/10 2:20 PM
186
CHAPTER 6
Metabolism of Microorganisms
SUMMARY OF KEY CONCEPTS 6.1 Enzymes and Energy in Metabolism The two major themes of microbial metabolism are catabolism (the breakdown of organic molecules) and anabolism (the synthesis of organic molecules). 1. Microorganisms and all living organisms use enzymes, protein molecules that speed up a chemical change, to control cellular reactions. 2. Enzymes bind to substrates at their active site (enzymesubstrate complex) where functional groups are destabilized, lowering the activation energy. 3. Many metabolic processes occur in metabolic pathways, where a sequence of chemical reactions is catalyzed by different enzymes. 4. Enzymes can be inhibited by physical agents, which can denature enzymes and inhibit their action in cells. Enzymes are modulated through feedback inhibition. The final end product often inhibits the first enzyme in the pathway. 5. Many metabolic reactions in cells require energy in the form of adenosine triphosphate (ATP). The breaking of the terminal phosphate produces enough energy to supply an endergonic reaction, and often involves the addition of the phosphate to another molecule (phosphorylation). 6.2 The Catabolism of Glucose 6. Cellular respiration is a series of metabolic pathways in which chemical energy is converted to cellular energy (ATP). It may require oxygen gas (aerobic respiration) or another inorganic final electron acceptor (anaerobic respiration). 7. Glycolysis, the catabolism of glucose to pyruvate, extracts some energy from which two ATP and 2 NADH molecules result. 8. The catabolism of pyruvate into carbon dioxide and water in the citric acid cycle extracts more energy as ATP, NADH, and FADH2. Carbon dioxide gas is released. 9. The process of oxidative phosphorylation involves the oxidation of NADH and FADH2, the transport of freed electrons along a cytochrome chain, the pumping of protons across the
cell membrane, and the synthesis of ATP from a reversed flow of protons. These last two steps are referred to as chemiosmosis. 6.3 Other Aspects of Catabolism 10. Other carbohydrates, such as sucrose, lactose, and polysaccharides, represent energy sources that can be metabolized through cellular respiration. Besides carbohydrates, proteins and fats can be metabolized through the cellular respiratory pathways to produce ATP. 11. The anaerobic respiration of glucose uses different final electron acceptors in oxidative phosphorylation. Glycolysis and parts of the citric acid cycle still function, and ATP synthesis occurs. 12. In fermentation, the catabolism of glucose can continue without a functional citric acid cycle or oxidative phosphorylation process. To maintain a steady supply of NAD+ for glycolysis and ATP synthesis, pyruvate is redirected into other pathways that reoxidize NADH to NAD+. End products include lactic acid or ethanol. Only the two ATP molecules of glycolysis are synthesized in fermentation from each molecule of glucose. 6.4 The Anabolism of Carbohydrates 13. The anabolism of carbohydrates can occur by photosynthesis, the process whereby light energy is used to synthesize ATP, and the latter is then used to fix atmospheric carbon dioxide into carbohydrate molecules. 6.5 Patterns of Metabolism 14. Autotrophs synthesize their own food from carbon dioxide and light energy (photoautotrophs) or carbon dioxide and inorganic compounds (chemoautotrophs). Heterotrophs obtain their carbon from organic compounds and energy from light (photoheterotrophs) or from organic compounds (chemoheterotrophs).
LEARNING OBJECTIVES After understanding the textbook reading, you should be capable of writing a paragraph that includes the appropriate terms and pertinent information to answer the objective. 1a. Contrast anabolism and catabolism as biochemical reactions and as energy processes. 1b. Describe the four properties of enzymes. 2. State the role of an enzyme-substrate complex to regulating metabolism. 3. Judge the importance of metabolic pathways in microbial cells. 4. Compare the mechanisms of noncompetitive and competitive inhibition. 5. Assess the role of ATP and the ATP/ADP cycle in cell metabolism. 6. Explain the importance of glucose to energy metabolism.
62582_CH06_158_188.pdf 186
7. Summarize the important steps of glycolysis. 8. Identify the importance of the citric acid cycle to cellular respiration. 9. Construct an electron transport pathway, indicating the important steps in the synthesis of ATP. 10. Identify what other compounds, besides glucose, can be used to supply chemical energy for ATP production. 11. Compare and contrast aerobic and anaerobic respiration. 12. Summarize the steps in fermentation and identify the reason why pyruvate is converted into a final end product. 13. Summarize the importance of (a) the energy-fixing reactions and (b) the carbon-fixing reactions of photosynthesis. 14. Distinguish between the energy and carbon sources for the four nutritional classes of microorganisms.
2/4/10 2:20 PM
Step B: Review
187
STEP A: SELF-TEST Each of the following questions is designed to assess your ability to remember or recall factual or conceptual knowledge related to this chapter. Read each question carefully, then select the one answer that best fits the question or statement. Answers to even-numbered questions can be found in Appendix C. 1. Enzymes are A. inorganic compounds. B. destroyed in a reaction. C. proteins. D. vitamins. 2. Enzymes combine with a _____ at the _____ site to lower the activation energy. A. substrate; active B. product; noncompetitive C. product; active D. coenzyme; active 3. Which one of the following is NOT a metabolic pathway? A. Citric acid cycle B. The carbon-fixing reactions C. Glycolysis D. Sucrose → glucose + fructose 4. If an enzyme’s active site becomes deformed, _____ inhibition was likely responsible. A. metabolic B. competitive C. noncompetitive D. cellular 5. Which one of the following is NOT part of an ATP molecule? A. Phosphate groups B. Cofactor C. Ribose D. Adenine 6. The use of oxygen gas (O2) in an exergonic pathway generating ATP is called A. anaerobic respiration. B. photosynthesis. C. aerobic respiration. D. fermentation. 7. Which one of the following is NOT produced during glycolysis? A. ATP B. NADH C. Pyruvate D. Glucose
8. All the following are produced during the citric acid cycle except: A. CO2. B. O2. C. ATP. D. NADH. 9. The electron transport chain is directly involved with A. ATP synthesis. B. CO2 production. C. H+ pumping. D. generating oxygen gas. 10. Which one of the following macromolecules would NOT normally be used for microbial energy metabolism? A. DNA B. Proteins C. Carbohydrates D. Fats 11. Anaerobic respiration does NOT A. use an electron transport system. B. use oxygen gas (O2). C. occur in bacterial cells. D. generate ATP molecules. 12. In fermentation, the conversion of pyruvate into a final end product is critical for the production of A. CO2. B. glucose. C. NAD+. D. O2. 13. Which one of the following is the correct sequence for the flow of electrons in the energy-fixing reactions of photosynthesis? A. Water—photosystem I—photosystem II—NADPH B. Photosystem I—NADPH—water—photosystem II C. Water—photosystem II—photosystem I—NADPH D. NADPH—photosystem II—photosystem I—water 14. Microorganisms that use organic compounds as energy and carbon sources are A. chemoheterotrophs. B. chemoautotrophs. C. photoautotrophs. D. photoheterotrophs.
STEP B: REVIEW 15. Identify on the metabolic map key where each reactant is used and where each product is produced in the cellular respiration summary equation. C6H12O6 + 6O2 + 38 ADP + 38 P ↓ 6 CO2 + 6 H2O + 38 ATP
62582_CH06_158_188.pdf 187
2/4/10 2:20 PM
188
CHAPTER 6
Metabolism of Microorganisms
For each choice, circle the word or term that best completes each of the following statements. The answers to even-numbered statements are listed in Appendix C. 16. The sum total of all an organism’s biochemical reactions is known as (catabolism, metabolism); it includes all the (synthesis, digestion) reactions called anabolism and all the breakdown reactions known as (inactivation, catabolism). 17. Enzymes are a group of (carbohydrate, protein) molecules that generally (slow down, speed up) a chemical reaction by converting the (substrate, active site) to end products. 18. The aerobic respiration of glucose begins with the process of (oxidative phosphorylation, glycolysis) and requires that (amino acids, energy) be supplied by (ATP, NADH) molecules. 19. The process of (fermentation, the citric acid cycle) takes place in the absence of (oxygen, carbon dioxide) and begins with a molecule of (glucose, protein) and ends with molecules of (amino acids, an organic end product). 20. In oxidative phosphorylation, pairs of (protons, electrons) are passed among a series of (chromosomes, cytochromes) with the result that (oxygen, energy) is released for (NAD+, ATP) synthesis.
21. In the citric acid cycle, (glucose, pyruvate) undergoes a series of changes and releases its (carbon, nitrogen) as (carbon dioxide, nitrous oxide) and its electrons to (NAD+, ATP). 22. For use as energy compounds, proteins are first digested to (uric, amino) acids, which then lose their (carboxyl, amino) groups in the process of (fermentation, deamination) and become intermediates of cellular respiration. 23. Ribulose 1,5-bisphosphate bonds with (carbon monoxide, carbon dioxide) molecules during (fermentation, photosynthesis), a process that ultimately results in molecules of (pyruvate, glucose). 24. Chemoautotrophs use energy from (light, inorganic compounds) to synthesize (carbohydrates, oxygen gas) and are typified by species of (Staphylococcus, Nitrosomonas). 25. Fats are broken down to (fatty acids, coenzymes), which are converted through (beta oxidation, deamination) reactions to (glucose, twocarbon units) and eventually enter (cellular respiration, photosynthesis).
STEP C: APPLICATIONS Answers to even-numbered questions can be found in Appendix C. 26. You have two flasks with broth media. One contains a species of cyanobacteria. The other flask contains E. coli. Both flasks are sealed and incubated under optimal growth conditions for two days. Assuming the cell volume and metabolic rate of the bacterial cells is identical in each flask, why would the carbon dioxide concentration be higher in the E. coli flask than in the cyanobacteria flask after the two-day incubation? 27. A stagnant pond usually has a putrid odor because hydrogen sulfide has accumulated in the water. A microbiologist recommends that tons
of green bacteria be added to remove the smell. What chemical process does the microbiologist have in mind? Do you think it will work? 28. Citrase is the enzyme that converts citrate to α-ketoglutarate in the citric acid cycle. A chemical company has isolated a mutant microorganism that cannot produce this enzyme and proposes to use the microorganism to manufacture a particular product. What do you suppose the product is? How might this product be useful?
STEP D: QUESTIONS FOR THOUGHT AND DISCUSSION Answers to even-numbered questions can be found in Appendix C. 29. A student goes on a college field trip and misses the microbiology exam covering microbial metabolism. Having made prior arrangements with the instructor for a make-up exam, he finds one question on the exam: “Discuss the interrelationships between anabolism and catabolism.” How might you have answered this question? 30. If ATP is such an important energy source for microbes, why do you think it is not added routinely to the growth medium for these organisms? 31. One of the most important steps in the evolution of life on Earth was the appearance of certain organisms in which photosynthesis takes place. Why was this critical?
32. A population of a Bacillus species is growing in a soil sample. Suppose glycolysis came to a halt in these bacterial cells. Would this mean that the citric acid cycle would also stop? Why? 33. While you are taking microbiology, a friend is enrolled in a general biology course. You both are studying cell energy metabolism. Your friend looks puzzled when you tell him that the citric acid cycle and electron transport occur in the bacterial cytoplasm and cell membrane. Your friend insists these processes occur in the mitochondrion. Who is correct and why?
HTTP://MICROBIOLOGY.JBPUB.COM/9E The site features eLearning, an online review area that provides quizzes and other tools to help you study for your class. You can also follow useful links for in-depth information, read more MicroFocus stories, or just find out the latest microbiology news.
62582_CH06_158_188.pdf 188
2/4/10 2:20 PM
7 Chapter Preview and Key Concepts
Control of Microorganisms: Physical and Chemical Methods Advances in our understanding of hygiene, sanitation, and pathology that followed the development of the germ theory have done more to extend life expectancy and change the nature of society than any other medical innovation. —Dr. Harry Burns, Chief Medical Officer for Scotland
For personal hygiene, washing our hands, taking regular showers or baths, brushing our teeth with fluoride toothpaste, and using an underarm deodorant are common practices we use to control microorganisms on our bodies. In our homes, we try to keep microbes in check by cooking and refrigerating foods, cleaning our kitchen counters and bathrooms with disinfectant chemicals, and washing our clothes with detergents. In our attempt to be hygiene-minded consumers, sometimes we have become excessively “germphobic.” The news media regularly report about this scientific study or that survey identifying places in our homes (e.g., toilets, kitchen drains) or environment (e.g., public bathrooms, drinking-water fountains) that represent infectious dangers. Consumer groups distribute pamphlets on “microbial awareness” and numerous companies have responded by manufacturing dozens of household antimicrobial products—some useful, but many unnecessary ( FIGURE 7.1A ). Our desire to protect ourselves from microbes also stems from events beyond our doorstep. The news media again report about dangerous disease outbreaks, many of which result from a lack of sanitary controls or a lack of vigilance to maintain those controls. In our communities, we expect our drinking water to be clean. That goes for our hospitals as well. Nowhere
1.1 The Beginnings of Microbiology 7.1 General Principles of Microbial Control • The discovery microorganisms 1. Microbes are kept underofcontrol either by was dependent onorobservations made with eliminating them reducing their numbers. the microscope 7.2 Physical Methods of Control 2. Microbes • The experimental 2. and emergence viruses are of killed at science provided a means to test long held temperatures above their temperature range beliefs and or resolve controversies for growth replication. 3. MicroInquiry 1: Experimentation 3. Dry heat uses hot air with little, if any, and Scientific Inquiry moisture. 1.2 Microorganisms andExploring DiseaseHeat Transmission MICROINQUIRY 7: as an 4. •Effective Early epidemiology studies Control Method could be objects spread and 4. suggested Moist heat how morediseases easily penetrates be controlled materials. 5. •Filtration Resistance to a disease canair come removes microbes from the or from water.exposure to and recovery from a mild of (or very similar) disease 6. form UV light cana be bactericidal. 1.3 The Goldenrays Agealso of are Microbiology 7. XClassical rays and gamma microbicidal. 6. 8. (1854-1914) Dehydration and cold temperatures slow growth. 7. •microbial The germ theory was based on the observations that of different microorganisms 7.3 General Principles Chemical Control distinctive specific roles in nature 9. have Disinfectants andand antiseptics are key to 8. •proper sanitation Antisepsis and identification and public health. of the cause of animal reinforced the germ 10. Disinfectants anddiseases antiseptics are defined by theory their properties. 9. •StandardsKoch's postulates provided a waythe to 11. have been established to know identify a specific microorganism asagent. causing relative effectiveness of a chemical a specific infectious disease 7.4 Chemical Methods of Control 10. • Laboratory science and teamwork 12. Chlorine andthe iodine are good disinfectant stimulated discovery of additional agents. infectious disease agents 13. phenolic derivatives are used as 11. Many • Viruses also can cause disease disinfectants or antiseptics. 12. • Many beneficial bacteria recycle 14. Mercury, and silver compounds can nutrientscopper, in the environment be useful disinfectants. 15. Alcohols are widely used skin antiseptics. 16. Cationic detergents are bacteriostatic. 17. Hydrogen peroxide can be used as an antiseptic rinse. 18. Aldehydes and gases can be used for sterilization.
189
62582_CH07_189_221.pdf 189
2/4/10 2:21 PM
190
CHAPTER 7
(A)
Control of Microorganisms: Physical and Chemical Methods
(B)
Controlling Microorganisms. (A) Household cleaning products are diverse and formulated for every cleaning need to maintain a sanitary condition. (B) This African shantytown has slum houses, open sewage, and littered walkways. It is not surprising that in these unsanitary conditions diseases such as cholera and typhoid are common. »» In these examples, does controlling microorganisms mean sterilization or simply reducing the number of microbes to a safe level? Explain. FIGURE 7.1
is this more important than in the operating rooms and surgical wards. Here, hospital personnel must maintain scrupulous levels of cleanliness and have surgical instruments that are sterile. Yet, nosocomial (hospital-acquired) infections do occur when hygiene barriers are breached. Microbial control also is a global endeavor. Government and health agencies in many developing nations often lack the means (financial, medical, social) to maintain proper sanitary conditions. These circ*mstances can result in outbreaks of diseases such as diphtheria, malaria, measles, meningitis, and cholera. Cholera, as an example, tends to be associated with poverty-stricken areas where overcrowding and inadequate sanitation practices generate contaminated water supplies and food ( FIGURE 7.1B ). We do need to be hygiene conscious. If the procedures and methods to control pathogens fail or are not monitored properly, serious threats to health and well-being may occur. Just think back to our description of Ignaz Semmelweis and childbed fever or John Snow and the London cholera outbreak (see Chapter 1). Importantly, then, as now, the successful
62582_CH07_189_221.pdf 190
control of microorganisms usually requires simple methods and procedures. These methods are not products of the modern era. As the opening quote reminds us, proper hygiene and sanitation have extended our lives and afforded us the opportunity to contribute more fully to society. Now that we have a good understanding of microbial growth and metabolism, we can examine a variety of physical and chemical methods used for controlling the growth and spread of microorganisms. Our study begins by outlining some general principles and terminology and then identifies physical methods commonly used today. We also explore chemical methods for microbial control and discuss the spectrum of antiseptics and disinfectants. Whether the methods are physical or chemical, they are integral in public health practices to ensure continued good health and protection from infectious disease. Controlling microbial growth within the body as a result of infection using antimicrobial drugs (e.g., antibiotics) will be discussed in Chapter 24.
2/4/10 2:21 PM
7.1 General Principles of Microbial Control
7.1
191
General Principles of Microbial Control
Although your immune system usually does a great job keeping pathogens out of the body, external control measures can further guard against contact with these potential invaders. The effective control of disease-causing microbes requires an understanding of the procedures and agents available today, including the physical and chemical methods used to limit microbial growth and/or microbial transmission. First, let’s establish some basic vocabulary generally used by the public and by health officials when talking about microbial control. Sterilization and Sanitization Are Key to Good Public Health KEY CONCEPT
1.
Microbes are kept under control either by eliminating them or reducing their numbers.
Microbiologically speaking, sterilization involves the destruction or removal of all living microbes, spores, and viruses on an object or in an area. For example, in a surgical operation, the surgeon uses sterile instruments previously treated in some way to kill any microbes present on them ( FIGURE 7.2 ). Everyday experiences bring us in contact with sterile materials. An unopened can of corn or peas is sterile inside. During the canning process, companies use special sterilization procedures to kill all the microbes on the vegetables and in the tin can. Agents that kill microbes are microbicidal (-cide = “kill”) or more simply called “germicides.” If the agent specifically kills bacteria, it is bactericidal; if it kills fungi, it is fungicidal. Many physical methods and chemical agents are capable of destroying microbes on nonliving materials or on the skin surface. However, once exposed to the air and surroundings, sterile objects will again be contaminated with microbes in the air or the surrounding area. More often, in our daily experiences we are likely to encounter materials where microbial populations have been reduced or where their growth has been inhibited. Sanitization involves those procedures reducing the numbers of patho-
62582_CH07_189_221.pdf 191
FIGURE 7.2 Sterile Surgical Instruments. Here a surgical nurse is unwrapping sterile surgical instruments. »» How would you sterilize these instruments?
genic microbes or discouraging (inhibiting) their growth. Given enough time, these pathogens will grow and some could possibly cause spoilage or a health problem. So, a tasty wedge of cheese in the refrigerator might look fine today, but in a few weeks it may have a mold growing on it. The toilet bowl “sanitized” with a disinfectant today contains few pathogens. Tomorrow it may again be an area with increased numbers of bacterial species. Many chemical agents are microbiostatic (-static = “remain in place”); they reduce microbial numbers or inhibit their growth. Again, agents can be bacteriostatic or fungistatic. Sanitary measures to control pathogens are very important in areas frequented by the public. City and state sanitation agencies monitor drinking water quality and the preparation of food in public eating establishments to ensure pathogen elimination. Public health depends on good sanitary practices at home and in the workplace.
Contaminated: In microbiology, a once sterile object that is again harboring microorganisms and/or viruses.
CONCEPT AND REASONING CHECKS
7.1 Assess the importance of maintaining sterility or sanitary conditions.
2/4/10 2:21 PM
192
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
7.2
Physical Methods of Control
With this background, let’s now examine some specific physical agents that kill microorganisms or inhibit their growth. Although there are several methods and agents used today that affect microbial survival, they generally include temperature, filtration, radiation, and osmotic pressure. Heat Is One of the Most Common Physical Control Methods KEY CONCEPT
2.
Foot-and-mouth disease: A highly contagious viral disease affecting cattle, sheep, and pigs, in which the animal develops ulcers in the mouth and near the hooves.
Microbes and viruses are killed at temperatures above their temperature range for growth or replication.
The Citadel is a novel by A. J. Cronin that follows the life of a young British physician, beginning in the 1920s. Early in the story, the physician, Andrew Manson, begins his practice in a small coal-mining town in Wales. Almost immediately, he encounters an epidemic of typhoid fever. When his first patient dies of the disease, Manson becomes terribly distraught. However, he realizes the epidemic can be halted, and in the next scene, he is tossing all of the patient’s bed sheets, clothing, and personal effects into a huge bonfire. The killing effect of heat on microorganisms has long been known. Heat is fast, reliable, and relatively inexpensive. Above the growth range temperature for a microbe (see Chapter 5), enzymes and other proteins as well as nucleic acids are denatured (see Chapter 2). Heat also drives off water, and because all organisms depend on water, this loss may be fatal. The killing rate of heat may be expressed as a function of time and temperature. For example, bacilli of Mycobacterium tuberculosis are destroyed in 30 minutes at 58°C, but in only 2 minutes at 65°C, and in a few seconds at 72°C. Each microbial species has a thermal death time, the time necessary for killing the population at a given temperature. Each species also has a thermal death point, the minimal temperature at which it dies in a given time. These measurements are particularly important in the food industry, where heat is used for preservation (Chapter 25). MICROINQUIRY 7 examines heat and microbial killing. CONCEPT AND REASONING CHECKS
7.2 How does the thermal death time differ from the thermal death point?
62582_CH07_189_221.pdf 192
Dry Heat Has Useful Applications KEY CONCEPT
3.
Dry heat uses hot air with little, if any, moisture.
The form in which dry heat is used depends on the nature of the substance to be treated. Incineration. Using a direct flame can incinerate microbes very rapidly. For example, the flame of the Bunsen burner is employed for a few seconds to sterilize the bacteriological loop before removing a sample from a culture tube ( FIGURE 7.3 ). Flaming the lip of the tube also destroys organisms that happen to contact the lip, while burning away lint and dust. Disposable hospital gowns and certain plastic apparatus are examples of materials that may be incinerated. In past centuries, the bodies of disease victims were burned to prevent spread of the plague. It still is common practice to incinerate the carcasses of cattle that have died of anthrax and to put the contaminated field to the torch because anthrax spores cannot be destroyed adequately by other means. The 2001 outbreak of foot-andmouth disease in British cattle required the mass incineration of thousands of cattle as a means to stop the spread of the disease ( FIGURE 7.4 ). Dry Heat. The hot-air oven uses radiating dry heat for sterilization. This type of energy does not penetrate materials easily, and therefore, long periods of exposure to high temperatures are necessary. For example, at a temperature of 160°C (320°F), a period of two hours is required for the destruction of bacterial spores. Higher temperatures are not recommended because the wrapping paper used for equipment tends to char at 180°C. The hot-air method is useful for sterilizing dry powders and water-free oily substances, as well as for many types of glassware, such as pipettes, flasks, and syringes. Dry heat does not corrode sharp instruments as steam often does, nor does it erode the ground glass surfaces of nondisposable syringes. The effect of dry heat on microorganisms is equivalent to that of baking. The heat changes microbial proteins by oxidation reactions and creates an arid internal environment, thereby burning microorganisms slowly. It is essential that organic matter such as oil or grease films be removed from the materials, because such substances insulate
2/4/10 2:21 PM
7.2 Physical Methods of Control
193
INQUIRY 7
Exploring Heat as an Effective Control Method
62582_CH07_189_221.pdf 193
affect the texture and flavor of the food product. One way the industry determines this sensitivity is by using standard curves that take into account the factors mentioned above. The graph drawn below represents three such curves, each representing a different bacterial species treated at the same temperature (60°C) in the same food material (curve B represents the plotted data from the table). 7a. If you had to sterilize this food product that initially contained 106 bacteria, how long would it take for each bacterial species? (Hint: 10° = 1) Another value of importance is the decimal reduction time (DRT) or D value, which is the time required at a specific temperature to kill 90% of the viable organisms. These are the values typically used in the canning industry. D values are usually identified by the temperature used for killing. In the graph to the right, the temperature was 60°C, so D is written as D60. Look at the graph again. 7b. Calculate the D60 values for the three bacterial populations depicted in curves A, B, and C.
On another day in the canning plant, you need to sterilize a food product. However, the only information you have is a D70 = 12 minutes for the microorganism in the food product. Assuming the D value is for the volume you have to sterilize and there are 108 bacteria in the food product: 7c. At what temperature will you treat the food product? 7d. How long will it take to sterilize the product?
Number of cells surviving (logarithm)
Is that can of unopened peas in your pantry sterile? Yes, because companies, like General Mills (manufacturer of Green Giant® products) and the food industry in general, have established appropriate procedures for sterilizing commercial foods. Sterilization depends on several factors. Identifying the type(s) of microbes in a product can determine whether the heating process will sterilize or eliminate only potential disease-causing species. In many foods, the microbes usually are not in water but rather in the food material. Microbes in powders or dry materials will require a different length of time to sterilize the product than microbes in organic matter. Environmental conditions also influence the sterilization time. Microbes in acidic or alkaline materials decrease sterilization times while microbes in fats and oils, which slow heat penetration, increase sterilization times. It must be remembered that sterilization times are not precise values. However, by knowing these factors, heating the product to temperatures above the maximal range for microbial growth will kill microbes rapidly and effectively. Let’s explore the factors of time and temperature. Answers can be found in Appendix D. As we described for the microbial growth curve in Chapter 4, microbial death occurs in an exponential fashion. Look at the table to the right. The table records the death of a microbial population by heating. Notice that the cells die at a constant rate. In this generalized example, each minute 90% of the cells die (10% survive). Therefore, if you know the initial number of microorganisms, you can predict the thermal death time (TDT), which is defined as the minimal time, at a specified temperature, required to kill a population of microorganisms. The food industry depends on knowing a microorganism’s heat sensitivity when planning the canning or packaging of many foods as excessive heat can
106 105 104 103 102 A
B
C
101 100 20
40
60
80
100
120
Time (minutes)
Standard curves for death of three microbial species (A, B, C).
TABLE
Microbial Death Rate Time (minutes)
Number of Cells Surviving
% Killed
0 10 20 30 40 50 60
1,000,000 100,000 10,000 1,000 100 10 1
— 90 90 90 90 90 90
2/4/10 2:21 PM
194
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
FIGURE 7.3 Use of the Direct Flame as a Sterilizing Agent. A few seconds in the flame of a laboratory Bunsen or Fisher burner is usually sufficient to effect sterilization of a culture tube lip or inoculation loop. »» Why is it necessary to flame a culture tube lip?
FIGURE 7.4 Incineration Is an Extreme Form of Heat. Nearly four million hoofed animals infected with or exposed to foot-and-mouth disease in England in 2001 were incinerated and buried. »» How is incineration similar to flame sterilization?
against dry heat. Moreover, the time required for heat to reach sterilizing temperatures varies according to the material. This factor must be considered in determining the total exposure time. CONCEPT AND REASONING CHECKS
7.3 Explain how dry heat is used to “eliminate” microorganisms.
Moist Heat Is More Versatile Than Dry Heat KEY CONCEPT
4.
62582_CH07_189_221.pdf 194
Moist heat more easily penetrates objects and materials.
There are several ways that moist heat is used to control microbes and sterilize materials. Moist Heat as Boiling Water. Boiling water is an example of moist heat that penetrates materials much more rapidly than dry heat because water molecules conduct heat better than air. Therefore, moist heat can be used at a lower temperature and shorter exposure time than for dry heat. Moist heat kills microorganisms by denaturing their proteins. Denaturation is a change in the chemical or physical property of a protein. It includes structural alterations due to destruction of the chemical bonds holding proteins in a three-dimensional form. As proteins revert to a two-dimensional structure, they coagulate (denature) and become nonfunctional. Egg protein undergoes a similar transformation when it is boiled. (You might find reviewing the chemical structure of proteins in Chapter 2 helpful in understanding this process.) The coagulation of proteins requires less energy than oxidation, and, therefore, less heat need be applied. Boiling water is not considered a sterilizing agent because the destruction of bacterial spores and the inactivation of viruses cannot always be assured. Under ordinary circ*mstances, with
2/4/10 2:21 PM
7.2 Physical Methods of Control
microorganisms at concentrations of less than 1 million per milliliter, most species of microorganisms can be killed within 10 minutes. Indeed, the process may require only a few seconds. However, fungal spores, protozoal cysts, and large concentrations of hepatitis A viruses require up to 30 minutes’ exposure. Bacterial spores often require two hours or more. Because inadequate information exists on the heat tolerance of many species of microorganisms, boiling water is not reliable for sterilization purposes ( FIGURE 7.5 ). If boiling water must be used to destroy microorganisms, then materials must be thoroughly cleaned to remove traces of organic matter, such as blood or feces. The minimum exposure period should be 30 minutes, except at high altitudes, where it should be increased to compensate for the lower boiling point of water. All materials should be well covered. Baking soda may be added at a 2% concentration to increase the efficiency of the process. Sterilization with Pressurized Steam. Moist heat in the form of pressurized steam is regarded as the most dependable method for sterilization, including the destruction of bacterial spores. This method is incorporated into a device called the autoclave. When the pressure of a gas increases, the temperature of the gas also increases proportionally. Because steam is a gas, increasing its pressure in a closed system increases its temperature. As the water molecules in steam become more energized, their penetration increases substantially. This principle is used to reduce cooking time in the home pressure cooker and to reduce sterilizing time in the autoclave. During autoclaving, the sterilizing agent is the moist heat, not the pressure. Autoclaves contain a sterilizing chamber into which articles are placed, and a steam jacket where steam is maintained ( FIGURE 7.6 ). As steam flows from the steam jacket into the sterilizing chamber, cool air is forced out and a special valve increases the pressure to 15 pounds/square inch (lb/in2) above normal atmospheric pressure. The temperature rises to 121.5°C, and the superheated steam rapidly conducts heat into microorganisms. The time for destruction of the most resistant bacterial species is about 15 minutes. For denser objects or larger volumes, more than 30 minutes of exposure may be required. The conditions must be carefully controlled to assure sterilization has been accomplished (MICROFOCUS 7.1).
62582_CH07_189_221.pdf 195
F° / C° 320 / 160 302 / 150 284 / 140
195
C° 160 Spores killed in 2 hours in hot-air oven or 1 hour in hot oil 140 Pathogenic bacteria killed in 3 seconds in ultra high temperature method
266 / 130 248 / 120
121 Most bacterial species killed in 15 minutes and spores killed in 30 minutes in autoclave
230 / 110 212 / 100 194 / 90
100 Spores killed in 2 hours in boiling water or 30 minutes/day for 3 days in fractional sterilization
176 / 80 158 / 70 140 / 60
72 Pathogenic bacteria killed in 15 seconds in flash pasteurization (71.6°C) 63 Pathogenic bacteria killed in 30 minutes in holding method pasteurization (62.9°C)
122 / 50 104 / 40 37 Human body temperature 86 / 30 68 / 20 50 / 10 5 Refrigerator temperature 32 / 0 14 / -10
-10 Home freezer temperature
FIGURE 7.5 Temperature and the Physical Control of Microorganisms. Notice that materials containing bacterial endospores require longer exposure times and higher temperatures for killing. »» Pure water boils and freezes at what temperatures on the Celsius scale?
The autoclave is used to control microorganisms in both hospitals and laboratories. It is employed for blankets, bedding, utensils, instruments, intravenous solutions, and a broad variety of other objects. The laboratory technician uses it to sterilize bacteriological media and destroy pathogenic cultures. The autoclave is equally valuable for glassware and metalware, and is among the first instruments ordered when a microbiology laboratory is established. The autoclave has certain limitations. For example, some plasticware melts in the high heat and sharp instruments often become dull. Moreover, many chemicals break down during the sterilization process and oily substances cannot be treated because they do not mix with water. In recent years a new form of autoclave, called the prevacuum autoclave, has been developed for sterilization procedures. This machine draws
2/4/10 2:21 PM
196
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods Chamber pressure gauge
Steam exhaust valve (E)
Valve (C)
Steam (D)
Door Air
Steam exhaust
Jacket (B)
Trap
Thermometer Pressure regulator
Steam enters (A)
FIGURE 7.6 Operating an Autoclave. Steam enters through the port (A) and passes into the jacket (B). After the air has been exhausted through the vent, a valve (C) opens to admit pressurized steam (D), which circulates among and through the materials, thereby sterilizing them. At the conclusion of the cycle, steam is exhausted through the steam exhaust valve (E). »» Is it the steam or the pressure that kills microorganisms in an autoclave? Explain.
7.1: Tools
Autoclave Quality Assurance A nosocomial outbreak of Pseudomonas in a Thailand hospital illustrates the need to carefully monitor the autoclave during use. The problem began when hospital pharmacists prepared bottles of basal salts solution for use in the hospital operating rooms. To sterilize the solutions, the bottles were placed in the autoclave and left to run on its automatic cycle. The bottles were then delivered to surgery to be used to irrigate the eyes of patients undergoing cataract surgery. Some bottles were left unused. Following surgery, three cataract patients develAn autoclave can be used to sterilize many dry and oped eye inflammations. The organism isolated from the liquid materials. patients was a pathogenic strain of Pseudomonas and the infected patients were treated with antibiotics. Health investigators tested the unused bottles of salt solution as well as the tubes attached to the now-empty bottles. They found the identical strain of Pseudomonas. Examining the pharmacy records, investigators noted that the autoclave pressure had reached only 10 to 12 lb/in2, rather than the required 15 lb/in2. The salts solution apparently was not sterilized. There are several ways to assure that materials are properly sterilized. Autoclaves have temperature and pressure gauges visible from the outside and most models can produce a paper record of the temperature, time, and pressure. To gauge the success of sterilization, materials usually are autoclaved with autoclave tape, which turns color if the object inside the material has been autoclaved correctly. Biological indicators also can be used. A strip containing spores of Geobacillus stearothermophilus can be included with the objects treated. At the conclusion of the cycle, the strip is placed in a nutrient broth medium and incubated. If the sterilization process has been unsuccessful, the spores will germinate and their metabolism will change the color of a pH indicator in the growth medium.
196
62582_CH07_189_221.pdf 196
2/4/10 2:21 PM
7.2 Physical Methods of Control
air out of the sterilizing chamber at the beginning of the cycle. Saturated steam then is used at a temperature of 132°C to 134°C at a pressure of 28 to 30 lb/in2. The time for sterilization is now reduced to as little as four minutes. A vacuum pump operates at the end of the cycle to remove the steam and dry the load. The major advantages of the prevacuum autoclave are the minimal exposure time for sterilization and the reduced time to complete the cycle. Sterilization without Pressurized Steam. In the years before the development of the autoclave, liquids and other objects were sterilized by exposure to free-flowing steam at 100°C for 30 minutes on each of three successive days, with incubation periods at room temperature between the steaming. The method was called fractional sterilization because a fraction of the sterilization was accomplished on each day. It was also called tyndallization after its developer, John Tyndall. Sterilization by the fractional method is achieved by an interesting series of events. During the first day’s exposure, steam kills virtually all organisms except bacterial spores. During overnight incubation, the spores germinate and the viable cells multiply only to be killed on the second day’s 100ºC exposure. Again, the material is cooled and any remaining spores may germinate, the resulting cells only to be killed on the third day. Although the method usually results in sterilization, occasions arise when several spores fail to germinate. The method also requires that spores be in a suitable medium, such as broth, for germination. Fractional sterilization has assumed renewed importance in modern microbiology with the development of high-technology instrumentation and new chemical substances. Often, these materials cannot be sterilized at autoclave temperatures, or by long periods of boiling or baking, or with chemicals. Pasteurization. The final example of moist heat involves the process of pasteurization, which reduces the bacterial population of a liquid such as milk and destroys organisms that may cause spoilage and human disease ( FIGURE 7.7 ). Spores are not affected by pasteurization. One method for milk pasteurization, called the holding (or batch) method, involves heating at 63°C for 30 minutes. Although any thermophilic
62582_CH07_189_221.pdf 197
197
FIGURE 7.7 The Pasteurization of Milk. Milk is pasteurized by passing the liquid through a heat exchanger. The flow rate and temperature are monitored carefully. Following heating, the liquid is rapidly cooled. »» Why is the liquid rapidly cooled?
bacteria would thrive at this temperature, they are of little consequence because they cannot grow at body temperature. For decades, pasteurization has been aimed at destroying Mycobacterium tuberculosis, long considered the most heat-resistant bacterial species. More recently, however, attention has shifted to destruction of Coxiella burnetii, the agent of Q fever (Chapter 10), because this bacterial organism has a higher resistance to heat. Because both organisms are eliminated by pasteurization, dairy microbiologists assume other pathogenic bacteria also are destroyed. Pasteurization also is used to eliminate the Salmonella and Escherichia coli that can contaminate fruit juices. Two other methods are the flash pasteurization method at 71.6°C for 15 seconds and the ultra high temperature (UHT) method at 140°C for 3 seconds. The UHT method is the only method that sterilizes the liquid (MICROFOCUS 7.2). These methods are discussed in Chapter 25. Although heat is a valuable physical agent for controlling microorganisms, sometimes it is impractical to use. For example, no one would suggest removing the microbial population from a tabletop by using a Bunsen burner, nor can heatsensitive solutions be subjected to an autoclave. In instances such as these and numerous others, a heat-free method must be used. CONCEPT AND REASONING CHECKS
7.4 Summarize the ways that moist heat controls or sterilizes materials or beverages.
2/4/10 2:21 PM
198
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
7.2: Being Skeptical
Milk Stays Fresh Longer If It’s Organic If you ever go shopping for milk at the local market, or especially one specializing in “natural and organic foods,” you might notice that the “Best by” date expires much sooner on a carton of regular milk than on one that is organic milk. In fact, the date on the organic milk may be some 3 weeks longer than on the regular milk, which typically is 5 to 7 days from the store delivery date. So, being organic, does that ensure a longer shelf life? The fact that the milk is organic has nothing to do with its longer shelf life. Labeling the milk as “organic” only means that the cows on the dairy farm were not given antibiotics or hormones like bovine growth hormone (BGH), which stimulates a cow’s milk production (see figure). The reason it has a longer A carton of organic milk. shelf life is due to the pasteurization process. Organic milk is subjected to the ultra high temperature (UHT) process (ultrapasteurized) where the milk is heated to 140°C for three seconds. This kills all the microorganisms that may be in the liquid—it is sterile. Most regular milk today is subjected to the flash pasteurization method where the milk is at about 72°C for 15 seconds. This “high temperature, short duration” process does not kill all microbes that may be in the milk; only the pathogens have been eliminated. Because there are bacterial species that are psychrotolerant, the milk can spoil if left on the refrigerated shelf too long. Regular milk also could be subjected to UHT. However, it usually is not because it has to travel only a short distance to market; organic products, on the other hand, are not often produced throughout the country, so they have further to travel to reach the consumer. So, UHT preserves the product longer. Although not found commonly within the United States, room-temperature Parmalat milk is a product of UHT and can be found commonly in Europe and other parts of the world. The verdict? “Organic” is not defined as “longer shelf life.” If shelf life is important to you, simply look for products treated by UHT. Also of note: UHT does burn some of the sugars in the milk, so the milk may taste slightly “caramelized,” something some people find less tasty.
Filtration Traps Microorganisms KEY CONCEPT
5.
Filtration removes microbes from the air or water.
Filters came into prominent use in microbiology as interest in viruses grew during the 1890s. Previous to that time, filters were used to trap airborne organisms and sterilize bacteriological media, but they became essential for separating viruses from other microorganisms. Among the early pioneers of filter technology was Charles Chamberland, an associate of Pasteur. His porcelain filter was important to early virus research. Another pioneer was Julius Petri (inventor of the Petri dish), who developed a sand filter to separate bacterial cells from the air. Filtration is a mechanical method that can be used to remove microorganisms from a solution or gas. Several types of filters are used in the microbiology laboratory.
62582_CH07_189_221.pdf 198
The most common is the membrane filter, which consists of a pad of cellulose acetate or polycarbonate mounted in a holding device ( FIGURE 7.8A ). As fluid passes through the filter, organisms are trapped in the pores of the filtering material. The solution dripping through the filter into the receiving container is decontaminated or, in some cases, sterilized. Membrane filters are used to purify such heat-sensitive liquids as beverages, some bacteriological media, toxoids, many pharmaceuticals, and blood solutions. The membrane filter is particularly valuable because bacterial cells trapped on the filter multiply and form colonies on the filter pad when the pad is placed on a plate of culture medium. Microbiologists then can count the colonies to determine the number of bacteria originally present ( FIGURE 7.8B, C ).
2/4/10 2:21 PM
7.2 Physical Methods of Control
199
Filter
Filter (B)
"Sterilized" liquid
Vacuum pump creates suction
(A) (a)
(C) FIGURE 7.8 The Principle of Filtration. Filtration is used to remove microorganisms from a liquid. The effectiveness of the filter is proportional to the size of its pores. (A) Bacteria-laden liquid is poured into a filter, and a vacuum pump helps pull the liquid through and into the flask below. The bacterial cells are larger than the pores of the filter, and they become trapped. (B) A view of Escherichia coli cells trapped in the pores of a 0.45-µm nylon membrane filter. (Bar = 5 µm.) (C) E. coli colonies growing on a membrane filter. »» Why aren’t viruses also trapped on the filter?
Air also can be filtered to remove microorganisms. The filter generally used is a high-efficiency particulate air (HEPA) filter, which consists of a mat of randomly arranged fibers that trap particles, microorganisms, and spores. As part of a biological safety cabinet, HEPA filters can trap over 99% of all particles, including microorganisms and spores with a diameter larger than 0.3 µm ( FIGURE 7.9 ). The air entering surgical units and specialized treatment facilities, such as burn units, also are HEPA filtered to exclude microorganisms. In some hospital wards, such as for respiratory diseases and in certain pharmaceutical filling rooms, the air is recirculated through HEPA filters to ensure air purity. CONCEPT AND REASONING CHECKS
7.5 Determine the uses for filtration in a health care setting.
62582_CH07_189_221.pdf 199
FIGURE 7.9 A Biological Safety Cabinet. The cabinet shown has a metal grid at the top that covers a HEPA filter through which air enters the cabinet. As the filtered air, free of contaminants and microbes, moves into and across the workspace, it exits out the bottom front and rear. A UV light is also positioned at the top rear to decontaminate the metal surfaces maintaining a contaminant-free workspace when the cabinet is not in use. »» Why is air moved out of the cabinet rather than into the cabinet?
2/4/10 2:21 PM
200
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
Ultraviolet Light Can Be Used to Control Microbial Growth KEY CONCEPT
6.
UV light can be bactericidal.
Visible light is a type of radiant energy detected by the light-sensitive cells of the eye. The wavelength of this energy is between 400 and 800 nanometers (nm). Other types of radiation have wavelengths longer or shorter than that of visible light, and therefore cannot be detected by the human eye. One type of radiant energy, ultraviolet (UV) light, is useful for controlling microorganisms. Ultraviolet light has a wavelength between 100 and 400 nm, with the energy at about 265 nm most destructive to bacterial cells ( FIGURE 7.10 ). When microorganisms are subjected to UV light, cellular DNA absorbs the energy, and adjacent thymine molecules (in the same strand) link together, kinking the double helix and disrupting DNA replication (Chapter 8). The damaged organism can no longer produce critical proteins or reproduce, and it quickly dies. Ultraviolet light effectively reduces the microbial population where direct exposure takes place. It is used to limit airborne or surface contamination in a hospital room, morgue, pharmacy, toilet 100 nm
200 nm
300 nm
400 nm
500 nm
600 nm
700 nm
Sunlight Bactericidal (wavelength) Ultraviolet portion of spectrum
Visible portion of spectrum Longer wavelengths
Shorter wavelengths
Infrared rays (microwaves) Cosmic rays
Gamma rays
10-6 10-5 10-4 10-3 10-1 100 Ionizing
Radio waves
X rays Solar rays reaching earth
Radar Television Radio
103 104 105 106 107 108 Wavelength (nm)
109
Electromagnetic
The Ionizing and Electromagnetic Spectrum of Energies. The complete spectrum is presented at the bottom of the chart, and the ultraviolet and visible sections are expanded at the top. Notice how the bactericidal energies overlap with the UV portion of sunlight. This may account for the destruction of microorganisms in the air and in upper layers of soil. »» How does UV light kill bacteria? FIGURE 7.10
62582_CH07_189_221.pdf 200
facility, or food service operation. It is noteworthy that UV light from the sun may be an important factor in controlling microorganisms in the air and upper layers of the soil, but it may not be effective against all bacterial spores. Ultraviolet light does not penetrate liquids or solids, and it can lead to human skin cancer. CONCEPT AND REASONING CHECKS
7.6 Identify some uses for UV light as a physical control method.
Other Types of Radiation Also Can Sterilize Materials KEY CONCEPT
7.
X rays and gamma rays also are microbicidal.
Looking back at Figure 7.10, there are two other forms of radiation useful for destroying microorganisms. These are X rays and gamma rays. Both have wavelengths shorter than the wavelength of UV light. As X rays and gamma rays pass through microbial molecules, they force electrons out of their shells, thereby creating ions. For this reason, the radiations are called ionizing radiations. The ions quickly combine, mainly with cellular water, and the free radicals generated affect cell metabolism and physiology. Ionizing radiations currently are used to sterilize such heat-sensitive pharmaceuticals as vitamins, hormones, and antibiotics as well as certain plastics and suture materials. Ionizing radiations also have been approved for controlling microorganisms, and for preserving foods, as noted in MICROFOCUS 7.3. The approval has generated much controversy, fueled by activists concerned with the safety of factory workers and consumers. First used in 1921 to inactivate Trichinella spiralis, the agent of trichinellosis, irradiation now is used as a preservative in more than 40 countries for over 100 food items, including potatoes, onions, cereals, flour, fresh fruit, and poultry ( FIGURE 7.11A ). The U.S. Food and Drug Administration (FDA) approved cobalt-60 and cesium-137 irradiation to preserve or extend the shelf life of several foods. This includes irradiating poultry and red meats such as beef, lamb, and pork. In 2008, the FDA approved the irradiation of fresh and bagged spinach, and iceberg lettuce, to reduce potential foodborne illness. Irradiation has been used to prepare many meals for the U.S. military and the American astronauts ( FIGURE 7.11B ). What is called
2/4/10 2:21 PM
7.2 Physical Methods of Control
201
7.3: Public Health
“No, the Food Does Not Glow!” In the United States, there are more than 76 million cases of foodborne disease accounting for more than 300,000 hospitalizations and 5,000 deaths each year. One major source of foodborne disease is agricultural produce contaminated with intestinal pathogens. Another source is from improperly cooked or handled meats, or poultry harboring human intestinal pathogens, such as Escherichia coli O157:H7, Campylobacter, Listeria, and Salmonella. Irradiation has the potential to greatly limit such illnesses. The Centers for Disease Control and Irradiated strawberries displaying the “radura” symbol, Prevention (CDC) have estimated that if just 50% of meaning they have been treated by irradiation. the meat and poultry sold in the United States was irradiated, there would be 900,000 fewer cases of foodborne illness and 350 fewer deaths each year. Yet today manufacturers continue to wrestle with the concept of food irradiation as they constantly confront a leery public, some of who still have visions of Hiroshima and Nagasaki. In the United States, just 10% of the herbs and spices are irradiated and only 0.002% of fruits, vegetables, meats, and poultry are irradiated. Food irradiation is entirely different from atomic radiation. The irradiation comes from gamma rays produced during the natural decay of cobalt-60 or cesium-137. The most common method involves electron beams (e-beams) not unlike those used in an electron microscope. None of these types of radiations produce radioactivity—the irradiated food does not glow (see figure). Low doses of irradiation are used for disinfestations and extending the shelf life of packaged foods. As mentioned in the chapter narrative, a pasteurizing dose is used on meats, poultry, and other foods. Such levels do not eliminate all microbes in the food, but, similar to pasteurization, helps to reduce the dangers of pathogen-contaminated or cross-contaminated meats and poultry. During the irradiation, the gamma rays or electrons penetrate the food, and, just as in cooking, cause molecular changes in any contaminating microorganisms, which ultimately leads to their death. Irradiation of foods also has its limitations. The irradiation dose will not kill bacterial endospores, inactivate viruses, or neutralize toxins. Therefore, irradiated food still must be treated in a sanitary fashion. Nutritional losses are similar to those occurring in cooking and/or freezing. Otherwise, there are virtually no known changes in the food, and there is no residue.
(A)
(B)
Food Irradiation. (A) The FDA has approved irradiation as a preservation method for numerous foods, including many fruits and vegetables, as well as poultry and red meats. (B) Many otherwise perishable foods eaten by NASA astronauts are prepared by irradiation. »» Does irradiation sterilize the treated product? Explain. FIGURE 7.11
62582_CH07_189_221.pdf 201
2/4/10 2:21 PM
202
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
7.4: Public Health
Microwave That Sponge! Kitchens are often considered to be one of the microbially dirtiest places in the home. Raw fruits, vegetables, and especially meats and poultry can carry substantial microbes that can end up on cutting boards, washcloths, and especially that kitchen sponge. These “hot spots” need to be kept clean with disinfectants and sanitized. But how do you clean that kitchen sponge that harbors millions of bacterial cells picked up in the juices from raw chicken or ground beef? Microwave it! A study published in the Journal of Environmental Health in 2006 suggests that putting that kitchen A sponge can be microwaved to kill microbial sponge or plastic scrubbing pad in the microwave contaminants. oven for two minutes will kill bacterial pathogens like Escherichia coli and Campylobacter jejuni, two species commonly found on raw ground beef and chicken (see figure). Simply washing the sponge and placing it in the dishwasher may clean it, but it will not get rid of bacteria buried deep in the nooks and crannies of the sponge. The sponge needs to be decontaminated. The University of Florida researchers came to their conclusions after doing experiments with sponges and pads that were soaked in wastewater containing E. coli cells, Bacillus cereus endospores, and a “co*cktail” of other microbes and viruses. The researchers used a standard kitchen microwave oven to heat the sponges and scrub pads for varying lengths of time. They were then squeezed to remove the water from which the researchers determined the microbes remaining. They compared the test sponges and pads with control sponges and pads that had been soaked but not placed in the microwave oven. Just two minutes of microwaving on full power killed or inactivated more than 99% of all the bacterial cells and viruses in the sponges and pads; four minutes was necessary to kill the B. cereus endospores (not surprising for such resistant structures). Because microwaves work by exciting water molecules and generating frictional heat, rather than by the direct effects of the microwave radiation, it is important to make sure the sponge or scrubbing pad is wet before putting it in the microwave. And how often should you microwave that sponge? The University of Florida researchers suggest every other day should be fine.
a pasteurizing dose is used on meats, poultry, and other foods. Such levels are not intended to eliminate all microbes in the food, but, like pasteurization of milk, to eliminate the pathogens. The foods are not necessarily sterile. Another form of energy, the microwave, has a wavelength longer than that of ultraviolet light and visible light. In a microwave oven, microwaves are absorbed by water molecules, which are set into high-speed motion, and the heat of friction from these excited molecules is transferred to foods. In fact, the microwave can be an excellent way to sterilize your kitchen sponge (MICROFOCUS 7.4). CONCEPT AND REASONING CHECKS
7.7 Identify some uses for X rays and gamma rays as a physical control method.
62582_CH07_189_221.pdf 202
Preservation Methods Retard Spoilage by Microorganisms in Foods KEY CONCEPT
8.
Dehydration and cold temperatures slow microbial growth.
Over the course of many centuries, various physical methods have evolved for controlling microorganisms in food. Though valuable for preventing the spread of infectious agents, these procedures are used mainly to retard spoilage and prolong the shelf life of foods, rather than for sterilization. Irradiation is an example of a preservation method. Drying is useful in the preservation of various meats, fish, cereals, and other foods. Because water is necessary for life, it follows that where
2/4/10 2:21 PM
7.2 Physical Methods of Control
there is no water, there is virtually no life. Many nonperishable foods (such as cereals, rice, and sugar) in the kitchen pantry represent such shelfstable products. Preservation by salting is based upon the principle of osmotic pressure. When food is salted (usually sodium chloride), water diffuses out of microorganisms toward the higher salt concentration and lower water concentration in the surrounding environment. This flow of water, called osmosis, leaves the microorganisms dehydrated, and they die. The same phenomenon occurs in highly sugared foods (usually sucrose) such as syrups, jams, and jellies. However, fungal contamination (molds and yeasts) and growth at the surface may occur because they can tolerate low water and high sugar concentrations. Low temperatures found in the refrigerator and freezer retard spoilage by lowering the metabolic rate of microorganisms and thereby reducing
their rate of growth (see Chapter 5). Spoilage is not totally eliminated in cold foods, however, and many psychrotrophs remain alive, even at freezer temperatures. These organisms multiply rapidly when food thaws, which is why prompt cooking is recommended. Note in these examples that there are significant differences between killing microorganisms, holding them in check, and reducing their numbers. The preservation methods are described as bacteriostatic because they prevent the further multiplication of food-borne pathogens such as Salmonella and Clostridium. A more complete discussion of food preservation as it relates to public health is presented in Chapter 25. TABLE 7.1 and FIGURE 7.12 summarize the physical agents used for controlling microorganisms.
203
Osmotic pressure: The pressure applied to a solution to stop the inward diffusion (osmosis) of a solvent through a semipermeable membrane.
CONCEPT AND REASONING CHECKS
7.8 Explain how salting foods acts as a preservation method.
TABLE
7.1
A Summary of Physical Agents Used to Control Microorganisms
Physical Method
Conditions
Instrument
Object of Treatment
Examples of Uses
Incineration
A few seconds
Flame
All microorganisms
Laboratory instruments
Hot air
160°C for 2 hr
Oven
Bacterial spores
Boiling water
100°C for 10 min
— —
Pressurized steam
100°C for 2 hr+ 121°C for 15 min at 15 lb/in2
Autoclave
Vegetative microorganisms Bacterial spores Bacterial spores
Glassware Powders Oily substances Wide variety of objects
Fractional sterilization
30 min/day for 3 successive days
Sterilizer
Bacterial spores
Pasteurization
Pasteurizer
Pathogenic microorganisms
Filtration
Holding method Flash method UHT method Entrapment in pores
All microorganisms
Ultraviolet light
265 nm energy
Membrane filter HEPA filter Generator
All microorganisms
X rays Gamma rays Dehydration
Short wave-length energy Osmotic conditions
Generator
All microorganisms
—
All microorganisms
Refrigeration/ Freezing
5°C/–10°C
Refrigerator/ Freezer
All microorganisms
62582_CH07_189_221.pdf 203
Instruments Surgical materials Solutions and media Materials not sterilized by other methods Dairy products Beverages Fluids Air Surface and air sterilization Heat-sensitive materials Salted and sugared foods Numerous foods
Comment
Object must be disposable or heat-resistant Not useful for fluid materials Total immersion and precleaning necessary Broad application in microbiology Long process Sterilization not assured Sterilization achieved with UHT Many adaptations Not useful in fluids Extending food shelf life Food preservation Spoilage/Food preservation
2/4/10 2:22 PM
204
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
Physical Methods of Control which include
Heat
Filtration
which can be in the form of
Dry heat
Low Temperature
that includes
in the form of
using a
Moist Heat
using
Radiant Energy
Membrane filter
by
HEPA filter
UV light
Ionizing radiations
Refrigeration
Freezing
to sterilize in the form of Liquids
Hot air oven
X rays
Air
Gamma rays
Incineration through
Direct flame
Boiling water
Steam
under pressure using Autoclave Prevacuum autoclave
Pasteurization
that can be carried out by
not under pressure using
Fractional sterilization
that accomplishes
that accomplishes Flash method Holding method
Elimination of pathogens and inhibition of growth and division
Ultrahigh temperature (UHT) method
Sterilization
FIGURE 7.12 A Concept Map Summarizing the Physical Methods of Microbial Control. Note that some methods sterilize while others tend to inhibit growth and division. »» What is common to most of the sterilization methods?
7.3
General Principles of Chemical Control
Sanitation and disinfection methods are not unique to the modern era. The Bible refers often to cleanliness and prescribes certain dietary laws to prevent consumption of what was believed to be contaminated food. Egyptians used resins and aromatics for embalming, and ancient peoples
62582_CH07_189_221.pdf 204
burned sulfur for deodorizing and sanitary purposes. Arabian physicians first suggested using mercury to treat syphilis. Over the centuries, spices were used as preservatives as well as masks for foul odors, making Marco Polo’s trips to Asia for new spices a necessity as well as an adventure.
2/4/10 2:22 PM
7.3 General Principles of Chemical Control
(A) (a) Antiseptic
205
(B) (b) Disinfectant
FIGURE 7.13 Sample Uses of Antiseptics and Disinfectants. (A) Antiseptics are used on body tissues, such as on a wound or before piercing the skin to take blood. (B) A disinfectant is used on inanimate objects, such as equipment used in an industrial process or tabletops and sinks. »» Why aren’t disinfectants normally used as antiseptics?
And fans of Western movies probably have noted that American cowboys practiced disinfection by pouring whiskey onto gunshot wounds. Chemical Control Methods Are Dependent on the Object to Be Treated KEY CONCEPT
9.
Disinfectants and antiseptics are key to proper sanitation and public health.
As early as 1830, the United States Pharmacopoeia listed tincture of iodine as a valuable antiseptic, and soldiers in the Civil War used it in plentiful amounts. Joseph Lister established the principles of aseptic surgery using carbolic acid (phenol) for treating wounds (see Chapter 1). As we have discussed, the physical agents for controlling microorganisms generally are intended to achieve sterilization. Chemical agents, by contrast, rarely achieve sterilization. Instead, they are expected only to destroy the pathogenic organisms on or in an object or area. The process of destroying pathogens is called disinfection and the object is said to be disinfected. If the object
62582_CH07_189_221.pdf 205
treated is lifeless, such as a tabletop, the chemical agent used is called a disinfectant. However, if the object treated is living, such as a tissue of the human body, the chemical agent used is an antiseptic ( FIGURE 7.13 ). It is important to note that even though a particular chemical may be used as a disinfectant as well as an antiseptic (e.g., iodine), the precise formulations are so different that its ability to kill or inactivate microorganisms differs substantially in the two products. Antiseptics and disinfectants are usually microbicidal; they inactivate the major enzymes of an organism and interfere with its metabolism so that it dies. A chemical also may be microbiostatic, disrupting minor chemical reactions and slowing the metabolism, which results in a longer time between cell divisions. Although a subtle difference sometimes exists between the two chemical agents, the terms indicate effectiveness in a particular situation. The word sepsis (seps = “putrid”) refers to a condition in which microbes or their toxins are present in tissues or the blood; thus, we have septicemia, meaning “microbial infection of the
Tincture: A substance dissolved in alcohol.
2/4/10 2:22 PM
206
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
FIGURE 7.14 A Pathogen-Contaminated Operating Room. Following a “dirty operation” (for an infectious disease), the operating room (OR) may have become broadly contaminated with the pathogen. The purple areas indicate where the pathogen was cultured from a swab sample. »» Will the OR need to be sterilized, disinfected, or sanitized? Explain.
blood,” and antiseptic, “against infection.” It also is the origin of the term asepsis, meaning “free of disease-causing microbes.” Other expressions are associated with chemical control. To sanitize an object is to reduce the microbial population to a safe level as determined by public health standards. For example, in dairy and food-processing plants, the equipment usually is sanitized through the process of sanitization. Commercial establishments, such as restaurants, depend on disinfectants to maintain a sanitary kitchen and work establishment. To degerm an object is merely to remove organisms from its surface. Washing with soap and water degerms the skin surface but has little effect on microorganisms deep in the skin pores. FIGURE 7.14 illustrates the extent of “cleanup” necessary in an operation room following an operation on an infected patient. CONCEPT AND REASONING CHECKS
7.9 Distinguish between (a) an antiseptic and a disinfectant and (b) disinfection and sanitization.
Chemical Agents Are Important to Laboratory and Hospital Safety KEY CONCEPT
10. Disinfectants and antiseptics are defined by their properties.
62582_CH07_189_221.pdf 206
To be useful as an antiseptic or disinfectant, a chemical agent must have a number of properties. The agent should be: • Able to kill or slow the growth of microorganisms. • Nontoxic to animals or humans, especially if it is used as an antiseptic. • Soluble in water and have a substantial shelf life during which its activity is retained. • Useful in much diluted form and able to perform its job in a relatively short time. Other characteristics also will contribute to the value of a chemical agent: It should not separate on standing, it should penetrate well, and it should not corrode instruments. The chemical will have a distinct advantage if it does not combine with organic matter such as blood or feces, because organic matter can bind and “use up” the chemical. Of course, the chemical should be easy to obtain and relatively inexpensive. Because disinfection is essentially a chemical process, several chemical parameters should be considered when selecting an antiseptic or disinfectant. • Temperature. It is important to know at what temperature the disinfection is to take place because a chemical reaction occurring at 37°C (body temperature) may not occur at 25°C (room temperature). • pH. A particular chemical may be effective at a certain pH but not another. • Stability. The chemical reaction may be very rapid with one agent and slower with another. Thus, if long-term disinfection is desired, the second agent may be preferable. Two other considerations are the type of microorganism to be eliminated and the surface treated. For instance, the removal of bacterial spores requires more vigorous treatment than the removal of vegetative cells. Also, a chemical applied to a laboratory bench is considerably different from one used on a wound or for sterilizing an object. It therefore is imperative to distinguish the antiseptic or disinfectant nature of a chemical before proceeding with its use. Indeed, chemical agents formulated as disinfectants are regu-
2/4/10 2:22 PM
7.3 General Principles of Chemical Control
207
TABLE
7.2
Phenol Coefficients of Some Common Antiseptics and Disinfectantsa
Chemical Agent
Staphylococcus aureus
Phenol Chloramine Tincture of iodine Lysol Mercurochrome Ethyl alcohol Formalin Cetylpyridinium chloride aAll
1 133 6.3 3.5 5.3 0.04 0.3 337
Salmonella typhi
1 100 5.8 1.9 2.7 0.04 0.7 228
PC values were determined at 37°C.
lated and registered by the U.S. Environmental Protection Agency (EPA), while chemicals formulated as antiseptics are regulated by the FDA. CONCEPT AND REASONING CHECKS
7.10 Summarize the properties important in the selection of a disinfectant or antiseptic.
Antiseptics and Disinfectants Can Be Evaluated for Effectiveness KEY CONCEPT
11. Standards have been established to know the relative effectiveness of a chemical agent.
Currently, there are more than 8,000 disinfectants and antiseptics for hospital use and thousands more for general use. Evaluating these chemical agents is a tedious process because of the broad diversity of conditions under which they are used. One measure of effectiveness for chemical agents is the phenol coefficient (PC). This is a number indicating the disinfecting ability of an antiseptic or disinfectant in comparison to phenol under identical conditions ( TABLE 7.2 ). A PC higher than 1 indicates the chemical is more effective than phenol; a number less than 1 indicates poorer disinfecting ability than phenol. For example, antiseptic A may have a PC of 78.5, while antiseptic B has a PC of 0.28. These numbers are used relative to each other rather than to phenol because phenol is allergenic and irritating to tissues and thus is not used in a concentrated form.
62582_CH07_189_221.pdf 207
The phenol coefficient is determined by a laboratory procedure in which dilutions of phenol and the test chemical are mixed with standardized bacterial species, such as Staphylococcus aureus, Salmonella typhi, or other species. The laboratory technician then determines which dilutions have killed the organisms after a 10-minute exposure but not after a 5-minute exposure. The test has many drawbacks, especially because it is performed in the laboratory rather than in a real-life situation. Nor does it take into account many of the factors cited above, such as tissue toxicity, activity in the presence of organic matter, or temperature variations. A more practical way of determining the value of a chemical agent is by an in-use test. For example, swab samples from a floor are taken before and after the application of a disinfectant to determine the level of disinfection. Another method is to dry standardized cultures of a bacterial species on small stainless steel cylinders and then expose the cylinders to the test chemical. After an established period of time, the organism is tested for survival rates. These methods of standardization have value under certain circ*mstances. However, it is conceivable that a universal test may never be developed, in view of the huge variety of chemical agents available and the numerous conditions under which they are used. CONCEPT CO C AND REASONING SO G C CHECKS C S
7.11 Assess the need to know a chemical agent’s effectiveness.
2/4/10 2:22 PM
208
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
7.4
Chemical Methods of Control
The chemical agents currently in use for controlling microorganisms range from very simple substances, such as halogen ions, to very complex compounds, typified by detergents. Many of these agents in nature have been used for generations, while others represent the latest products of chemical companies. In this section, we shall survey several groups of chemical agents and indicate how they are best applied in the chemical control of microorganisms. MICROFOCUS 7.5 identifies some common but surprising antiseptics. +
Halogens Oxidize Proteins
–
Na [OCl]
Sodium hypochlorite 2+
Ca
KEY CONCEPT
12. Chlorine and iodine are good disinfectant agents.
–
[OCl]
2
Calcium hypochlorite
The halogens are a group of highly reactive elements whose atoms have seven electrons in the outer shell (see Chapter 2). Two halogens, chlorine and iodine, are commonly used for disinfection. In microorganisms, halogens are believed to cause the release of atomic oxygen, which then combines with and inactivates certain cytoplasmic
proteins, such as enzymes. Killing almost always occurs within 30 minutes after application. Chlorine (Cl) is effective against a broad variety of organisms, including most grampositive and gram-negative bacteria, and many viruses, fungi, and protozoa. However, it is not sporicidal. Chlorine is available in a gaseous form and as both organic and inorganic compounds ( FIGURE 7.15 ). It is widely used in municipal water supplies and swimming pools, where it keeps microbial populations at low levels. Chlorine combines readily with numerous ions in water; therefore, enough chlorine must be added to ensure a residue remains for antimicrobial activity. In municipal water, the residue of chlorine is usually about 0.2 to 1.0 parts per million (ppm) of free chlorine. One ppm is equivalent to 0.0001 percent, an extremely small amount. Chlorine also is available as sodium hypochlorite (Clorox®) or calcium hypochlorite. The latter, also known as chlorinated lime, was used by Semmelweis in his studies (see Chapter 1).
City Water Supply CHLORINE
FIGURE 7.15 Some Practical Applications of Disinfection with Chlorine Compounds. Different chlorine compounds have been used as both disinfectants and antiseptics. »» In each of the above illustrations, is the chemical agent being used as a disinfectant or an antiseptic?
62582_CH07_189_221.pdf 208
2/4/10 2:22 PM
7.5: Being Skeptical
Antiseptics in Your Pantry? Today, we live in an age when alternative and herbal medicine claims are always in the news, and these reports have generated a whole industry of health products that often make unbelievable claims. With regard to “natural products,” are there some that have genuine medicinal and antiseptic properties? Cinnamon Professor Daniel Y. C. Fung, Professor of Food Science and Food Microbiology at Kansas State University in Manhattan, Kansas, believes cinnamon might be an antiseptic that can control pathogens, at least in fruit beverages. Fung’s group added cinnamon to commercially pasteurized apple juice. They then added typical foodborne pathogens (Salmonella typhimurium, Yersinia enterocolitica, and Staphylococcus aureus) and viruses. After one week of monitoring the juice at refrigerated and room temperatures, the investigators discovered the pathogens were killed more readily in the cinnamon blend than in the cinnamon-free juice. In addition, more bacterial organisms and viruses were killed in the juice at room temperature than when refrigerated. Garlic In 1858, Louis Pasteur examined the properties of garlic as an antiseptic. During World War II, when penicillin and sulfa drugs were in short supply, garlic was used as an antiseptic to disinfect open wounds and prevent gangrene. Since then, numerous scientific studies have tried to discover garlic’s antiseptic powers. Many research studies have identified a sulfur compound, allicin, as one key to garlic’s antiseptic properties. When a raw garlic clove is crushed or chewed, allicin gives garlic its characteristic taste and smell. Laboratory studies using garlic suggest that this compound is responsible for combating the microbes causing the common cold, flu, sore throat, sinusitis, and bronchitis. The findings indicate that the compound blocks key enzymes that bacterial cells and viruses need to invade and damage host cells. Honey For nearly three decades, Professor Peter Molan, associate professor of biochemistry and director of the Waikato Honey Research Unit at the University of Waikato, New Zealand, has been studying the medicinal properties of and uses for honey. Its acidity, between 3.2 and 4.5, is low enough to inhibit many pathogens. Its low water content (15% to 21% by weight) means that it osmotically ties up free water and “drains water” from wounds, helping to deprive pathogens of an ideal environment in which to grow. In addition, when honey encounters fluid from a wound, it slowly releases small quantities of hydrogen peroxide that are not damaging to skin tissues. It also speeds wound healing. If that isn’t enough, there also is evidence that honey protects against tooth decay. Professor Molan’s group has shown that, in the lab, honey completely inhibits the growth of plaque-forming bacterial species, including Streptococcus mitis, S. sobrinus, and Lactobacillus caseii. Honey cut acid production to almost zero and stopped the bacteria from producing dextran, which is a component of dental plaque. Like its use for wound infections, hydrogen peroxide probably is, in part, responsible for the antimicrobial activity. But beware! Not all honey is alike. The antibacterial properties of honey depend on the kind of nectar, or plant pollen, that bees use to make honey. At least manuka honey from New Zealand and honeydew from central Europe are thought to contain useful levels of antiseptic potency. Professor Molan is convinced that “honey belongs in the medicine cabinet as well as the pantry.” Wasabi The green, pungent, Japanese horseradish called wasabi may be more than a spicy condiment for sushi. Professor Hedeki Masuda, director of the Material Research and Development Laboratories at Ogawa & Co. Ltd., in Tokyo, Japan, and his colleagues have found that natural chemicals in wasabi, called isothiocyanates, inhibit the growth of Streptococcus mutans—one of the bacterial species causing tooth decay. Researchers tested wasabi’s tooth-decay fighting ability in test tubes and found the substance interferes with the way sugar affects teeth. At this point, these are only test-tube laboratory studies and the results will need to be proven in clinical trials. So, are there products having genuine antimicrobial properties? It appears so—and there are many more than can be described here.
209
62582_CH07_189_221.pdf 209
2/4/10 2:22 PM
210
CHAPTER 7
—
O
O S
Na+
N– Cl
H 3C
Chloramine-T Chloramine-T
Control of Microorganisms: Physical and Chemical Methods
Hypochlorite compounds cause cellular proteins to clump together, destroying their function. To disinfect clear water for drinking, the Centers for Disease Control and Prevention (CDC) recommends a half-teaspoon of household chlorine bleach in two gallons of water, with 30 minutes of contact time before consumption. Hypochlorites also are useful in very dilute solutions for sanitizing commercial and factory equipment. The chloramines, such as chloramine-T, are organic compounds used as bactericides and for the disinfection of drinking water. The iodine atom (I) is slightly larger than the chlorine atom and is more reactive and more germicidal. A tincture of iodine, a commonly used antiseptic for wounds, consists of 2% iodine. For the disinfection of clear water, the CDC recommends five drops of an iodine tincture in one quart of water, with 30 minutes of contact time before consumption. Iodine compounds in different forms are also valuable sanitizers for restaurant equipment and eating utensils. Iodophors are iodine linked to a solubilizing agent, such as a detergent or nondetergent carrier. These water-soluble complexes release iodine over a long period of time and have the added advantage of not staining tissues or fabrics. The solubilizing agent loosens the organisms from the surface and diatomic iodine (I2) irreversibly damages the microbe by reacting with enzymes in the respiratory chain (see Chapter 6) and with proteins in the cell membrane and cell wall. Some examples of iodophors are Wescodyne, used in preoperative skin preparations; and Betadine, for local wounds. Iodophors also may be combined with nondetergent carrier molecules. The best known carrier is povidone, which stabilizes the iodine and releases it slowly. However, compounds like these are not self-sterilizing.
remains the standard against which other antiseptics and disinfectants are evaluated using the phenol coefficient test. It is active against grampositive bacteria, but its activity is reduced in the presence of organic matter. Phenol and its derivatives act by denaturing proteins, especially in the cell membrane. Phenol is expensive, has a pungent odor, and is caustic to the skin; therefore, the role of phenol as an antiseptic has diminished ( FIGURE 7.16 ). However, phenol derivatives have greater germicidal activity and lower toxicity than the parent compound. Hexylresorcinol is used in some mouthwashes, topical antiseptics, and throat lozenges. It has the added advantage of reducing surface tension, thereby loosening bacterial cells from tissue and allowing greater penetration of the germicidal agent. Combinations of two phenol molecules called bisphenols are prominent in modern disinfection
OH
Phenol
OH
Orthophenylphenol Cl
OH
OH
Cl
CH2
H
H
CONCEPT AND REASONING CHECKS
Cl
7.12 Compare the uses for chlorine and iodine chemical agents.
Phenol and Phenolic Compounds Denature Proteins KEY CONCEPT
13. Many phenolic derivatives are used as disinfectants or antiseptics.
Phenol (carbolic acid) and phenolic compounds have played a key role in disinfection practices since Joseph Lister used them in the 1860s. Phenol
62582_CH07_189_221.pdf 210
Cl
Cl
Cl
Hexachlorophene OH Cl
Cl O
Cl
Triclosan FIGURE 7.16 Phenol and Some Derivatives. The chemical structure of phenol and some important derivatives. »» Why are most phenolic compounds only used as disinfectants?
2/4/10 2:22 PM
7.4 Chemical Methods of Control
and antisepsis. Orthophenylphenol, for example, is used in Lysol and Amphyl. Another bisphenol, hexachlorophene, was used extensively during the 1950s and 1960s in toothpastes, underarm deodorants, and bath soaps. One product, pHisoHex, combined hexachlorophene with a pH-balanced detergent cream. Pediatricians recommended it to retard staphylococcal infections of the scalp and umbilical stump and for general cleansing of the newborn. However, studies indicate that excessive amounts can be absorbed through the skin and cause neurological damage, so hexachlorophene has been removed from overthe-counter products. The product pHisoHex is still available, but only by prescription. An important bisphenol relative is chlorhexidine. This compound is used as a surgical scrub, hand wash, and superficial skin wound cleanser. A 4% chlorhexidine solution in isopropyl alcohol is commercially available as Hibiclens. Another bisphenol in widespread use is triclosan, a broadspectrum antimicrobial agent that destroys bacterial cells by disrupting cell membranes (and possibly cell walls) by blocking the synthesis of lipids. Triclosan is fairly mild and nontoxic, and it is effective against pathogenic bacteria (but only partially against viruses and fungi). The chemical is included in antibacterial soaps, lotions, mouthwashes, toothpastes, toys, food trays, underwear, kitchen sponges, utensils, and cutting boards. A negative side to extensive triclosan use is the possibility of bacterial species developing resistance to the chemical, just as they have developed resistance to antibiotics. CONCEPT AND REASONING CHECKS
7.13 Explain why bisphenols are preferred as disinfectants and antiseptics.
Heavy Metals Interfere with Microbial Metabolism KEY CONCEPT
14. Mercury, copper, and silver compounds can be useful disinfectants.
Mercury, silver, and copper are called heavy metals because of their large atomic weights and complex electron configurations. They are very reactive with proteins, particularly at the protein’s sulfhydryl groups (–SH), and they are believed to bind protein molecules together by forming
62582_CH07_189_221.pdf 211
bridges between the groups. Because many of the proteins involved are enzymes, cellular metabolism is disrupted, and the microorganism dies. However, heavy metals are not sporicidal. Mercury (Hg) is very toxic to the host and the antimicrobial activity of mercury is reduced when other organic matter is present. In such products as merbromin (Mercurochrome) and thimerosal (Merthiolate), mercury is combined with carrier compounds and is less toxic when applied to the skin, especially after surgical incisions. Thimerosal was previously used as a preservative in vaccines (Chapter 22). Copper (Cu) is active against chlorophyllcontaining organisms and is a potent inhibitor of algae. As copper sulfate (CuSO4), it is incorporated into algicides and is used in swimming pools and municipal water supplies. Silver (Ag) in the form of silver nitrate (AgNO3) is useful as an antiseptic and disinfectant. For example, one drop of a 1% silver nitrate solution used to be placed in the eyes of newborns to protect against infection by Neisseria gonorrhoeae. This gram-negative diplococcus can cause blindness if contracted by a newborn during passage through an infected mother’s birth canal (Chapter 13).
211
2 Na+ COO– Br
Br
–
O
O
O
Hg OH Merbromin
Na–O
+
O S
Hg
Thimerosal
NH
HN HN
NH N H
HN
N H
N H
Cl
N H
NH
Cl Chlorhexidine Chlorhexidine
CONCEPT AND REASONING CHECKS
7.14 Evaluate the use of heavy metals as antiseptics and disinfectants.
Alcohols Denature Proteins and Disrupt Membranes KEY CONCEPT
15. Alcohols are widely used skin antiseptics.
For practical use, the preferred alcohol is ethyl alcohol (ethanol), which is active against vegetative bacterial cells, including the tubercle bacillus, but it has no effect on spores. It denatures proteins and dissolves lipids, an action leading to cell membrane disintegration. Ethyl alcohol also is a strong dehydrating agent. Because ethyl alcohol reacts readily with organic matter, medical instruments and thermometers must be thoroughly cleaned before exposure. Usually, a 10-minute immersion in 50% to 80% alcohol solution is recommended to disinfect because water prevents rapid evaporation. Ethyl alcohol is used in many popular hand sanitizers.
H
H
H
C
C
H
H
OH
Ethanol
2/4/10 2:22 PM
212
CHAPTER 7
Venipuncture: The piercing of a vein to take blood, to feed somebody intravenously, or to administer a drug.
Control of Microorganisms: Physical and Chemical Methods
Alcohol is used to treat skin before a venipuncture or injection. It mechanically removes bacterial cells from the skin and dissolves lipids. Isopropyl alcohol, or rubbing alcohol, has high bactericidal activity in concentrations as high as 99%. CONCEPT AND REASONING CHECKS
H
H
OH H
C
C
C
H
H
H
Isopropyl alcohol
H
7.15 Why is 70% ethanol preferable to 95% ethanol as an antiseptic?
Soaps and Detergents Act as Surface-Active Agents KEY CONCEPT
16. Cationic detergents are bacteriostatic.
Soaps are chemical compounds of fatty acids combined with potassium or sodium hydroxide. The pH of the compounds is usually about 8.0, and some microbial destruction is due to the alkaline conditions they establish on the skin. However, the major activity of soaps is as degerming agents
for the mechanical removal of microorganisms from the skin surface. Soaps, therefore, are surface-active agents called surfactants; that is, they emulsify and solubilize particles clinging to a surface and reduce the surface tension. Soaps also remove skin oils, further reducing the surface tension and increasing the cleaning action. MICROFOCUS 7.6 discusses the antibacterial soaps. Detergents are synthetic chemicals acting as strong surfactants. Because they are actively attracted to the phosphate groups of cellular membranes, they also alter the membranes and encourage leakage from the cytoplasm. When used to clean cutting boards, for example, they can reduce the possibility of transmitting contaminants. The most useful detergents to control microorganisms are cationic (positively charged) derivatives of ammonium chloride. In these detergents, four organic radicals replace the four hydrogens,
7.6: Public Health/Being Skeptical
Are Antibacterial Soaps Worth the Money? All of us want to be as clean as possible. In fact, hand washing is one of the best ways to protect oneself and prevent the spread of disease-causing microbes. To that end, numerous consumer product companies have provided us with many different types of antimicrobial cleaning and hygiene items. Perhaps the most pervasive are the antibacterial soaps, which usually contain about 0.2% triclosan. It is estimated that 75% of liquid and 30% of bar soaps on the market today are of the antibacterial type. The question though is: Are these products any better than Washing hands with soap and water is a key to regular soaps? The short answer is—no. preventing disease transmission. Numerous studies have shown these antibacterial soaps do little against foodborne pathogens such as Salmonella and Escherichia coli. In addition, they do nothing to reduce the chances of picking up and harboring infectious microbes. A 2005 study gathered together over 200 families with children. Each family was given cleaning and hygiene supplies—soaps, detergents, and household cleaners—to use for one year. Half of the families (controls) received regular products without added antibacterial chemicals, while the other half used products with the antibacterial chemicals. When the families were surveyed after one year, those using the antibacterial products were just as likely to get sick, as identified by such symptoms as coughs, fevers, sore throats, vomiting, and diarrhea. You may say that this is not surprising, as many of these symptoms are the result of a viral infection—and the antibacterial products are not effective on viruses. However, further analysis of the families indicated there were just as many bacterial infections in the antibacterial group as there were in the control group. Antibacterial soaps may be useful in a hospital environment, but they certainly are not worth the extra cost for home use.
62582_CH07_189_221.pdf 212
2/4/10 2:22 PM
7.4 Chemical Methods of Control
and at least one radical is a long hydrocarbon chain ( FIGURE 7.17 ). Such compounds often are called quaternary ammonium compounds or, simply, quats. They react with cell membranes and can destroy some bacterial species and enveloped viruses. Quats have rather long, complex names, such as benzalkonium chloride in Zephiran and cetylpyridinium chloride in Ceepryn. Quats are bacteriostatic, especially on gram-positive bacteria, and are relatively stable, with little odor. They are used as sanitizing agents for industrial equipment and food utensils; as skin antiseptics; as disinfectants in mouthwashes and contact lens cleaners; and as disinfectants for use on hospital walls and floors. Their use as disinfectants for food-preparation surfaces can help reduce contamination incidents. Mixing them with soap, however, reduces their activity, and certain gramnegative bacteria, such as Burkholderia (Pseudomonas) cepacia, can actually grow in them. CONCEPT AND REASONING CHECKS
7.16 How do soaps differ from quats as chemical agents of control?
Peroxides Damage Cellular Components KEY CONCEPT
17. Hydrogen peroxide can be used as an antiseptic rinse.
213
+ H Ammonium ion
H
+ N
H
H
CH3 CH2
+ N
C18H37
Cl
+ N
–
C16H33 Cl
–
CH3 Benzalkonium chloride (Zephiran)
Cetylpyridinium chloride (Ceepryn)
FIGURE 7.17 Cationic Detergents. The chemical structures of some important quaternary ammonium compounds (quats) used in disinfection and antisepsis. »» How has the basic ammonium ion been modified to generate these two quats?
Benzoyl perioxide is another peroxide chemical. At low concentrations (2.5%), it is used to treat acne and is an active ingredient in teeth whitening products.
O O
O O
CONCEPT AND REASONING CHECKS
7.17 Judge the advantages and disadvantages of using hydrogen peroxide as an antiseptic.
Benzoyl peroxide
Some Chemical Agents Combine with Nucleic Acids and/or Cell Proteins KEY CONCEPT
18. Aldehydes and gases can be used for sterilization.
Peroxides are compounds containing oxygenoxygen single bonds. Hydrogen peroxide (H2O2) has been used as a rinse in wounds, scrapes, and abrasions. However, H2O2 applied to such areas foams and effervesces, as catalase in the tissue breaks down hydrogen peroxide to oxygen and water. Therefore, it is not recommended as an antiseptic for open wounds. However, the furious bubbling loosens dirt, debris, and dead tissue, and the oxygen gas is effective against anaerobic bacterial species. Hydrogen peroxide decomposition also results in a reactive form of oxygen— the superoxide radical—which is highly toxic to microorganisms. New forms of H2O2 are more stable than traditional forms, do not decompose spontaneously, and therefore can be used topically. Such inanimate materials as soft contact lenses, utensils, heatsensitive plastics, and food-processing equipment can be disinfected within 30 minutes.
62582_CH07_189_221.pdf 213
O
The chemical agents we discussed in previous sections are used as disinfectants and antiseptics. In addition, there are some chemicals that can be used for sterilization purposes, especially for modern high-technology equipment. Several such agents are considered. Aldehydes. Aldehydes are agents that react with amino and hydroxyl groups of nucleic acids and proteins. The resulting cross linking inactivates the proteins and nucleic acids. Formaldehyde is a gas at high temperatures and a solid at room temperature. As a 37% solution it is called formalin. For over a century, formalin was used in embalming fluid for anatomical specimens (though rarely used anymore) and by morticians for disinfecting purposes. In microbiology, formalin is used for inactivating viruses in certain vaccines and producing toxoids from toxins (Chapter 22).
H
H
O
Hydrogen peroxide
O C H
H
Formalin
2/4/10 2:22 PM
214
O
CHAPTER 7
O
H
H
Glutaraldehyde
O H2C
CH2
Ethylene oxide Cl O
O
Chlorine dioxide
62582_CH07_189_221.pdf 214
Control of Microorganisms: Physical and Chemical Methods
Instruments can be sterilized by placing them in a 20% solution of formaldehyde in 70% alcohol for 18 hours. Formaldehyde, however, leaves a residue, and instruments must be rinsed before use. Many allergic individuals develop a contact dermatitis to this compound. Glutaraldehyde is a small, organic molecule that destroys bacterial cells within 10 to 30 minutes and spores in 10 hours. As a 2% solution, glutaraldehyde can be used for sterilization purposes. Materials have to be precleaned, then immersed for 10 hours, rinsed thoroughly with sterile water, dried in a special cabinet with sterile air, and stored in a sterile container to ensure that the material remains sterile. If any of these parameters are altered, the materials may be disinfected but may not be considered sterile. Glutaraldehyde does not damage delicate objects, so it can be used to disinfect or sterilize optical equipment, such as the fiber-optic endoscopes used for arthroscopic surgery. It gives off irritating fumes, however, and instruments must be rinsed thoroughly in sterile water. Sterilizing Gases. The development of plastics for use in microbiology required a suitable method for sterilizing these heat-sensitive materials. In the 1950s, research scientists discovered the antimicrobial abilities of ethylene oxide, which essentially made the plastic Petri dish and plastic syringe possible. Ethylene oxide is a small molecule with excellent penetration capacity, and is microbicidal as well as sporicidal by combining with cell proteins. However, it is carcinogenic and highly explosive. Its explosiveness is reduced by mixing it with Freon
gas or carbon dioxide gas, but its toxicity remains a problem for those who work with it. The gas is released into a tightly sealed chamber where it circulates for up to four hours with carefully controlled humidity. The chamber then must be flushed with inert gas for 8 to 12 hours to ensure that all traces of ethylene oxide are removed; otherwise the chemical will cause “cold burns” on contact with the skin. Ethylene oxide is used to sterilize paper, leather, wood, metal, and rubber products as well as plastics. In medicine, it is used to sterilize catheters, artificial heart valves, heart-lung machine components, and optical equipment. The National Aeronautics and Space Administration (NASA) uses the gas for sterilization of interplanetary space capsules. Ethylene oxide chambers, called “gas autoclaves,” have become the chemical counterparts of heat- and pressure-based autoclaves for sterilization procedures. Chlorine dioxide has properties very similar to chloride gas and sodium hypochlorite but, unlike ethylene oxide, it produces nontoxic byproducts and is not a carcinogen. Chlorine dioxide can be used as a gas or liquid. In a gaseous form, with proper containment and humidity, a 15-hour fumigation can be used to sanitize air ducts, food and meat processing plants, and hospital areas. It was the gas used to decontaminate the 2001 anthrax-contaminated mail and office buildings (MICROFOCUS 7.7). TABLE 7.3 and FIGURE 7.18 summarize the chemical agents used in controlling microorganisms. CONCEPT AND REASONING CHECKS
7.18 Summarize the uses for aldehydes, ethylene oxide, and chloride dioxide for sterilization.
2/4/10 2:22 PM
7.4 Chemical Methods of Control
215
7.7: Tools/Bioterrorism
Decontamination of Anthrax-Contaminated Mail and Office Buildings This chapter has examined the chemical procedures and methods used to control the numbers of microorganisms on inanimate and living objects. These control measures usually involve a level of sanitation, although some procedures may sterilize. Some examples were given for their use in the home and workplace. However, what about real instances where large-scale and extensive decontamination has to be carried out? In October 2001, the United States experienced a (A) bioterrorist attack. The perpetrator(s) used anthrax spores as the bioterror agent. Four anthraxcontaminated letters were sent through the mail on the same day, addressed to NBC newscaster Tom Brokaw, the New York Post, and to two United States Senators, Senator Patrick Leahy and Senate Majority Leader Tom Daschle (Figure A). The Centers for Disease Control and Prevention (CDC) confirmed that anthrax spores from at least the Daschle letter contaminated the Hart Senate Office Building and several post office sorting facilities in Trenton, New Jersey (from where the letters were mailed), and Washington, D.C., areas. This resulted in the closing (B) Mail sorting machines. of the Senate building and the postal sorting facilities. With the Senate building and postal sorting facilities closed, the CDC, the Environmental Protection Agency (EPA), other governmental agencies, and commercial companies had to devise and implement a strategy to decontaminate these buildings and the mail sorting machines (Figure B). As mentioned in this chapter, most sanitation procedures do not require a high technology solution. In fact, all of the methods actually used for this situation are described in this chapter. The Hart Senate Office Building and the post office sorting facilities were contaminated with Bacillus anthracis endospores. These are large, multi-room facilities with many pieces of furniture and instruments, including computers, copy machines, and mail sorting machines. To decontaminate these buildings, chemical disinfectants such as bleach or phenol solutions could have been used. However, spores may have gotten into the office machinery and sorting machines. Liquids would not work here. Therefore, a gas was needed that could permeate the air ducts as well as all the office machinery and sorting machines. The gas chosen was chlorine dioxide. Essentially, the buildings were sealed as if they were going to be fumigated for termites. The gas was pumped in, and after a time that was believed to be sufficient to kill any anthrax spores, the gas was evacuated. Swabs were taken from the buildings and plated on nutrient media. If any spores were still alive, they would germinate on the plates and the vegetative cells would grow into visible colonies. Such results would require retreatment of the facility. To protect the mail from similar attacks in the future, a system was devised using ultraviolet (UV) light to kill any spores that might be found in a piece of mail moving through the sorting machines. It took months, and even years, for some of the postal facilities to be declared safe and free of anthrax spores. Still, simple physical and chemical methods worked to decontaminate the buildings and equipment.
62582_CH07_189_221.pdf 215
2/4/10 2:22 PM
216
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
TABLE
7.3
Summary of Chemical Agents Used to Control Microorganisms
Chemical Agent Chlorine
Antiseptic or Disinfectant Chlorine gas Sodium hypochlorite Chloramines
Mechanism of Activity Protein oxidation Membrane leakage
Iodine
Tincture of iodine Iodophors
Reacts with proteins
Phenol and derivatives
Hexachlorophene Chlorhexidine Triclosan Mercuric chloride Merthiolate Merbromin
Coagulates proteins Disrupts cell membranes
Copper
Copper sulfate
Combines with proteins
Silver
Silver nitrate
Binds proteins
Alcohol
70% ethyl alcohol
Cationic detergents
Quaternary ammonium compounds Hydrogen peroxide Benzoyl peroxide
Denatures proteins Dissolves lipids Dehydrating agent Dissolve lipids in cell membranes
Mercury
Peroxides
Formaldehyde
Formalin
Glutaraldehyde
Glutaraldehyde
Ethylene oxide
Ethylene oxide gas
Chlorine dioxide
Chlorine dioxide gas
62582_CH07_189_221.pdf 216
Combines with —SH groups in proteins
Creates aerobic environment Oxidizes protein groups Reacts with functional groups in proteins and nucleic acids
Reacts with functional groups in proteins and nucleic acids Reacts with functional groups in proteins and nucleic acids Reacts with functional groups in proteins and nucleic acids
Applications Water treatment Skin antisepsis Equipment spraying Food processing Skin antisepsis Food processing Preoperative preparation General preservatives Skin antisepsis with detergent Skin antiseptics Disinfectants
Algicide in swimming pools Municipal water supplies Skin antiseptic Eyes of newborns
Limitations Inactivated by organic matter Objectionable taste, odor
Antimicrobial Spectrum Broad variety of bacteria, fungi, protozoa, viruses
Inactivated by organic matter Objectionable taste, odor Toxic to tissues Disagreeable odor
Broad variety of bacteria, fungi, protozoa, viruses Gram-positive bacteria Some fungi
Inactivated by organic matter Toxic to tissues Slow acting Inactivated by organic matter Skin irritation
Broad variety of bacteria, fungi, protozoa, viruses Algae Some fungi Organisms in burned tissue Gonococci Vegetative bacterial cells, fungi, protozoa, viruses Broad variety of microorganisms
Instrument disinfectant Skin antiseptic
Precleaning necessary Skin irritation
Industrial sanitization Skin antiseptic Disinfectant Wound treatment Acne
Neutralized by soap
Limited use
Anaerobic bacteria
Embalming Vaccine production Gaseous sterilant
Broad variety of bacteria, fungi, protozoa, viruses
Sterilization of surgical supplies
Poor penetration Allergenic Toxic to tissues Neutralized by organic matter Unstable Toxic to skin
Sterilization of instruments, equipment, heat-sensitive objects Sanitizes equipment, rooms, buildings
Explosive Toxic to skin Requires constant humidity Burns skin and eyes on contact
All microorganisms, including spores
All microorganisms, including spores All microorganisms, including spores
2/4/10 2:22 PM
7.4 Chemical Methods of Control
217
Chemical Methods of Control include
Halogens
Alcohols
Phenolic compounds
such as the elements which are typically used as
Heavy metals
that include
that include
Mercury
Iodine
used as
Cationic detergents
that include Sodium/ calcium hypochlorite
Peroxides
that are in the form of
Bisphenols Chlorine
(Quats) Quaternary ammonium compounds
Silver Hydrogen peroxide
in the form of
Benzoyl peroxide
Silver nitrate
Iodophors Triclosan
Chlorohexidine Merbromin
Thimerosal that accomplishes
Chloromine-T 70% ethanol
Disinfection
75% isopropyl alcohol
Chemical sterilants
that accomplishes
in the form of
Disinfection
Aldehydes
Gases
such as
such as
Formalin
Glutaraldehyde
Ethylene oxide
Chlorine dioxide
that accomplishes Sterilization FIGURE 7.18 A Concept Map Summarizing the Chemical Methods of Microbial Control. The chemical methods predominantly disinfect, although a few can sterilize. »» If you wanted to sanitize a kitchen counter, which chemicals might be selected?
62582_CH07_189_221.pdf 217
2/4/10 2:22 PM
218
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
SUMMARY OF KEY CONCEPTS 7.1 General Principles of Microbial Control 1. The physical methods for controlling microorganisms are generally intended to achieve sterilization—the destruction or removal of all life-forms, including bacterial spores. Sanitization involves methods to reduce the numbers of, or inhibit the growth of, microbes. 7.2 Physical Methods of Control 2. Heat is a common control method. Used in the food industry, thermal death point and thermal death time are used to determine how long it takes to kill microbial cells. 3. Incineration using a direct flame achieves sterilization in a few seconds. 4. Moist heat has several applications: The exposure to boiling water at 100° C for two hours can result in sterilization, but spore destruction cannot always be assured; the autoclave sterilizes materials in about 15 minutes, while a prevacuum sterilizer shortens this time using higher temperatures and pressures. Fractional sterilization is another method for sterilization through successive exposures to steam on three days; pasteurization reduces the microbial population in a liquid and is not intended to be a sterilization method. 5. Filtration uses various materials to trap microorganisms within or on a filter. Membrane filters are the most common. Air can be filtered using a high-efficiency particulate air (HEPA) filter. 6. Ultraviolet (UV) light is an effective way of killing microorganisms on a dry surface and in the air. 7. X rays and gamma rays are two forms of ionizing radiation used to sterilize heat-sensitive objects. Irradiation also is used in the food industry to control microorganisms on perishable foods. 8. For food preservation, drying, salting, and low temperatures can be used to control microorganisms.
7.3 General Principles of Chemical Control 9. Chemical agents are effectively used to control the growth of microorganisms. A chemical agent used on a living object is an antiseptic; one used on a nonliving object is a disinfectant. 10. Both antiseptics and disinfectants are selected according to certain criteria, including an ability to kill microorganisms or interfere with their metabolism. 11. The phenol coefficient test can be used to evaluate antiseptics and disinfectants. Chemicals are contrasted based on their effectiveness compared to phenol. In-use tests are more practical for everyday applications of antiseptics and disinfectants. 7.4 Chemical Methods of Control 12. Halogens (chlorine and iodine) are useful for water disinfection, wound antisepsis, and various forms of sanitation. 13. Phenol derivatives, such as hexachlorophene, are valuable skin antiseptics and active ingredients in presurgical scrubs. 14. Heavy metals (silver and copper) are useful as antiseptics and disinfectants, respectively. 15. Alcohol (70% ethyl alcohol) is an effective skin antiseptic. 16. Soaps and detergents are effective degerming agents. Quats are more effective as a disinfectant than as an antiseptic. 17. Hydrogen peroxide acts by releasing oxygen to cause an effervescing cleansing action. It is better as a disinfectant than an antiseptic. 18. Formaldehyde and glutaraldehyde are sterilants that cross link amino and hydroxyl groups in proteins and nucleic acids to alter the biochemistry of microorganisms. Ethylene oxide gas under controlled conditions is an effective sterilant for plasticware. Chlorine dioxide gas can be used to sanitize air ducts, food and meat processing plants, and hospital areas.
LEARNING OBJECTIVES After understanding the textbook reading, you should be capable of writing a paragraph that includes the appropriate terms and pertinent information to answer the objective. 1. Distinguish between sterilization and sanitization. 2. Contrast thermal death time and thermal death point. 3. Distinguish between incineration and dry heat. 4. Discuss the four ways that moist heat can be used to control microbial growth. 5. Summarize the filtration methods used to sterilize a liquid and decontaminate air. 6. Summarize how ultraviolet (UV) light, works to control microbial growth. 7. Explain how X rays and gamma rays are used as physical control agents. 8. Explain how dehydration and cold temperatures preserve foods.
62582_CH07_189_221.pdf 218
9. Compare and contrast an antiseptic and a disinfectant. 10. List the desirable and chemical properties of antiseptics and disinfectants. 11. Describe how the effectiveness of a chemical agent can be measured. 12. Evaluate the usefulness of halogens as disinfectants. 13. Summarize the uses for phenolic derivatives as disinfectants and antiseptics. 14. Summarize the uses for heavy metals in the chemical control of microorganisms. 15. Justify why alcohol is not a method for skin sterilization. 16. Distinguish between a soap, a detergent, and quats. 17. Estimate the value of hydrogen peroxide as a bacteriostatic agent. 18. Identify the uses of aldehydes and gases as sterilants.
2/4/10 2:22 PM
Step A: Self-Test
219
STEP A: SELF-TEST Each of the following questions is designed to assess your ability to remember or recall factual or conceptual knowledge related to this chapter. Read each question carefully, then select the one answer that best fits the question or statement. Answers to even-numbered questions can be found in Appendix C. 1. All the following terms apply to microbial killing except: A. sterilization. B. microbicidal. C. bactericidal. D. fungistatic. 2. The thermal death time is A. the time to kill a microbial population at a given temperature. B. the time to kill a microbial population in boiling water. C. the temperature to kill all pathogens. D. the minimal temperature need to kill a microbial population. 3. At 160°C, it takes about _____ minutes to kill bacterial spores in a hot-air oven. A. 30 B. 60 C. 90 D. 120 4. An autoclave normally sterilizes material by heating the material to _____°C for _____ minutes at _____ psi. A. 100; 10; 30 B. 121.5; 15; 15 C. 100; 15; 0 D. 110; 30; 5 5. Air filtration typically uses a _____ filter. A. HEPA B. membrane C. sand D. diatomaceous earth 6. For bactericidal activity, _____ has/have the ability to cause thymine dimer formation. A. X rays B. ultraviolet light C. gamma rays D. microwaves 7. The elimination of pathogens in foods by irradiation is called A. the D value. B. the pasteurizing dose. C. incineration. D. sterilization. 8. Preservation methods such as salting result in the _____ microbial cells. A. loss of salt from B. gain of water into C. loss of water from D. lysis of 9. Which one of the following statements does NOT apply to antiseptics? A. They are used on living objects. B. They usually are microbicidal. C. They should be useful as dilute solutions. D. They can sanitize objects.
62582_CH07_189_221.pdf 219
10. All the following are chemical parameters considered when selecting an antiseptic or disinfectant except: A. dehydration. B. temperature. C. stability. D. pH. 11. If a chemical has a phenol coefficient (PC) of 63, it means the chemical A. is better than one with a PC of 22. B. will kill 63% of bacteria. C. kills microbes at 63°C. D. will kill all bacteria in 63 minutes. 12. Which one of the following is NOT a halogen? A. Iodine B. Mercury C. Clorox bleach D. Chlorine 13. Phenolics include chemical agents A. such as the iodophores. B. derived from carbolic acid. C. used as tinctures. D. such as formaldehyde. 14. Heavy metals, such as _____ work by _____. A. mercury; disrupting membranes B. copper; producing toxins C. iodine; denaturing proteins D. silver; binding protein molecules together 15. Alcohols are A. surfacants. B. heavy metals. C. denaturing agents. D. detergents. 16. All the following statements apply to quats except: A. they react with cell membranes. B. they are positively charged molecules. C. they are types of soaps. D. they can be used as disinfectants. 17. Hydrogen peroxide A. is an effective sterilant. B. cross-links proteins and nucleic acids. C. can emulsify and solubilize pathogens. D. is not recommended for use on open wounds. 18. Ethylene oxide can be used to A. kill bacterial spores. B. clean wounds. C. sanitize work surfaces. D. treat water supplies.
2/4/10 2:22 PM
220
CHAPTER 7
Control of Microorganisms: Physical and Chemical Methods
STEP B: REVIEW—PHYSICAL METHODS Use the following syllables to form the term that answers the clue pertaining to physical methods of control. The number of letters in the term is indicated by the dashes, and the number of syllables in the term is shown by the number in parentheses. Each syllable is used only once. The answers to evennumbered terms are listed in Appendix C. A AU BA BER BRANE CIL CLAVE CU DE DER DRY HOLD ING ING LET LO LUS MEM MO NA O OS PLAS POW SIS SIS SPORE TIC TION TO TRA TU TUR UL VI 19. Instrument for sterilization.
(3) ___ ___ ___ ___ ___ ___ ___ ___ ___
20. Type of filter.
(2) ___ ___ ___ ___ ___ ___ ___ ___
21. Sterilized in an oven.
(2) ___ ___ ___ ___ ___ ___
22. Occurs with moist heat.
(5) ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
23. Preserves meat, fish.
(2) ___ ___ ___ ___ ___ ___
24. Most resistant life-form.
(1) ___ ___ ___ ___ ___
25. Method of pasteurization.
(2) ___ ___ ___ ___ ___ ___ ___
26. Light for air sterilization.
(5) ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
27. Melts in the autoclave.
(2) ___ ___ ___ ___ ___ ___ ___
28. Water flow from salting.
(3) ___ ___ ___ ___ ___ ___ ___
29. Genus of spore formers.
(3) ___ ___ ___ ___ ___ ___ ___ ___
30. Disease prevented by pasteurization.
(5) ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
STEP B: REVIEW—CHEMICAL METHODS Chemical agents are a broad and diverse group, as this chapter has demonstrated. To test your knowledge over the chemical methods of control, match the chemical agent on the right to the statement on the left by placing the correct letter in the available space. A letter may be used once, more than once, or not at all. The answers to even-numbered statements are listed in Appendix C.
Statement ____
31. The halogen in bleach.
____
32. Sterilizes heat-sensitive materials.
____
33. Part of chloramine molecule.
____
34. A 70% concentration is recommended.
____
35. Active ingredient in Betadine.
____
36. Quaternary compounds, or quats.
____
37. Can induce a contact dermatitis.
____
38. Often used as a tincture.
____
39. Rinse for wounds and scrapes.
____
40. Example of a heavy metal.
____
41. Aids mechanical removal of organisms.
____
42. Triclosan is a derivative.
____
43. Used by Joseph Lister.
____
44. Used for plastic Petri dishes.
____
45. Broken down by catalase.
62582_CH07_189_221.pdf 220
Chemical agent A. B. C. D. E. F. G. H. I. J. K.
Cationic detergent Chlorine Ethyl alcohol Ethylene oxide Formaldehyde Glutaraldehyde Hydrogen peroxide Iodine Phenol Silver Soap
2/4/10 2:22 PM
Step D: Questions for Thought and Discussion
221
STEP C: APPLICATIONS Answers to even-numbered questions can be found in Appendix C. 46. When the local drinking water is believed to be contaminated, area residents are advised to boil their water before drinking. Often, however, they are not told how long to boil it. As a student of microbiology, what is your recommendation? 47. You need to sterilize a liquid. What methods could you devise using only the materials found in the average household? 48. Suppose you were in charge of a clinical laboratory where instruments are routinely disinfected and equipment is sanitized. A salesperson from a disinfectant company stops in to spur your interest in a new
chemical agent. What questions might you ask the salesperson about the product? 49. A portable room humidifier can incubate and disseminate infectious microorganisms. If a friend asked for your recommendations on disinfecting the humidifier, what do you suggest? 50. A student has finished his work in the laboratory and is preparing to leave. He remembers the instructor’s precautions to wash his hands and disinfect the lab bench before leaving. However, he cannot remember whether to wash first then disinfect, or to disinfect then wash. What advice would you give?
STEP D: QUESTIONS FOR THOUGHT AND DISCUSSION Answers to even-numbered questions can be found in Appendix C. 51. Instead of saying that food has been irradiated, manufacturers indicate that it has been “cold pasteurized.” Why do you believe they must use this deception? 52. The label on the container of a product in the dairy case proudly proclaims, “This dairy product is sterilized for your protection.” However, a statement in small letters below reads: “Use within 30 days of purchase.” Should this statement arouse your suspicion about the sterility of the product? Why? 53. In view of all the sterilization methods we have discussed in this chapter, why do you think none has been widely adapted to the sterilization of milk? 54. A liquid that has been sterilized may be considered pasteurized, but one that has been pasteurized may not be considered sterilized. Why not?
55. Before taking a blood sample from the finger, the blood bank technician commonly rubs the skin with a pad soaked in alcohol. Many people think that this procedure sterilizes the skin. Are they correct? Why? 56. Suppose you had just removed the thermometer from the mouth of your sick child and confirmed your suspicion of fever. Before checking the temperature of your other child, how would you treat the thermometer to disinfect it? 57. The water in your home aquarium always seems to resemble pea soup, but your friend’s is crystal clear. Not wanting to appear stupid, you avoid asking him his secret. But one day, in a moment of desperation, you break down and ask, whereupon he knowledgeably points to a few pennies among the gravel. What is the secret of the pennies?
HTTP://MICROBIOLOGY.JBPUB.COM/9E The site features eLearning, an online review area that provides quizzes and other tools to help you study for your class. You can also follow useful links for in-depth information, read more MicroFocus stories, or just find out the latest microbiology news.
62582_CH07_189_221.pdf 221
2/4/10 2:22 PM
PART
2
The Genetics of Microorganisms CHAPTER 8
Microbial Genetics
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
n Part 1, we learned that many of the microorganisms that make up most of the Earth’s biomass have been evolving for billions of years. They exist in virtually every environment on planet Earth; many survive—and even thrive—in extremes of heat, cold, radiation, pressure, salt, and acidity. This diversity and its range of environmental conditions show that microbes long ago “solved” many of the problems of adaptation in these environments. In fact, whether we examine cell structure and function, growth and nutrition, microbial metabolism, or virtually any microbial characteristic we might wish to consider, including antibiotic resistance, all are the result of inherited information. This information is stored as deoxyribonucleic acid (DNA) and is passed on from generation to generation. The study is called microbial genetics. The contributions of microbial genetics have been numerous, diverse, False-color transmission electron microscope and far reaching. As described in Chapter 1, model microbial systems, such image of two Escherichia coli cells that are part of the human intestinal microbiota and as Escherichia coli, have established many of the principles of molecular biolare a model organism for genetic studies. ogy. In addition, many of the molecular techniques in the geneticist’s toolbox (e.g., polymerases, restriction enzymes, cloning vectors) are derived from genetic studies of microbes. Despite this legacy and the huge clinical significance of microbial genetics, the potential of the field is only just beginning to be tapped. This is, in part, why we are in the third golden age of microbiology! In Part 2, we will explore the microbial genome in detail. Chapter 8 is devoted to the basics of microbial genetics. We will examine how microbial DNA is replicated and how this information codes for and directs protein synthesis. We will also explore the mechanisms of genome regulation and how it is affected by mutation. Chapter 9 introduces us to the fields of genetic engineering, biotechnology, and microbial genomics. We will discover how DNA information can be transferred laterally from one microbe to another. Then, we will examine the techniques of genetic engineering, the applications of biotechnology, and finish with a discussion of microbial genomics; that is, the study of genes and their function. Genomic analyses of microorganisms have broad significance not only for microbiology, human health, industry, and the environment, but also in our daily lives.
I
222
62582_CH08_222_259.pdf 222
2/4/10 2:05 PM
MICROBIOLOGY
PATHWAYS
Biotechnology
Microbiology: Then and Now
During the 1980s, the editors of Time Magazine referred to DNA technology as “the most awesome skill acquired by man since the splitting of the atom.” Indeed, the work with DNA, begun in the 1950s and continuing today, has opened vistas previously unimagined. Scientists can now remove bits of DNA from organisms, snip and rearrange the genes, and insert them into different species, where the genes will express themselves. Practical results of these experiments have led to the mass production of hormones, blood-clotting factors, and other pharmaceutical products. They also have given us diagnostic methods based on DNA fingerprinting; advances in gene therapy; a revolution in agricultural research; barnyard animals producing human hemoglobin; and a colossal project that has mapped the entire human genome. Industrial microbiology or microbial biotechnology (the terms “industrial microbiology” and “biotechnology” are often one and the same) applies scientific and engineering principles to the processing of materials by microorganisms and viruses, or plant and animal cells, to create useful products or processes. Because biotechnology essentially uses the basic ingredients of life to make new products, it is both a cutting-edge technology and an applied science. If you would like to be part of what analysts predict will be one of the most important applied sciences of this century, then microbiology is the place to start. You would be well advised to take a course in biochemistry as well as one in genetics. Courses in physiology and cell biology are also helpful. Employers will be looking for individuals with good laboratory skills, so be sure to take as many lab courses as you can. You may enter the biotechnology field with an associate’s, bachelor’s, master’s, or doctoral degree. This is because there are so many levels at which individuals are hired. Most professional levels of employment require a college degree (BS) in biology, microbiology, or biotechnology with minors in one or more of the complementary sciences. Persons who have project responsibilities often have one or more advanced degrees (MS and/or PhD) in biology, microbiology, or some other allied field such as molecular biology, biochemistry, biotechnology, chemical engineering, or genetics. An employer also will be looking for work experience, which you can obtain by assisting a senior scientist, doing an internship, or working summers in a biotech firm (usually for slave wages). The campus research lab is another good place to obtain work experience. It also might be a good idea to sharpen your writing skills, because you will be preparing numerous reports. As Chapter 8 explains, the novel and imaginative research that established biotechnology was founded in microbiology, and it continues to call on microbiology for its continuing growth.
223
62582_CH08_222_259.pdf 223
2/4/10 2:05 PM
8 Chapter Preview and Key Concepts
8.1 DNA and Chromosomes 1. The DNA exists as a single, circular chromosome. 2. Microbial DNA must be tightly packed to fit in the cell. 3. Plasmids carry nonessential, but often useful, information. 8.2 DNA Replication 4. DNA replication is a three-phase event requiring an array of proteins working in sequence. 5. Continuous and discontinuous DNA synthesis occur in each replication fork. 8.3 Protein Synthesis 6. Different DNA segments are transcribed into one of three types of RNA. 7. More than one codon often specifies a specific amino acid. 8. The synthesis of a protein (polypeptide) occurs through chain initiation, elongation, and termination/release. 9. Many antibiotics can inhibit transcription or translation. 10. Many genes are controlled by operons. 11. Transcription and translation occur in spatially separated compartments. MICROINQUIRY 8: The Operon Theory and the Control of Protein Synthesis 8.4 Mutations 12. Mutations can be spontaneous or induced. 13. Point mutations affect one base pair in a DNA sequence. 14. Cells have the ability to repair damaged DNA. 15. Insertion sequences and transposons move from one DNA location to another. 8.5 Identifying Mutants 16. Mutant identification can involve negative or positive selection techniques. 17. Ames test revertants suggest a chemical is a potential carcinogen in humans.
Microbial Genetics We wish to suggest a structure for the salt of deoxyribose nucleic acid (DNA). This structure has novel features which are of considerable biological interest. —In the first 1953 paper by Watson and Crick describing the structure of DNA
In our fast-paced world, we often measure time in minutes and seconds, so our minds find it difficult to imagine the colossal 4.5 billion years that the Earth has been in existence. It may help, however, to think of Earth’s history as a single year. In the months of January and February, Earth was a hot, volcanic, lifeless ball of rock bombarded by material left over from the formation of the solar system. As the earth cooled during March, water vapor condensed into oceans and seas, providing conditions more amenable for the origin of life. Around April, something akin to the Bacteria or Archaea first appeared ( FIGURE 8.1 ). As they evolved, they thrived and diversified in environments without oxygen gas and, by mid-June (2.4 billion years ago), in environments with oxygen gas (see MicroFocus 2.1 and 5.3). Members of the Bacteria and Archaea were the only organisms on Earth until early August, when singlecelled eukaryotes, such as the algae, emerged. These organisms flourished and represent ancestors of present-day species. About mid-September, multicellular eukaryotes arose, whose descendants would evolve into diverse plants, fungi, and animals. Not until mid-November did the first of the plants, fungi, and animals move out of the sea onto the land. The dinosaurs were in existence from December 19 to December 25, and by December 27, the Earth bore a resemblance to modern Earth. Finally, on December 31, close to midnight, humans appeared. We take this trek through geologic time to help us appreciate why microorganisms have prospered genetically and in evolutionary terms. They have been successful primarily because they have been around the
224
62582_CH08_222_259.pdf 224
2/4/10 2:05 PM
CHAPTER 8 Microbial Genetics
longest and have adapted well. In fact, the Bacteria and Archaea domains have been on Earth about 3.7 billion years (versus about 200,000 years for humans), as FIGURE 8.2 shows. During this time, gene changes have been occurring regularly and nature has used the microbes to test its newest genetic traits. The detrimental traits have been eliminated (together with the organisms unlucky enough to have them),
FIGURE 8.1 Fossil Microbes. This photograph is looking down on an ancient sea floor in Western Australia’s Pilbara region. The wavy markings and cone-shaped formations may be evidence for a microbial reef made of cyanobacteria that existed 3.4 billion years ago. »» What would it mean for the environment once cyanobacteria predominated?
225
while the beneficial traits have thrived and have been passed on to the next generation—and on to the present day. Present day microorganisms enjoy the fruits of genetic change. Because of their diverse genes, they can thrive in the varied environments on Earth, whether it is the snows of the Arctic or the boiling hot volcanic vents of the ocean depths. No other organisms can compare in sheer numbers. Finally, consider a bacterium’s multiplication rate—a new generation every half hour in some cases—and it is easy to see how a useful genetic change (such as drug resistance) can be propagated quickly. Any one of these factors—time on Earth, sheer numbers, multiplication rate—would be sufficient to explain how microorganisms have evolved to their current form. However, when taken together, the factors help us appreciate why they have done very well in the evolutionary lottery—very well, indeed. In this chapter, we examine mutation, one of the two processes that have brought ancient microorganisms to the myriad forms we observe on Earth today. However, to understand the material in these topics, we first must look at DNA replication and how the information in DNA is processed and regulated in making proteins—something alluded to by the remarkable discovery made in 1953 by James Watson and Francis Crick (see chapter opening quotation).
Great oxidation event
Time of humans Time of land colonization Time of animals
Time of multicellular Eukarya Origin of Earth
5 billion years ago
Time of single-celled Eukarya Oldest Earth rocks Time of Bacteria/Archaea
4 billion years ago
3 billion years ago
2 billion years ago
1 billion years ago
Now
FIGURE 8.2 The Appearance of Life on Earth. This time line shows the relative amounts of time that various groups of organisms have existed on Earth. The Bacteria and Archaea have been in existence for a notably longer period than any other group, particularly humans. They have adapted well to Earth simply because they have had ample time and numbers. »» Why did it take so long for eukaryotes to appear on Earth?
62582_CH08_222_259.pdf 225
2/4/10 2:06 PM
226
CHAPTER 8
Microbial Genetics
8.1
DNA and Chromosomes
In 1953, James Watson and Francis Crick worked out DNA’s double helix structure based, in part, on the X-ray studies of Rosalind Franklin (MICROFOCUS 8.1). This discovery has formed the foundation for all we know today about DNA rep-
lication, protein synthesis, and gene control. In Chapter 2, we described the structure of the DNA molecule, so it might be helpful to review that material before proceeding too far in this chapter.
8.1: History
The Tortoise and the Hare We all remember the children’s fable of the tortoise and the hare. The moral of the story was those who plod along slowly and methodically (the tortoise) will win the race over those who are speedy and impetuous (the hare). The race to discover the structure of DNA is a story of collaboration and competition—a science “tortoise and the hare.” Rosalind Franklin (the tortoise) was 31 when she arrived at King’s College in London in 1951 to work in J. T. Randell’s lab. Having received a Ph.D. in physical chemistry from Cambridge University, she moved to Paris where she learned the art of X-ray crystallography. At King’s College, Franklin was part of Maurice Wilkins’s group and she was assigned the job of using X-ray crystallography to work out the structure of DNA fibers. Her training and constant pursuit of excellence allowed her to produce excellent, high-resolution X-ray photographs of DNA. Meanwhile, at the Cavendish Laboratory in Cambridge, James Watson (the hare) was working with Francis Crick on the structure of DNA. Watson, who was in a rush for honor and greatness that could be gained by figuring out the structure of DNA, had a brash “bull in a china shop” attitude. This was in sharp contrast to Franklin’s philosophy where you don’t make conclusions until all of the experimental facts have been analyzed. Therefore, until she had all the facts, Franklin was reluctant to share her data with Wilkins—or anyone else. Feeling left out, Wilkins was more than willing to help Watson and Crick. Because Watson thought Franklin was “incompetent in interpreting X-ray photographs” and he was better able to use the data, Wilkins shared with Watson an X-ray photograph and report that Franklin had filed. From these materials, it was clear that DNA was a helical molecule. It also seems clear Franklin knew this as well but, perhaps being a physical chemist, she did not grasp its importance because she was concerned with getting all the facts first and making sure they were absolutely correct. But, looking through the report that Wilkins shared, the proverbial “light bulb” went on when Crick saw what Franklin had missed; that the two DNA strands were antiparallel. This knowledge, together with Watson’s ability to work out the base pairing, led Watson and Crick to their “leap of imagination” and the structure of DNA. In her book entitled, Rosalind Franklin: The Dark Lady of DNA (HarperCollins, 2002), author Brenda Maddox suggests it is uncertain if Franklin could have made that leap as it was not in her character to jump beyond the data in hand. In this case, the leap of intuition won out over the methodical, data collecting in research—the hare beat the tortoise this time. However, it cannot be denied that Franklin’s data provided an important key from which Watson and Crick made the historical discovery. In 1962, Watson, Crick, and Wilkins received the Nobel Prize in Physiology or Medicine for their work on the structure of DNA. Should Franklin have been included? The Nobel Prize committee does not make awards posthumously and Franklin had died four years earlier from ovarian cancer. So, if she had lived, did Rosalind Franklin deserve to be included in the award?
62582_CH08_222_259.pdf 226
2/4/10 2:06 PM
Bacterial and Archaeal DNA Is Organized within the Nucleoid KEY CONCEPT
1.
The DNA exists as a single, circular chromosome.
Most of the genetic information in bacterial and archaeal cells is contained within the chromosome, the cell’s intracellular source of genetic information. Usually, this is a single, circular molecule of DNA that is haploid, although a few species may have a single genome spread over multiple chromosomes. The chromosome exists as thread-like fibers associated with some protein and is localized in the cytosol within a space called the nucleoid (see Chapter 4). Remember that one of the unique features defining the nucleoid area is the absence of a surrounding membrane envelope typical of the cell nucleus in eukaryotic cells. The circular chromosome of Escherichia coli probably has been studied more thoroughly than that of any other microbe. The genome has about 4,400 genes coding for growth and metabolic activities. By contrast, many other bacterial and archaeal genomes are much smaller, especially those of obligate symbionts/ parasites ( FIGURE 8.3 ). At the other extreme are the genomes of the eukaryotes, which, along
8.1 DNA and Chromosomes
227
with other characteristics listed in TABLE 8.1 , can be much larger is size. Note in this table some of the archaeal/eukaryote similarities.
Haploid: Having a single set of genetic information.
CONCEPT AND REASONING CHECKS
8.1 Describe the basic structure of a bacterial chromosome.
TABLE
8.1
Characteristics of Bacteria, Archaeal, and Eukaryotic Chromosomes
Characteristic
Bacteria
Archaea
Eukarya
Organization Chromosome morphology Ploidy
Nucleoid Usually circular
Nucleoid Usually circular
Nucleus Linear
Usually haploid
Usually haploid
Genome size (Mb)1 Average proteincoding genes Presence of histone proteins Presence of introns Replication
0.16–10 Few thousand
0.5–6 Few thousand
Histone-like
Yes
Haploid, diploid, polyploid 10–100,000 Tens of thousands Yes
No
Present in rRNA and tRNA genes Just prior to binary fission Multiple
Replication origins 1Mb
Just prior to binary fission Single
Yes Few hours before mitosis Multiple
= Millions of base pairs.
10.0 Streptomyces coelicolor
Genome size (Mb)
5.0 E. coli
Free-living Obligate symbionts/parasites
Pelagibacter ubique (smallest bacterial)
1.0 Carsonella rudii (smallest bacterial)
Nanoarchaeum equitans (smallest archaeal)
0.5 0.1 100
500 1,000 Number of protein encoding genes
5,000
10,000
FIGURE 8.3 Genome Size among the Bacteria and Archaea. This graph illustrates the relationship between genome size (Mb = millions of base pairs) and number of protein-coding genes. Note the extremely small size of Carsonella ruddii.»» Produce a hypothesis to explain why the obligate symbionts/parasites have the smallest genomes.
62582_CH08_222_259.pdf 227
2/4/10 2:06 PM
228
CHAPTER 8
Microbial Genetics
DNA within a Chromosome Is Highly Compacted
Many Microbial Cells also Contain Plasmids
KEY CONCEPT
KEY CONCEPT
2.
3.
Microbial DNA must be tightly packed to fit in the cell.
In most microbial cells, including E. coli, the DNA occupies about one-third of the total volume of the cell, and when extended its full length, it is about 1.5 millimeters (mm) long. This is approximately 500 times the length of the bacterial cell. So, how can a 1.5-mm-long circular chromosome fit into a 1.0 to 2.0 mm E. coli cell? The answer is supercoiling, a twisting and tight packing caused by a number of abundant nucleoid-associated proteins. Thus, the DNA double helix twists on itself like a wound-up rubber band. The coils are folded further into loops of 10,000 bases, each forming a supercoiled domain ( FIGURE 8.4A ) and there are about 400 such domains in an E. coli chromosome, giving the molecule an overall “flower” structure called the looped domain structure. The high level of compaction is evident when the cell envelope is broken, releasing the DNA in a looped form ( FIGURE 8.4B ). How the loops are anchored in the nucleoid is not understood. CONCEPT AND REASONING CHECKS
8.2 Justify the necessity for DNA supercoiling and looped domains.
Plasmids carry nonessential, but often useful, information.
Many bacterial, archaeal, and fungal cells contain plasmids, which are stable extrachromosomal DNA elements that do not carry genetic information essential for normal structure, growth, and metabolism. This means a plasmid could be removed from a cell without affecting its viability, assuming the cell is in a nutrient-rich environment free of toxic materials. Most plasmids are circular, and they are easily transferred between cells (Chapter 9). Plasmids exist and replicate as independent genetic elements in the cytosol where they typically contain about 2% of the total genetic information of the cell. Exceptions include some plasmids that can be quite large because they can integrate into a chromosome and excise from it many additional chromosomal genes, some of which may be essential for cell growth. In most cases though, plasmids are not essential to the normal survival of the cell but they can confer selective advantages and provide genetic flexibility for those organisms possessing plasmids. For example, some bacterial plasmids, called F plasmids, allow for the trans-
Loop anchor Protein
Loop domain structure of a bacterial chromosome (A) (a)
DNA double helix
(B)
DNA Packing. (A) The loop domain structure of the chromosome as seen head-on. The loops in DNA help account for the compacting of a large amount of DNA in a relatively small cell. (B) An electron micrograph of an E. coli cell immediately after cell lysis. The uncoiled DNA fiber exists in loops attached to the disrupted cell envelope. (Bar = 1 µm.) »» How does plasmid structure compare to that of the chromosome in a bacterial cell? FIGURE 8.4
62582_CH08_222_259.pdf 228
2/4/10 2:06 PM
8.2 DNA Replication
fer of genetic material from donor to recipient through a recombination process (Chapter 9). Other plasmids may play protective roles. R plasmids (“resistance” factors), for example, carry genes for antibiotic resistance. Others contain genes for resistance to potentially toxic heavy metals (e.g., silver, mercury). Some plasmids provide offensive abilities. For example, species of Streptomyces carry plasmids for the production of antibiotics while plasmids in other bacteria contain genes for the production of bacteriocins, a group of proteins that inhibit or kill other bacterial species.
8.2
Finally, there are plasmids containing genes coding for toxins affecting human cells and disease processes. The genes encoding the toxins responsible for anthrax are carried on a plasmid. We shall have much to say about these extrachromosomal units when we discuss recombination and genetic engineering in the next chapter. CONCEPT AND REASONING CHECKS
8.3 What does it mean to say plasmids carry nonessential genetic information?
DNA Replication
Watson and Crick’s 1953 paper on the structure of DNA provided a glimpse of how DNA might be copied. They concluded, “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.” In fact, the copying of the genetic material, called DNA replication, occurs with such precision that the two daughter cells from binary fission are genetically identical to the parent cell. DNA Replication Occurs in “Replication Factories” KEY CONCEPT
4.
229
DNA replication is a three-phase event requiring an array of proteins working in sequence.
As described in Chapters 3 and 4, the archaeal organisms appear to be an interesting mosaic of bacterial, eukaryotic, and unique features. This applies to the chromosome (see Table 8.1) and to DNA replication as well. Most archaeal proteins involved in DNA replication are more similar in sequence to those found in eukaryotic cells than to analogous replication proteins in bacterial cells. The archaeal DNA replication apparatus also contains features not found in other organisms, which is probably a result of the broad range of environmental conditions in which members of this domain thrive. That being said, we will examine DNA replication in E. coli, which has been more thoroughly studied than most other microbes.
62582_CH08_222_259.pdf 229
Chromosome replication requires the products of more than 20 genes and, although it occurs in a smooth process, we can separate it into three stages ( FIGURE 8.5 ): initiation when the DNA unwinds and the strands separate; elongation when enzymes synthesize a new polynucleotide strand of DNA for each of the two old template (parental) strands; and termination, when each of the two DNA helices separate from one another. This combination of a new and old strand was first observed in E. coli in 1958 by Matthew J. Meselson and Franklin W. Stahl. It is called semiconservative replication because each old strand of the replicated DNA is conserved in each new chromosome and one strand is newly synthesized. Let’s look at each stage in more detail using Figure 8.5 to guide us. Initiation. DNA replication starts at a fixed region on the chromosome called the replication origin (oriC), which is a sequence of about 250 base pairs. A group of initiator proteins binds at the origin along with other enzymes, forming two “replication factories” in which DNA synthesis will occur. Helicases unwind and unzip the two polynucleotide strands, while stabilizing proteins keep the template strands separated for the replication of complementary strands. Because the replication factories are thought to be attached to the cell membrane, the yet to be replicated template strands move through a V-shaped replication fork in each factory.
Base pairs: The complementary pairing of A—T and G—C on the two opposite polynucleotide strands.
2/4/10 2:06 PM
230
CHAPTER 8
Microbial Genetics
INITIATION
Bacterial chromosome
ELONGATION
V-shaped replication fork
TERMINATION
New chromosome
Replication factory
ori C
DNA Replication: 1. Initiation • Replication of the circular bacterial chromosome begins at a fixed region on the DNA called ori C . • At oriC, copies of initiation proteins bind to the oriC DNA sequences. • The other proteins needed for replication will then add to this so-called “replication factory.”
DNA Replication: 2. Elongation • The replication factories are attached to the cell membrane and consist of a variety of enzymes needed to unwind, separate, and synthesize a complementary strand. • Therefore, as replication continues, unreplicated (parental) DNA (black) is pushed through a replication factory at a replication fork, synthesizing a complementary strand (yellow) to the template strand, forming the elongating DNA loops. • Because the two parental DNA strands are antiparallel, replication involves leading and lagging strand synthesis at the replication fork in each replication factory. (see Figure 8.6).
DNA Replication: 3. Termination • Replication comes to completion when the replication factories reach a terminus region opposite the ori C in the chromosome. • At the terminus, termination proteins bind and the replication factories disperse. • Each daughter chromosome consists of one old parental strand (black) and one newly synthesized strand (yellow).
New chromosome
FIGURE 8.5 Replication of the Circular Chromosome of E. coli. DNA replication involves the addition of complementary bases to the parental (template) strand within replication factories that are attached to the cell membrane. »» Why is DNA replication considered to be semiconservative?
62582_CH08_222_259.pdf 230
2/4/10 2:06 PM
8.2 DNA Replication
Elongation. Synthesis of DNA in each factory then occurs on each old strand, which represents a template for the synthesis of a new complementary strand. Many proteins are involved in DNA synthesis. Besides the stabilizing protein, a DNA polymerase III moves along each strand, catalyzing the insertion of new complementary nucleotides to each template strand. In E. coli, DNA synthesis takes about 40 minutes, which means at each replication fork DNA polymerase III is adding new complementary bases at the rate of about 1,000 per second! At this pace, errors occur where an incorrect base is added. Such potential mutations could be lethal, so there must be a mechanism to correct any errors. DNA polymerases III and I detect any mismatched nucleotides, remove the incorrect nucleotide in the pair, and add the correct nucleotide. Such proofreading reduces replication errors to about 1 in every 10 billion bases added. We will have more to say about mutations later in this chapter. Termination. In about 40 minutes, the two replication forks meet 180° from oriC. At the terminus region, there are additional terminator proteins that block further replication, causing the replication factories to dissociate. Then, the two intertwined DNA molecules (chromosomes) are separated by other enzymes, guaranteeing that each daughter cell will inherit one complete chromosome after binary fission (see Chapter 5).
231
Leading Strand Synthesis. One parental strand in each replication factory is the template for synthesizing a continuous complementary leading strand. Here the DNA polymerase reads the template in the 3⬘ to 5⬘ direction, bringing in triphosphate nucleotides (A, T, G, and C) that hydrogen bond with their complement in the template strand. The high-energy bonds in the triphosphate nucleotides provide the energy for the DNA polymerase to covalently join nucleotides into the continuous strand, forming an elongating chain of nucleotides from 5⬘ to 3⬘. Lagging Strand Synthesis. The other template strand in each fork of a replication factory must be read “backwards”; that is, as the DNA polymerase moves away from the replication fork, a discontinuous process of starts and stops occurs, with the new strand always lagging behind the leading strand. This piecemeal strand, therefore, is called the lagging strand. These segments, which are about 1,000 nucleotides long, are called Okazaki fragments, after Reiji Okazaki, who discovered them in 1968. As these new polynucleotide segments are produced, the gaps between segments are eventually joined into a complete and elongating single strand with the help of an enzyme called DNA ligase.
Mutations: Permanent alterations in DNA base sequences.
CONCEPT AND REASONING CHECKS
8.5 Why are there leading and lagging strands in each replication fork?
CONCEPT AND REASONING CHECKS
8.4 Describe the role for replication factories in DNA synthesis.
DNA Polymerase Only Reads in the 3⬘ to 5⬘ Direction KEY CONCEPT
5.
Continuous and discontinuous DNA synthesis occur in each replication fork.
3′ 5′
Old (parental) DNA strands
DNA polymerase
5′ 3′
DNA helicase 3′
Because DNA polymerase can “read” the template DNA only in the 3⬘ to 5⬘ direction and the two parental (template) strands are antiparallel, this means at each replication fork the complementary DNA strand is formed in two different ways ( FIGURE 8.6 ).
62582_CH08_222_259.pdf 231
Stabilizing proteins
New (complementary) strand replicated continuously (leading strand) New (complementary) strand replicated in pieces, producing Okazaki fragments (lagging strand)
DNA 5′ ligase FIGURE 8.6 A Replication Factory. This diagram outlines the general events occurring at one replication fork, showing both the leading and lagging strand synthesis. The discontinuous synthesis on the lagging strand results from the DNA polymerase moving away from the replication fork, resulting in the formation of short DNA fragments, called Okazaki fragments, which are eventually joined by a DNA ligase. »» Why is the DNA polymerase on the lagging strand moving away from the replication fork?
2/4/10 2:06 PM
232
CHAPTER 8
Microbial Genetics
8.3
Genetic code: The sequence of bases in the DNA or codons in the RNA that specify a specific polypeptide.
Protein Synthesis
The discovery of the structure of DNA also provided a glimpse into understanding how a cell makes proteins. Protein synthesis is a process in which amino acids are precisely bound together in a three-dimensional structure determined by the hereditary information, the genes, in the cell. The process requires not only DNA, but also ribonucleic acid (RNA). Both DNA and RNA were described in Chapter 2 and are summarized in TABLE 8.2 . A review of their structure is recommended so the discussion to follow can be fully comprehended. One of the central truths in biology states that the genetic information in DNA first is expressed as RNA by a process called transcription. One type of RNA then functions as a messenger by carrying the genetic code to areas of the cytosol where the ribosomes are located. There, amino acids are fitted together in a precise sequence to form the protein. This sequencing process, called translation, reflects the genetic information in the DNA. This central “dogma” (dogma = “opinion”) of biology is shown in FIGURE 8.7 . As we will see in Chapter 13, a few viruses modify this rule.
DNA
Transcription mRNA
Translation Ribosome
Polypeptide
FIGURE 8.7 The Central Dogma. The flow of genetic information proceeds from DNA to RNA to protein (polypeptide). »» What is the name for the segment of DNA that is used to make a protein?
Transcription Copies Genetic Information into Complementary RNA KEY CONCEPT
6.
Different DNA segments are transcribed into one of three types of RNA.
TABLE
8.2
A Comparison of DNA and RNA
DNA (Deoxyribonucleic Acid)
RNA (Ribonucleic Acid)
In Bacteria and Archaea, found in the nucleoid and plasmids; in Eukarya, found in the nucleus, mitochondria, and chloroplasts Always associated with chromosome (genes); each chromosome has a fixed amount of DNA
In all organisms, found in the cytosol and in ribosomes; in Eukarya, found in the nucleolus
Contains a 5-carbon sugar called deoxyribose Contains bases adenine, guanine, and cytosine, thymine Contains phosphorus (in phosphate groups) that connects deoxyribose sugars with one another Functions as the molecule of inheritance Double stranded Larger size
62582_CH08_222_259.pdf 232
Found mainly in combinations with proteins in ribosomes (ribosomal RNA) in the cytosol, as messenger RNA, and as transfer RNA Contains a 5-carbon sugar called ribose Contains bases adenine, guanine, cytosine, and uracil Contains phosphorus (in phosphate groups) that connects ribose sugars with one another Functions in protein synthesis and gene regulation Usually single stranded Smaller size
2/4/10 2:06 PM
8.3 Protein Synthesis
A microorganism’s genome contains a significant number of genes (see Figure 8.3). Transcription is the process of expressing a number of these genes at a particular time. Thus, the gene DNA serves as a template for new RNA molecules ( FIGURE 8.8 ). RNA polymerase is the enzyme that carries out transcription. In the Bacteria and Archaea, there is but one RNA polymerase with the archaeal enzyme being more similar to the eukaryotic polymerases. Like DNA polymerases, the RNA polymerase “reads” the DNA template strand in the 3⬘ to 5⬘ direction. However, unlike DNA replication, only one of the two DNA strands within a gene is transcribed. The RNA polymerase recognizes this DNA template strand by a sequence of bases called the promoter located on the template strand. The polymerase binds to the promoter (initiation), unwinds the helix, and separates the two strands within the gene. As the enzyme moves along the
DNA template strand (elongation), complementary pairing brings RNA triphosphate nucleotides to the template strand—guanine (G) and cytosine (C) pair with one another and thymine (T) in the DNA template pairs with adenine (A) in the RNA. However, an adenine base on the DNA template pairs with a uracil (U) base in the RNA because RNA nucleotides contain no thymine bases (see Chapter 2). Like initiation, termination of transcription occurs at specific base sequences, called terminators, on the DNA template strand. The RNA transcription product released represents a complementary image to the sequence of bases in the DNA template strand. Transcription produces three types of RNA, all of which are needed for translation. Messenger RNA (mRNA). This RNA carries the genetic information or “blueprint” to
Direction of transcription C
RNA polymerase DNA template strand
C
G
A
A C
G
T
C
5′
A
A
C G
T
T
A
C C
U
A
U
C
3′
A G
G
T G
G
3′
C
3′
233
G T
A
G G
C
T
G
G G
T
5′
A A
Inactive DNA strand
Transcription • Transcription is DNA-directed RNA synthesis of a gene catalyzed by an RNA polymerase. • The RNA polymerase starts transcription at a control sequence called a promoter (not shown, but see Figure 8.14) found on the template strand. • The RNA polymerase transcribes the template, substituting uracil for thymine where adenine appears in the DNA template strand. • In Bacteria and Archaea, transcription stops at DNA sequences called terminators (not shown). The resulting transcript is released as a single polynucleotide strand.
Newly made mRNA transcript
5′
FIGURE 8.8 The Transcription Process. For transcription to occur, a gene must unwind and the base pairs separate. The enzyme RNA polymerase does this as it moves along the template strand of the DNA and adds complementary RNA nucleotides. Note that the other DNA strand of the gene is not transcribed. »» Justify the need for a promoter sequence in a gene.
62582_CH08_222_259.pdf 233
2/4/10 2:06 PM
234
CHAPTER 8
Microbial Genetics
OH
Amino acid attachment site
Acceptor stem
(A)
Anticodon
OH Acceptor stem
(B)
Anticodon
FIGURE 8.9 Structure of a Transfer RNA (tRNA). (A) The traditional “cloverleaf” configuration for tRNA. The anticodon will pair up with a complementary codon in the mRNA. The appropriate amino acid attaches to the end of the acceptor arm. (B) A schematic diagram of the more correct three-dimensional structure of a tRNA. »» What part of the tRNA is critical for the complementary binding to a codon in a mRNA?
manufacture a polypeptide. Each mRNA transcribed from a different gene carries a different message; that is, a different sequence of nucleotides coding for a different polypeptide. The message is encoded in a series of three-base codes or codons found along the length of the mRNA. Each codon specifies an individual amino acid to be slotted into position during translation. Ribosomal RNA (rRNA). Three rRNAs are transcribed from specific regions of the DNA. Together with protein, these RNAs serve a structural role as the framework of the ribosomes, which are the sites at which amino acids assemble into proteins (see Figure 4.19). They also serve a functional role in the translation process. Transfer RNA (tRNA). The conventional drawing for a tRNA is in a shape roughly like a cloverleaf ( FIGURE 8.9 ). One point presents a sequence of three nitrogenous bases, which func-
62582_CH08_222_259.pdf 234
tions as an anticodon; that is, a sequence that complementary binds to an mRNA codon. The tRNAs have a structural role in delivering amino acids to the ribosome for assembly into proteins. Each tRNA has a specific amino acid attached through an enzymatic reaction involving ATP. For example, the amino acid alanine binds only to the tRNA specialized to transport alanine; glycine is transported by a different tRNA. There is one important difference between microbial RNAs. In bacterial and some archaeal cells, all of the bases in a gene are transcribed and used to specify a particular protein ( FIGURE 8.10A ). However, in many archaeal and eukaryotic cells certain portions of a gene are not part of the final RNA and are removed from the RNA before the molecule can function ( FIGURE 8.10B ). These intervening DNA segments removed after transcription are called introns, while the remaining, amino acid-coding segments are called exons. While the exons have the “standard” information coding for a polypeptide (or protein), the introns also may have roles in gene regulation, or in metabolic control through association with other RNAs or proteins. This may have helped in the evolution of multicellularity. CONCEPT AND REASONING CHECKS
8.6 How is a bacterial gene processed differently from a eukaryotic gene?
The Genetic Code Consists of ThreeLetter Words KEY CONCEPT
7.
More than one codon often specifies a specific amino acid.
By now you should have the idea that the information to specify the amino acid sequence for a polypeptide is encoded in the gene DNA. This specific sequence of nucleotide bases is called the genetic code and each sequence is made up of “three-letter words” that we called a codon. To synthesize a polypeptide then, the DNA codons must first be transcribed into RNA codons, as was depicted in Figure 8.8. One of the startling discoveries of biochemistry is that the genetic code in most cases contains more than one codon for each amino acid. Because there are four nitrogenous bases, mathematics tells
2/4/10 2:06 PM
8.3 Protein Synthesis
Bacterial gene
Eukaryotic gene DNA gene regulation
DNA RNA transcript
235
Exon 1
Intron 1
Exon 2
Intron 2
DNA gene regulation
Exon 3
DNA
Transcription by RNA polymerase
Transcription by RNA polymerase Primary RNA transcript Exon 1 Intron 1
Translation by ribosomes
Exon 2
Intron 2
Exon 3
Intron removal and splicing of exons
Protein Exon 1
Exon 2
Mature RNA Cytoplasmic functions
Intron 1
Exon 3
Translation by ribosomes
Intron 2
Protein
(A)
Other functions
Degraded
Cytoplasmic functions (B)
RNA Processing and Gene Activity. (A) In bacterial cells, gene DNA is almost entirely protein-coding information that is transcribed and translated into a protein having structural or functional roles in the cytoplasm, or gene regulation roles. (B) In eukaryotic cells, some of the intron RNA may be degraded, used to regulate gene function, or be associated with other RNAs or proteins in the cytoplasm. »» How do the roles of exonic RNA and intronic RNA differ? FIGURE 8.10
us 64 possible combinations can be made of the four bases, using three at a time. But there are only 20 amino acids for which a code must be supplied. How do scientists account for the remaining 44 codes? It is now known that 61 of the 64 codons are sense codons that specify an amino acid, and most of those amino acids have multiple codons (as shown in TABLE 8.3 ). For example, GCU, GCC, GCA, and GCG all code for the amino acid alanine (ala). This lack of a one-to-one relationship between codon and amino acid generates redundancy. In Table 8.3, notice one of the 64 codons, AUG, represents the start codon for making a protein. This codon usually specifies the amino acid methionine (met). Three additional codons, which do not code for an amino acid (UGA, UAG, UAA), are called stop codons
62582_CH08_222_259.pdf 235
because they terminate the addition of amino acids to a growing polypeptide chain. CONCEPT AND REASONING CHECKS
8.7 What is meant by the genetic code being redundant? Give two examples.
Before we proceed to the last stage, translation, let’s summarize the protein synthesis process to this point ( FIGURE 8.11 ). 1. Each gene of the DNA contains information to manufacture a specific form of RNA. 2. The information can be transcribed into: • mRNAs, which are produced from genes carrying the information as to what protein will be made during translation; • rRNAs, which form part of the structure of the ribosomes and help in the translation of the mRNA; and
2/4/10 2:06 PM
236
CHAPTER 8
Microbial Genetics
to manufacture specific cellular proteins. Note: although we are using the term protein, what is actually made from the ribosome is a polypeptide. This polypeptide may represent the functional protein (tertiary structure) or first combine with one or more other polypeptides to form the functional protein (quaternary structure), as described in Chapter 2.
TABLE
8.3
The Genetic Code Decoder
The genetic code embedded in an mRNA is decoded by knowing which codon specifies which amino acid. On the far left column, find the first letter of the codon; then find the second letter from the top row; finally read up or down from the right-most column to find the third letter. The three-letter abbreviations for the amino acids are given. Note: In the Bacteria, AUG codes for formylmethionine when starting a polypeptide. Key Alanine Arginine Asparagine Aspartic acid Cysteine Glutamine Glutamic acid Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine
First base
= = = = = = = = = = = = = = = = = = = =
C
Second base A
UUU U UUC UUA UUG
Phe UCU UCC UCA Leu UCG
UAU UAC Ser UAA UAG
CUU CUC C CUA CUG
CCU Leu CCC CCA CCG
CAU CAC Pro CAA
ACU ACC ACA ACG
AAU AAC Thr AAA
AUU AUC A AUA AUG
Ile Met
(START)
GUU GUC G GUA GUG
Val
GCU GCC GCA GCG
CAG
AAG
Ala
GAU GAC GAA GAG
KEY CONCEPT
G
8.
U UGU Cys UGC C UGA STOP A STOP UGG Trp G
Tyr
CGU CGC CGA CGG
His Gln
Asn Lys
Asp Glu
AGU AGC AGA AGG GGU GGC GGA GGG
Arg
Ser Arg
Gly
U C A G U C A G
Third base
Ala Arg Asn Asp Cys Gln Glu Gly His Ile Leu Lys Met Phe Pro Ser Thr Trp Tyr Val
U
Translation Is the Process of Making the Polypeptide
U C A G
DNA
Formylmethionine: The presence of a formyl group (H-CO—) attached to methionine. Ribozyme: An RNA molecule capable of carrying out a chemical reaction.
TRANSCRIPTION
rRNA
With ribosomal proteins
Ribosome
tRNA
mRNA
FIGURE 8.11 The Transcription of the Three Types of RNA. Genes in the DNA contain the information to produce three types of RNA: mRNA, rRNA, and tRNA. »» What is each type of RNA used for in a microbial cell?
• tRNAs, each of which carries a specific amino acid needed for the translation process. 3. With the tRNAs and mRNAs present in the cytosol, they can combine within ribosomes
62582_CH08_222_259.pdf 236
The synthesis of a protein (polypeptide) occurs through chain initiation, elongation, and termination/ release.
In the process of translation, the language of the genetic code (nucleotides) is translated into the language of proteins (amino acids). A refresher on the structure of proteins and the peptide bonds holding them together will be of value (see Chapter 2). As with DNA replication and RNA transcription, translation occurs in three steps: chain initiation, elongation, and termination. Chain Initiation. Translation begins with the association of a small ribosomal subunit with an initiator tRNA at the AUG start codon ( FIGURE 8.12A ). Then, the large ribosomal subunit was added to form the functional ribosome with three tRNA binding sites, called A, P, and E. In Bacteria, the first amino acid is formylmethionine (fmet) while in the Archaea and Eukarya, it is methionine (met). Once formed, a second tRNA can complementary bind at the A site and a ribozyme transfers the fmet to the amino acid on the second tRNA. Chain Elongation. With the second tRNA attached, the first tRNA is released from the E site ( FIGURE 8.12B ). Moving right one codon, the ribosome exposes the next codon (GCC), and the appropriate tRNA with the amino acid alanine (ala) attached. Again, a ribozyme transfers the dipeptide fmet-Ser to alanine. The tRNA that carried serine exited the ribosome and the process of chain elongation continues as the ribosome moves to expose the next codon. Chain Termination/Release. The process of adding tRNAs and transferring the elongating
2/4/10 2:06 PM
8.3 Protein Synthesis
fmet
237
Amino acid tRNA
U A C
E
Anticodon
P
A
A U G U C C G C C U A C G U C U C C A C C U G A
Start
Small ribosomal subunit (30S)
Messenger RNA
The representation for a ribosome in this series of figures for translation.
(A) Translation: Chain Initiation • Translation starts when the translation components [small ribosomal subunit, initiator tRNA, and other protein factors (not shown)] assemble on the start codon. fmet
Ser
• The large ribosomal subunit then associates to form a functional ribosome with three binding sites, called A, P, and E.
Large ribosomal submit (50S)
• After the initiator tRNA binds to the P site, the next tRNA can bind to the A site.
G G U A C A A U G U C C G C C U A C G U C U C C A C C U G A
• A ribozyme of the large subunit then transfers the amino acid from the first tRNA onto the tRNA in the A site.
(A) FIGURE 8.12 Protein Synthesis in a Bacterial Cell. The steps of (A) chain initiation, (B) chain elongation, and (C) chain termination are outlined. »» How do the P, A, and E sites in the ribosome differ? Continued
polypeptide to the entering amino acid/tRNA at the A site continues until the ribosome reaches a stop codon (UGA in this example). There is no tRNA to recognize any of these stop codons ( FIGURE 8.12C ). Rather, proteins called termination factors bind where the tRNA would normally attach. This triggers the release of the polypeptide and a disassembly of the ribosome subunits, which can be reassembled for translation of another mRNA. During synthesis, the polypeptide already may start to twist into its secondary and tertiary structure. For many polypeptides, groups of cytoplasmic proteins called chaperones ensure the folding process occurs correctly.
62582_CH08_222_259.pdf 237
MICROFOCUS 8.2 describes how the understanding of protein synthesis has been used to block “harmful” proteins from being made. Cells typically make hundreds, if not thousands, of copies of each protein. Producing such large amounts of a protein can be done efficiently and quite quickly. Remember, a cell contains thousands of identical ribosomes. Therefore, a single mRNA molecule can be translated simultaneously by several ribosomes ( FIGURE 8.13 ). Once one ribosome has moved far enough along the mRNA, another small subunit can “jump on” and initiate translation. Such a string of ribosomes all translating the same mRNA at the same time is called a polysome.
2/4/10 2:06 PM
238
CHAPTER 8
Microbial Genetics
Ala
Tyr
fmet Ser
fmet Ser
Ala
C G G
A U G
U A C
A G G
A G
G
A U G U C C G C C U A C G U C U C C A C C U G A
A U G U C C G C C U A C G U C U C C A C C U G A
Ribosome movement Val fmet
Ser
(B) Translation: Chain Elongation
Ala
• Once the functional ribosome has been formed, translation is a process of adding new amino acids, one at a time, to the forming polypeptide chain.
Tyr C
G G
C A
G
A U G
A U G U
C C
• The process involves: – The addition of the appropiate tRNA to the A site; – The transfer of the amino acid chain from the amino acid in the P site; and – The loss of a former tRNA from the E site
G C C U A C G U C U C C A C C U G A
fmet
Ser
• The ribosome then moves down one codon and the process repeats; the result is an elongating amino acid sequence. Ala
Tyr y
Val
A U G U
C C
Tyr G C
Termination factor
fmet Ser Ala
C A G G U C U C C A C C U G A
Val
Ser Thr
U G G A U G U
(B)
C C
G C C U A C G U C U C C A C C U G A
Ribosome movement
fmet Ser Ala
(C) Translation: Chain Termination
Tyr
• Chain elongation continues until the A site covers a stop codon (UGA, UAG, or UAA) to which there is no corresponding tRNA.
Val
Ser Thr
U G G
• A termination factor binds to this site, causing: • The release of the polypeptide chain from the P site; • The disassociation of the ribosome into sub units; and • The release of the empty tRNA and termination factor.
A U G U
C C
G C C U A C G U C U C C A C C U G A
STOP
(C)
FIGURE 8.12
Continued.
62582_CH08_222_259.pdf 238
2/4/10 2:06 PM
8.3 Protein Synthesis
239
8.2: Biotechnology
Antisense and Interference Makes Sense With the recent outbreaks of fatal encephalitis caused by the West Nile virus and atypical pneumonia caused by the severe acute respiratory syndrome (SARS) coronavirus, scientists have been trying to find ways to treat and cure these and other viral diseases, because they are not affected by antibiotics. One of the potential approaches being considered is the use of antisense molecules as therapeutic agents. Antisense molecules are RNA fragments that are the complement of an mRNA that carries a specific genetic message for protein synthesis. By binding to the mRNA, antisense molecules should block the ability of ribosomes to translate the message and thus have the ability to shut off the production of unwanted or disease-causing proteins. To treat AIDS, for example, scientists could create an antisense strand that is complementary to specific mRNAs produced by the human immunodeficiency virus (HIV). In an infected individual, the antisense molecules should bind to these viral mRNAs and, as double-stranded RNA molecules, the mRNAs could not be translated by the cell’s ribosomes. Without these essential viral proteins, no new HIV particles could be formed (Chapter 23). Although such strategies make sense on paper, they have yet to produce the successes that were hoped for in clinical trials. More recently, another way has been discovered for turning off or silencing the expression of specific genes. This is called RNA interference (RNAi). This is a technique in which extracellular, double-stranded (ds) RNA that is complementary to a known target mRNA is introduced into a cell. The dsRNA in the cell is chopped into smaller pieces by cellular enzymes and these fragments then bind to the target mRNA. Again these new dsRNA pieces are degraded and the protein or polypeptide is not produced. Indirectly, the gene for that polypeptide has been silenced. One potential use for RNAi is for antiviral therapy. Since many human diseases are caused by viruses that have an RNA genome (Chapter 14), RNAi may be valuable in inhibiting gene expression. For example, RNAi could silence viruses that induce human tumors, as well as the hepatitis A virus, influenza viruses, and other RNA viruses such as the measles virus. In all these examples, if the virus cannot replicate, new viruses cannot be produced—and disease development would be prevented. The potential value of RNAi has recently been recognized. In 2006, Andrew Z. Fire (Stanford University School of Medicine) and Craig C. Mello (University of Massachusetts Medical School) were awarded the Nobel Prize in Physiology or Medicine “for their discovery of RNA interference—gene silencing by doublestranded RNA.”
DNA (gene) mRNA 1 mRNA 2 Polysome
mRNA 3
mRNA 4 (A)
(B)
Coupled Transcription and Translation in E. Coli. (A) The electron micrograph shows transcription of a gene in E. coli and translation of the mRNA. The dark spots are ribosomes, which coat the mRNA. An interpretation of the electron micrograph is shown in (B). Each mRNA has ribosomes attached along its length. The large red dots are the RNA polymerase molecules; they are too small to be seen in the electron micrograph. The length of each mRNA is equal to the distance that each RNA polymerase has progressed from the transcription-initiation site. For clarity, the polypeptides elongating from the ribosomes are not shown. »» From the interpretation of the micrograph, (a) how many times has this gene been transcribed and (b) how many identical polypeptides are being translated? FIGURE 8.13
62582_CH08_222_259.pdf 239
2/4/10 2:06 PM
240
CHAPTER 8
Microbial Genetics
CONCEPT AND REASONING CHECKS
8.8 Explain why the ribosome can be portrayed as a “cellular translator.”
Antibiotics Interfere with Protein Synthesis KEY CONCEPT
9.
Many antibiotics can inhibit transcription or translation.
Many antibiotics affect protein synthesis in bacterial cells and therefore are clinically useful in treating human infections and disease. A few antibiotics interfere with transcription. Rifampin binds to the RNA polymerase so that transcription cannot initiate. A very large number of antibiotics inhibit translation by binding to the bacterial 30S or 50S ribosomal subunit. For example, tetracycline prevents chain initiation by binding to the 30S subunit, while drugs like chloramphenicol and erythromycin inhibit chain elongation by binding to the 50S subunit. We will have much more to learn about antibiotics in Chapter 24. CONCEPT AND REASONING CHECKS
8.9 Propose a hypothesis to explain why so many antibiotics specifically affect protein synthesis.
Protein Synthesis Can Be Controlled in Several Ways KEY CONCEPT
10. Many genes are controlled by operons.
In Chapter 6, we described how negative feedback can control enzyme activity. Another control mechanism is to simply not make the enzyme (or any other protein in general) when it is not needed. Because transcription is the first step leading to protein manufacture in cells, another way to control what proteins and enzymes are present in bacterial and archaeal cells is to regulate the mechanisms that induce (“turn on”) or repress (“turn off”) transcription of a gene or set of genes. In 1961, two Pasteur Institute scientists, Françoise Jacob and Jacques Monod, proposed such a mechanism for controlling protein synthesis. They suggested segments of bacte-
62582_CH08_222_259.pdf 240
rial DNA are organized into functional units called operons ( FIGURE 8.14 ). Their pioneering research along with more recent studies indicates that each operon consists of a cluster of structural genes providing genetic codes for proteins often having metabolically related functions. In this way, bacterial and archaeal cells can co-regulate genes needed in the same functional or metabolic pathway (see Chapter 6). Adjacent to the structural genes is the operator, which is a sequence of bases controlling the expression (transcription) of the structural genes. Next to the operator is a promoter, which represents the sequence of bases to which the RNA polymerase binds to initiate transcription of the structural genes. Also important, but not part of the operon is a distant regulatory gene that codes for a repressor protein. In the operon model, the repressor protein binds to the operator. Binding prevents the RNA polymerase from moving down the operon and thus cannot transcribe the structural genes. This is called negative control of protein synthesis because the repressor protein inhibits or “turns off” gene transcription within the operon. When the repressor in some way is prevented from binding to the operator, the RNA polymerase has clear sailing and transcribes the structural genes, which then are translated into the final polypeptides. M ICRO I NQUIRY 8 presents two contrasting examples of how an operon works to induce or repress gene transcription. Following the series of observations and explanations given in the MicroInquiry, you should have a firm understanding of how bacterial and archaeal cells can control protein synthesis through transcription. CONCEPT AND REASONING CHECKS
8.10 Why is transcription described in this section referred to as negative control?
Transcription and Translation Are Compartmentalized KEY CONCEPT
11. Transcription and translation occur in spatially separated compartments.
2/4/10 2:06 PM
8.3 Protein Synthesis
241
Operon DNA
Promoter
I
Operator
A
Promoter
I
Operator
A
B
RNA polymerase
Transcription
C
A An operon consists of one or more structural genes, an operator, and a promoter. A regulatory gene is found at a site separate from the operon.
C
B The regulatory gene encodes a repressor protein that binds to the operator, thereby preventing the transcription of the structural genes by the RNA polymerase.
Structural genes
Regulatory gene
DNA
B
No Transcription
mRNA Repressor binds with operator
Translation Repressor protein
DNA
I
Promoter
Operator
A
B
C
C If the repressor protein is blocked somehow from binding to the mRNA operator, the RNA polymerase is free to Translation transcribe the structural genes. B C Transcription
A
Proteins FIGURE 8.14 The Operon and Negative Control. An operon consists of a group of structural genes that are under the control of a single operator. Negative control exists if the operator prevents the RNA polymerase from transcribing the structural genes. »» How does the operator prevent structural gene transcription in negative control?
In Chapter 4, we described the nucleoid as an amorphous area containing the cell’s chromosome. It also was noted that although the nucleoid lacked a nuclear envelope, nucleoid and cytoplasmic activities were segregated much as they are in eukaryotic cells. Research studies have shown that, at least in Bacillus subtilis, RNA polymerases are concentrated within the nucleoid core in the central portion of the cell ( FIGURE 8.15 ). If correct, then most of the cell’s transcription presumably occurs in the same region. In fact, RNA polymerase was often localized to specific regions of the nucleoid, somewhat similar to its localization in eukaryotic nucleoli
62582_CH08_222_259.pdf 241
carrying out rRNA synthesis. This is in contrast to the localization of ribosomes, which are absent in the nucleoid region and primarily concentrated at the cell poles. If the observation with B. subtilis holds true for other members of the Bacteria and Archaea, then the ability to segregate transcription and translation without the need for a nuclear envelope is analogous to that of the Eukarya. Other research suggests that individual genes and DNA segments within the chromosome also have specific positions within the nucleoid. For example, the oriC region of the chromosome lies at one end of the nucleoid and is associated with the cell membrane. The precise mechanisms
2/4/10 2:06 PM
242
CHAPTER 8
Microbial Genetics
INQUIRY
8
The Operon Theory and the Control of Protein Synthesis
The Lactose (lac) Operon Here is a piece of experimental data. The disaccharide lactose represents a potential energy source for E. coli cells if it can be broken into its monomers of glucose and galactose. One of the enzymes involved in the metabolism of lactose is β-galactosidase. If E. coli cells are grown in the absence of lactose, β-galactosidase activity cannot be detected as shown in the graph (Figure A). However, when lactose is added to the nutrient broth, very quickly enzyme activity is detected. How can this change from inhibition to expression be explained in the operon model? Based on the operon theory, we would propose that when lactose is absent from the growth medium, the repressor protein for the lac operon binds to the operator and blocks passage of the RNA polymerase that is attached to the adjacent promoter (Figure Bi). Being unable to move past the operator, the polymerase cannot transcribe the structural genes, one of which (lacZ) codes for β-galactosidase. When lactose is added to the growth medium, lactose will be transported into the bacterial cell, where the disaccharide binds to the repressor protein and inactivates it (Figure Bii). With the repressor protein inactive, it no longer can recognize and bind to the operator. The RNA polymerase now is not blocked and can translocate down the operon and transcribe the structural genes. Lactose is called an inducer because its presence has induced, or “turned on,” structural gene transcription in the lac operon. It explains why β-galactosidase activity increases when lactose was present. Now let’s see if you can figure out this scenario.
62582_CH08_222_259.pdf 242
Tryptophan (trp) Operon E. coli cells have a cluster of structural genes that code for five enzymes in the metabolic pathway for the synthesis of the amino acid tryptophan (trp). Therefore, if E. coli cells are grown in a broth culture lacking trp, they continue to grow normally by synthesizing their own tryptophan, as shown in the graph (Figure A). However, as the graph shows, when trp is added to the growth medium, new enzyme synthesis is repressed or “turned off” and cells use the trp supplied in the growth medium. How can enzyme repression be explained by the operon model? The solution is provided in Appendix D.
β-Galactosidase Galactosidase/trp enzyme activity
The best way to visualize and understand the operon model for control of protein synthesis is by working through a couple of examples.
Enzymes involved in tryptophan (trp) synthesis
Tryptophan added
Lactose added
Time FIGURE A
Enzyme activity versus time.
lac operon Structural genes DNA
Promoter
Operator
RNA polymerase
Z
Y
A
Transcription blocked
(i) Without lactose
Repressor protein
DNA
Promoter
Operator
Z
Y
A
Transcription occurs
(ii) With lactose FIGURE B
Inactive repressor protein
Lactose (inducer)
Regulation of the lac operon.
2/4/10 2:06 PM
8.3 Protein Synthesis
responsible for nucleoid gene organization and the establishment of core and peripheral zones remain to be elucidated. FIGURE 8.16 summarizes the protein synthesis process.
(A)
243
CONCEPT AND REASONING CHECKS
8.11 How is compartmentation in bacterial and eukaryotic cells similar in regard to transcription and translation?
(B)
The Localization of Transcription and Translation in Bacillus subtilis Cells. (A) In these dividing B. subtilis cells, ribosomal subunits have been labeled with a green fluorescent protein (GFP) and RNA polymerase subunits with a label that fluoresces red. The RNA polymerase (transcription) is found mainly in the nucleoid core while the ribosomes (translation) are concentrated at the poles of the cell. (Bar = 3 µm.) (B) This linescan through the cells confirms the interpretation that where polymerase RNA polymerase fluorescence is high (red line), ribosomal fluorescence is low (green line) and vice-versa. »» How does fluorescence microscopy aid in the identification of spatially separated compartments? FIGURE 8.15
PROTEIN SYNTHESIS involves genes copied into
mRNA
rRNAs
associates with
associate with ribosomal proteins to form
tRNAs
are charged with specific amino acids (AA)
Ribosome
reads the codons to produce
brings specific AA
tRNA-AA
Polypeptide (protein) FIGURE 8.16 A Concept Map for Protein Synthesis. The relationships between transcription and translation, and the three types of RNA, are illustrated. »» In this concept map, circle those parts representing transcription and circle those parts representing translation.
62582_CH08_222_259.pdf 243
2/4/10 2:06 PM
244
CHAPTER 8
Microbial Genetics
8.4
Wild type: The common or native form of a gene or organism.
Mutations
The information in a chromosome may be altered through a permanent change in the DNA, which is called a mutation. In most cases, a mutation involves a disruption of the nitrogenous base sequence in the DNA molecule. From this disruption, the production of a miscoded mRNA, and ultimately the insertion of one or more incorrect amino acids into the polypeptide during translation can occur. Because proteins govern numerous cellular activities, mutations may alter some aspect of these activities—for better or worse (MICROFOCUS 8.3). Mutations Are the Result of Heritable Changes in a Genome KEY CONCEPT
12. Mutations can be spontaneous or induced. Niche: The functioning of a species in relation to other species and its physical environment.
Spontaneous mutations are heritable changes to the base sequence in the DNA that result from natural phenomena. These changes could be from
everyday radiation penetrating the atmosphere or errors made and not corrected by DNA polymerase III during replication. It has been estimated that one such mutation may occur for every 106 to 1010 divisions of a microbial cell. A mutant cell arising from a spontaneous mutation usually is masked by the normal wild type cells in the population. However, should some agent be present from which the mutant survives, it may multiply and emerge as the predominant form. For many decades, for example, doctors used penicillin to treat gonorrhea. Then, in 1976, a penicillin-resistant strain of Neisseria gonorrhoeae emerged in human populations. Many investigators believe the resistant bacterial strain had been present for perhaps centuries, but only now with heavy use of penicillin could it arise and fill the niche once held by the penicillin-sensitive forms. MICROFOCUS 8.4 describes another example of an evolutionary shift “caught” in the research lab.
8.3: Evolution
Evolution of An Infectious Disease Could the Black Death of the 14th century and the 25 million Europeans that succumbed to plague have been the result of a few genetic changes to a bacterial cell? Could the entire course of Western civilization have been affected by these changes? Possibly so, maintain researchers from the federal Rocky Mountain Laboratory in Montana. In 1996, a research group led by Joseph Hinnebusch reported that three genes missing in the plague bacillus Yersinia pestis are present in a related species (Y. pseudotuberculosis) that causes mild food poisoning. Thus, it is possible that the entire story of plague’s pathogenicity revolves around a small number of gene changes. Bubonic, septicemic, and pneumonic plague are caused by Y. pestis, a rod-shaped bacterium transmitted by the rat flea (Chapter 12). In an infected flea, the bacterial cells eventually amass in its foregut and obstruct its gastrointestinal tract. Soon the flea is starving, and it starts biting victims (humans and rodents) uncontrollably and feeding on their blood. During the bite, the flea regurgitates some 24,000 plague bacilli into the bloodstream of the unfortunate victim. At least three genes are important in the evolution of plague. The nonpathogenic Y. pseudotuberculosis bacilli have these genes, which encourage the bacilli to remain harmlessly in the midgut of the flea. Pathogenic plague bacilli, by contrast, do not have the genes. Free of control, the bacteria migrate from the midgut to the foregut and form a plug of packed bacilli that are passed on to the victim in a flea bite. In 2002, Hinnebusch and colleagues published evidence that another gene, carried on a plasmid, codes for an enzyme that is required for the initial survival of Y. pestis bacilli in the flea midgut. By acquiring this gene from another unrelated organism, Y. pestis made a crucial jump in its host range. It now could survive in fleas and became adapted to relying on its blood-feeding host for transmission. So, a few genetic changes may have been a key force leading to the evolution and emergence of plague. This is just another example of the flexibility that many microbes have to repackage themselves constantly into new and, sometimes, more dangerous agents of infectious disease.
62582_CH08_222_259.pdf 244
2/4/10 2:06 PM
8.4 Mutations
Most of our understanding of mutations has come from experiments in which scientists purposely generate mutations. Such induced mutations are produced by chemical or physical agents called mutagens. Physical Mutagens. Ultraviolet (UV) light is a physical mutagen whose energy induces adjacent thymine (or cytosine) bases in the DNA to covalently link together forming dimers ( FIGURE 8.17 ). If these dimers occur in a protein-coding gene, the RNA polymerase cannot insert the correct bases (A—A) in mRNA molecules where the dimers are located. Chemical Mutagens. Nitrous acid is an example of a chemical mutagen that converts DNA’s adenine bases to hypoxanthine bases ( FIGURE 8.18A ). Adenine would normally base pair with thymine, but the presence of hypoxanthine causes a base pairing with cytosine after replication. Later, should replication occur from the gene with the cytosine mutation, the mRNA will contain a guanine rather than an adenine. Mutations also are induced by base analogs, such as 5-bromouracil, which bears a close chemical resemblance to thymine ( FIGURE 8.18B ). During replication, the base analog could pair with adenine when thymine should be present. Other base analogs resemble other DNA bases and are useful as antiviral agents in the treatment of diseases caused by DNA viruses, such as the herpesviruses (Chapter 15). Acyclovir, for example, is a base analog that can substitute for guanine during viral replication. The presence of acyclovir blocks viral replication, so new virus particles cannot be produced. As such, treatment with acyclovir can be effective in decreasing the frequency and severity of fever blisters (cold sores). CONCEPT AND REASONING CHECKS
8.12 How do chemical mutagens interfere with DNA replication or protein synthesis?
Point Mutations Can Be Spontaneous or Induced KEY CONCEPT
13. Point mutations affect one base pair in a DNA sequence.
Regardless of the cause of the mutation, one of the most common results is a point mutation, which affects just one point (base pair) in a gene. Such
62582_CH08_222_259.pdf 245
A T
C
A
G
A
T
245
C
T
G
(A) Normal DNA
Ultraviolet light
A
C
A
A
C
T
G
T
T
G
O
O CH3
CH3
N O
(B) Abnormal DNA
Thymine dimer
N T
T
N
N
O
Ultraviolet Light and DNA. (A) When cells are irradiated with ultraviolet (UV) light either naturally or through experiment, the radiations may affect the cell’s DNA. (B) UV light can cause adjacent thymine molecules to pair within the DNA strand to form a thymine dimer. »» How might a thymine dimer block the movement of RNA polymerase? FIGURE 8.17
mutations may be a change to or substitution of a different base pair, or a deletion or addition of a base pair. Base-Pair Substitutions. If a point mutation causes a base-pair substitution, then the transcription of that gene will have one incorrect base in the mRNA sequence of codons. Perhaps one way to see the effects of such changes is using an English sentence made up of three-letter words (representing codons) where one letter has been changed. As three-letter words, the letter substitution still reads correctly, but the sentence makes less sense. Normal sequence: THE FAT CAT ATE THE RAT Substitution: THE FAT CAR ATE THE RAT As shown in FIGURE 8.19A , depending on the placement of the substituted base, when the mRNA is translated this may cause no change (silent mutation), lead to the insertion of the wrong amino acid (missense mutation), or generate a stop codon (nonsense mutation), prematurely terminating the polypeptide.
2/4/10 2:06 PM
246
CHAPTER 8
Microbial Genetics
8.4: Evolution
“Observing” Bacterial Evolution Natural selection works to adapt populations to their prevailing environment. The evolutionary process generates heritable traits that make it more likely that over successive generations the organism will survive and reproduce in that particular environment. One such process for such heritable genetic variation is through random mutation. In the eukaryotic world of plants and animals, observing such heritable and evolutionary phenomena often is impossible because of the long time line between a heritable event and the subsequent evolutionary shift. However, in the bacterial world, where cells divide and populations grow at a much faster pace, modest evolutionary shifts can be “observed.” One well studied example of such natural selection in bacteria is the development of antibiotic resistance. Although generic variation does not necessarily affect survival, some heritable traits can improve the chances of survival of a particular individual. Such an example has been “observed” by Richard Lenski and his group at Michigan State University. In 1988, Lenski took one Escherichia coli cell and from its descendents established 12 separate laboratory populations (see diagram). These populations have continually been maintained and subcultured to where, in 2008, each population had gone through more than 44,000 generations. Over these 20 years, each population was “watched” to see what phenotypic, physiological, and biochemical changes occurred. Through 44,000 generations, all 12 populations (grown aerobically on a glucose and citrate medium) went through millions of mutations and the patterns of changes were similar in all 12 populations. All produced larger cells, grew faster with glucose, had shorter lag phases when subcultured to a fresh medium, and remained unable to metabolize citrate (cit-). But then around the 31,500th generation, population 3 alone exhibited a dramatic change (green dot in figure)—the cells had gained the ability to metabolize citrate (cit+). How did this occur? Certainly, after 31,550 generations, most simple mutations had occurred making it likely that cit+ should have already occurred. Every 500 generations, Lenski had saved samples from all 12 populations. Therefore, he went back and revived samples of each population to see if cit+ would again evolve and, if so, would it be from the same population 3 or from any of the other 11 populations (red dot in figure)? He discovered that only the original population 3 re-evolved cit+, it occurred only from generation 20,000 forward, and cit+ would not occur for another 11,550 generations. Lenski had replayed the original heritable evolutionary event. The conclusion is that some genetic event occurred around generation 20,000 that formed the basis allowing for the eventual development of cit+ more than 10,000 generations later. Some heritable event around generation 20,000 would bring about an evolutionary shift in one population that remained unattainable in the 11 other populations (at least through more than 44,000 generations). Was it a very rare single mutational event, the last of many sequential mutations that started around generation 20,000, or some other genetic change? Lenski and his lab are now attempting to discover what that event was at 20,000 generations that set the stage for cit+ development years later.
Base-Pair Deletion or Insertion. Point mutations also can cause the loss or addition of a base in a gene, resulting in an inappropriate number of bases. Again, using our English sentence, we can see how a deletion or insertion of one letter affects the reading of the three-letter word sentence. Normal sequence: THE FAT CAT ATE THE RAT Deletion: THE F_TC ATA TET HER AT Insertion: THE FAT ACA TAT ETH ERA T As you can see, the “sentence mutations” are nonsense when reading the sentence as three-
62582_CH08_222_259.pdf 246
letter words. The same is true in a cell. Ribosomes always read three letters (one codon) at one time, generating potentially extensive mistakes in the amino acid sequence ( FIGURE 8.19B ). Thus, like our English sentence, the deletion or addition of a base will cause a “reading frameshift” because the ribosome always reads the genetic code in groups of three bases. Therefore, loss or addition of a base shifts the reading of the code by one base. The result is serious sequence errors in the amino acids, which will probably produce an abnormal protein (nonsense) unable to carry out its role in metabolism.
2/4/10 2:06 PM
8.4 Mutations
247
Glu+ Cit–
Glu+ Cit–
1
2
3
4
5
6
7
8
9
10
11
12 Glu+ Cit–
1988: Generation 1 10,000
Resample and grow all 12 populations
20,000 30,000 40,000 2008: Generation >44,000
1
2
Glu+ Cit–
3
4
5
Glu+ Cit+
6
7
8
Glu+ Cit–
9
10
11
12
3
others
Glu+ Cit+
Glu+ Cit–
Larger cells Faster growth with glucose Shorter lag phase
CONCEPT AND REASONING CHECKS
8.13 Justify the statement: “A frameshift mutation potentially is more dangerous to an organism’s viability than a base-pair substitution.”
Repair Mechanisms Attempt to Correct Mistakes or Damage in the DNA KEY CONCEPT
14. Cells have the ability to repair damaged DNA.
During the life of a microbial cell (indeed, of every cell), cellular DNA endures thousands
62582_CH08_222_259.pdf 247
of damaging events resulting from DNA replication errors and other base changes caused by mutagens. Because these errors could disrupt metabolism, cells attempt to correct such DNA damage by using a variety of DNA repair mechanisms. One type of repair mechanism is called mismatch repair. As described earlier in this chapter, as the DNA polymerase adds new complementary bases to the DNA template strand during replication, it makes mistakes. Therefore, as it adds bases, it also “proofreads” its work and removes mismatched nucleotides ( FIGURE 8.20 ).
2/4/10 2:06 PM
C
A
Nitrous acid (HNO2) induces an adenine in the parental DNA molecule to be modified to a hypoxanthine molecule (H).
G C T G T
HNO2
A
When the altered parent DNA strand (bottom) is replicated, a cytosine molecule pairs in the new strand opposite hypoxanthine. Normally, a thymine molecule would pair with adenine.
B
G C T G T
A
The mutated DNA, now with a CG base pair, is passed on to the next generation.
G C C G T
A
C G G C A T
Mutated granddaughter DNA
DNA replication
G C C G T
A
C G A C A T
C G H C A T
C G H C A T
Normal parent DNA
Altered parent DNA
Altered daughter DNA
DNA replication
G C C G T
(a) How nitrous acid (HNO2) leads to mutation
A
C G H C A T O H C 3
O
C C
N
C
C
C
Br
H
Altered granddaughter DNA
H
C
N
C
C
D H
O
N
H
O
N
H
H
Thymine
5-bromouracil
The mutated DNA (with hypoxanthine) also is passed on.
(b) A nitrogenous base and its mutation-causing analog
The Effect of Chemical Mutagens. (A) Nitrous acid induced an adenine to hypoxanthine change. After replication of the hypoxanthine-containing strand, the granddaughter DNA has a mutated C—G base pair. (B) Base analogs induce mutations by substituting for nitrogenous bases in the synthesis of DNA. Note the similarity in chemical structure between thymine and the base analog 5-bromouracil. »» How does nitrous acid differ from 5-bromouracil in inducing mutations? FIGURE 8.18
Normal sequence mRNA
A U G C A G A C A U C U U A G
Protein
Met
Gln
(a) Base-pair substiutions
Thr
Ser
stop
(b) Deletion/insertion
Silent mutation
Deletion A instead of G
Loss of A
A U G C A A A C A U C U U A G Met
Gln
Thr
Ser
stop
Missense mutation A instead of C
Lys
Thr
Met
Gln
His
Leu
Insertion G inserted
A U G A A G A C A U C U U A G Met
A U G C A G C A U C U U A G
Ser
stop
A U G G C A G A C A U C U U A G Met
Ala
Asp
Ile
Leu
Nonsense mutation U instead of C A U G U A G A C A U C U U A G Met
stop
Categories and Results of Point Mutations. Mutations are permanent changes in DNA, but they are represented here as they are reflected in mRNA and its protein product. (A) Base-pair substitutions can produce silent, missense, or nonsense mutations. (B) Deletions or insertions shift the reading frame of the ribosome. »» Determine the normal sequence of bases in the template strand of the gene and the base change that gave rise to each of the “mutated” mRNAs. FIGURE 8.19
62582_CH08_222_259.pdf 248
2/4/10 2:06 PM
8.4 Mutations
C
G
C
G
C
G
T
A
T
A
T
A
T
A
T
A
T
A
C
G
C
G
C
G
A
T
A
T
A
T
G
C
A C
G
Normal base pairing
G
T
G
Mismatched nucleotide
DNA polymerase
C
A. Incorrect nucleotide A incorporated.
T
G
C
C
A
T
G
C
A
G A
C
C
A
C
A
G
249
T
G C
C
C. C Addition of correct nucleotide.
B. Excision of incorrect B nucleotide.
FIGURE 8.20 Mismatch Repair Mechanisms. Mismatch repair during DNA replication. As a result of an incorrectly paired nucleotide (A), DNA polymerase removes (excises) the nucleotide (B) and adds the correct complementary nucleotide (C). »» Propose a hypothesis to explain how the DNA polymerase “knows” there is a mismatch during replication.
So, the repair process is somewhat like driving with a mechanic in the back seat. The fact that DNA is double-stranded is not a fluke. By being double-stranded, one strand can act as a template to correct mismatches. It is estimated that about 1 in 10,000 bases is mismatched during DNA replication. E. coli has about 4.6 million bases in its chromosome, so mathematics says over 460 mismatches will occur and must be repaired every replication. Considering the enzyme is catalyzing the addition of 50,000 bases every minute, an initial one percent error rate is very efficient. Mutations caused by physical mutagens also can be corrected. Almost 100 different nuclease enzymes are known to exist in E. coli cells. When DNA is damaged by a physical mutagen, such as UV light, several of these nucleases execute excision repair ( FIGURE 8.21 ). First, nucleases cut out (excise) the damaged DNA. Then, a different DNA polymerase from the one used in replication replaces the missing nucleotides with the correct ones. Finally, DNA ligase seals the new strand into the rest of the polynucleotide. An impressive example of DNA repair is seen in Deinococcus radiodurans (MICROFOCUS 8.5). CONCEPT AND REASONING CHECKS
8.14 Explain why cells need at least two repair mechanisms (mismatch and excision).
62582_CH08_222_259.pdf 249
T
T
A
A
T
T
T C G
A
A
T
T C A G
A G C
T
T
A
G T C
T C G
A
A
T
T C A G
A G C T C G
A G C
A A G T C T
Thymine dimer distorts DNA strand.
T C A G
A A G T C
DNA polymerase
A G C
T
T
A A G T C
T C G
A
A
T
T C A G
A The damaged strand is cut and removed by a nuclease enzyme.
B The complementary (undamaged) strand serves as a template to repair the damaged strand. C The repaired strand is sealed to the polynucleotide by DNA ligase.
FIGURE 8.21 Excision Repair Mechanism. Thymine dimer distortion triggers nuclease repair enzymes that excise the damaged DNA and permit resynthesis of the correct nucleotides. »» How might excision nucleases recognize an error in a DNA fragment?
2/4/10 2:06 PM
250
CHAPTER 8
Microbial Genetics
8.5: Evolution
Shattered Chromosomes It has been called “Conan the Bacterium”1 and has been listed in The Guinness Book of World Records as “the world’s toughest bacterium.” The organism: Deinococcus radiodurans, a spherical bacterial species arranged in tetrads (see figure), is easily cultured and does not cause any known disease. The species was discovered in 1956 when a scientist at the Oregon Agricultural Experiment Station in Corvallis, Oregon was doing experiments to see if canned food could be sterilized with high doses of gamma radiation (see Chapter 7). To test this, he irradiated a can of ground meat with a dose of radiation that was 250-times higher than that needed to kill Escherichia coli, so the dose should have killed any living organism. Surprisingly, the can of meat subsequently spoiled and a bacterium was isolated. It had amazingly survived the impossible. It was named Deinococcus (deino = “terrible”; coccus = “sphere”) radiodurans (radio = “ray”; dura = “hard”) referring to its resistance to gamma ray radiation. Analysis of D. radiodurans’ genome indicates A false-color scanning electron micrograph of Deinococcus that it consists of two circular chromosomes, radiodurans (Bar = 2 µm). one of 2.6Mb and the other of 0.41Mb, containing about 3,200 genes. During stationary phase of its growth curve, each bacterial cell contains four copies of this genome; when in log phase, each bacterium contains 8 to 10 copies of the genome. Further studies have shown that D. radiodurans can survive up to 5,000 gray (Gy; formerly called rad = 0.01 Gy) of ionizing radiation, which should cause several hundred double-stranded breaks—one of the hardest types of DNA damage to repair—in the organism’s DNA. For comparison, 10 Gy can kill a human. So, how does D. radiodurans survive a dose of radiation that produces “shattered chromosomes” consisting of hundreds of short DNA fragments? The key appears to be the presence of multiple copies of its genome and a rapid, novel two-step DNA repair mechanism that can repair double-stranded breaks in its chromosomes within just a few hours. First, repair requires at least two genome copies broken at different positions. Therefore, D. radiodurans undergoes massive and rapid DNA synthesis to produce a mosaic of new and old fragments with single-stranded ends that can then reconnect accurately into larger chromosomal segments. In the second step, a protein, called RecA, efficiently joins the double-strand breaks into functional chromosomes. It is a remarkably efficient process that occurs in an equally incredible short period of time. A genetically engineered D. radiodurans has been used for bioremediation to consume and digest solvents and heavy metals, especially in highly radioactive sites. In addition, bacterial genes from Escherichia coli have been introduced into D. radiodurans so it can detoxify ionic mercury and toluene, chemicals often included in the radioactive waste from nuclear weapons manufacture. A few other bacterial genera, including Chroococcidiopsis (phylum Cyanobacteria) and Rubrobacter (phylum Actinobacteria), and the archaeal species Thermococcus gammatolerans, also are gamma-radiation resistant. However, with its added genes for bioremediation, D. radiodurans rightly retains its title of “the world’s toughest bacterium.” 1Huyghe,
62582_CH08_222_259.pdf 250
P. 1998. Conan the bacterium. The Sciences 38:4. 16–19.
2/4/10 2:06 PM
8.4 Mutations
Transposable Genetic Elements Can Cause Mutations KEY CONCEPT
15. Insertion sequences and transposons move from one DNA location to another.
Mutations of a different nature may be caused by fragments of DNA called transposable genetic elements. Two types are known to exist in all microbial cells: insertion sequences and transposons. Insertion sequences (IS) are small segments of DNA with about 1,000 base pairs. IS have no genetic information other than for the ability to insert into a chromosome; that is, they produce copies of themselves and the copies move into other areas of the chromosome. These events are rare, but when they occur they can interrupt the
251
coding sequence in a gene, such that protein synthesis produces a nonfunctional protein, or more likely no protein at all. Thus, IS may be a prime force behind spontaneous mutations. A second type of transposable genetic element is the transposon. These are the so-called “jumping genes” for which Barbara McClintock won the 1983 Nobel Prize in Physiology or Medicine (MICROFOCUS 8.6). Transposons are larger than IS and carry additional genes for various functions, such as antibiotic resistance, which can be conferred to the recipient cell. Like IS, they can interrupt the genetic code of a gene. The movement of transposons appears to be nonreciprocal, meaning an element moves (“jumps”) away from its location and nothing takes
8.6: History
Jumping Genes In the early 1950s, scientists assumed that genes were fixed elements, always found in the same position on the same chromosome. But in 1951, Barbara McClintock unveiled her research with corn plants at a symposium at Cold Spring Harbor Laboratory on Long Island, New York. McClintock described genes that apparently moved from one chromosome to another. The audience listened in respectful silence. There were no questions after her talk, and only three people requested copies of her paper. McClintock grew Indian corn, or maize. In the 1940s, she noticed curious patterns of pigmentation on the kernels. Other scientists might have missed the patterns as random variations of nature, but McClintock’s record keeping and careful analysis revealed a method to nature’s madness. The pigment genes causing the splotches of color appeared to be switched on or off in particular generations. Still more remarkable, the “switches” seemed to occur at different places along the same chromosome. Some switches even showed up in different chromosomes. Such “controlling elements,” as McClintock called them, were available whenever needed to turn the genes on or off. In the modern lexicon of molecular genetics, McClintock’s elements are recognized as a two-gene system. One is an activator gene, the other a dissociation gene. The activator gene, for reasons unknown, can direct a dissociation gene to “jump” along the arm of the ninth chromosome in maize plants where color is regulated. When the jumping gene reinserts itself, it turns off the neighboring pigmentation genes, thereby altering the color of the kernel. The jumping gene is identical to the transposon found in bacteria and certainly serves as a driving force in evolution. For Barbara McClintock, recognition came 30 years after that symposium at Cold Spring Harbor. In 1981 (at the age of 79), she received eight awards, among them a $60,000-a-year lifetime grant from the MacArthur Foundation and the $15,000 Lasker prize. In 1983, she was awarded the Nobel Prize in Physiology or Medicine. When informed of the Nobel award, she humbly replied to an interviewer’s question, “It seemed unfair to reward a person for having so much pleasure over the years, asking the maize plants to solve specific problems and then watching their response.” Dr. McClintock died in 1992.
62582_CH08_222_259.pdf 251
2/4/10 2:06 PM
252
CHAPTER 8
Microbial Genetics
A
Active gene
B
Transposon Chromosome
Plasmid
C C C C C T A A G G G G G A T T
(B)
Gram negative cell
T T A G G G G G A A T C C C C C
Transposon
Transposon in chromosome “jumps” to plasmid
Transfer of plasmid
Transfer of plasmid
Recipient cell (Gram negative)
Recipient cell (Gram positive)
(A) FIGURE 8.22 Transposon “Jumping” and Structure. (A) Transposons can “jump” to another DNA molecule, such as a plasmid, which then can be transferred to another cell conferring new genetic capabilities on the recipient. (B) A transposon contains one or more active genes bordered by inverted repetitive sequences. The base sequence in A is the reverse and complement of the base sequence in B. Inverted repetitive base sequences (C–G and G–C) are at the ends of the transposon. »» What is required for the transposon to “jump” to another DNA molecule?
its place. (This contrasts with insertion sequences, where copies move.) Transposons can move from plasmid to plasmid, from plasmid to chromosome, or from chromosome to plasmid. The presence of inverted repetitive base sequences at the ends of the element appears to be important in establishing the ability to move ( FIGURE 8.22 ). Of particular significance is the finding that many transposons contain genes for antibiotic resistance. For example, if a plasmid containing
8.5
CONCEPT AND REASONING CHECKS
8.15 What role do insertion sequences and transposons play?
Identifying Mutants
Any organism carrying a mutation is called a mutant, while the normal strain isolated from nature is the wild type. Some mutants are easy to identify because the phenotype, or physical appearance, of the organism or the colony has changed from the wild type. For example, some bacterial colonies appear red because they produce a red pigment. Treat the colonies with a mutagen and, after plating on nutrient agar, mutants form colorless colonies. However, not all mutants can be identified solely by their “looks.”
62582_CH08_222_259.pdf 252
a transposon is transferred from one bacterial cell to another, as plasmids are known to do, the transposon will move along with it, thus spreading the genes for antibiotic resistance. Moreover, the movement of transposons among plasmids helps explain how a single plasmid acquires numerous genes for resistance to different antibiotics.
Plating Techniques Select for Specific Mutants or Characteristics KEY CONCEPT
16. Mutant identification can involve negative or positive selection techniques.
Selection is a very useful technique to identify and isolate a single mutant from among thousands of possible cells or colonies. Let’s look at two selection techniques that make this search possible.
2/4/10 2:06 PM
8.5 Identifying Mutants
Mutants (auxotrophs) do not grow
Minimal medium (– his)
Master plate (growth on complete medium)
All colonies grow
Incubate 24–48 hours Complete medium (+ his)
Transfer imprint of colonies
Press plate on velveteen surface
Sterilized velveteen
253
Imprint of colonies
Solid velveteen support
FIGURE 8.23 Negative Selection Identifies Auxotrophs. Negative selection plating techniques can be used to detect nutritional mutants (auxotrophs) that fail to grow when replica plated on minimal medium (in this example, a growth medium lacking histidine). Comparison to replica plating on complete medium visually identifies the auxotrophic mutants. »» In this example, which colonies transferred to the complete medium represent the auxotrophs (his–)?
First, in both techniques, the chemical composition of the transfer plate is key to visual identification of the colonies being hunted. The use of a replica plating device makes the identification possible. The device consists of a sterile velveteen cloth or filter paper mounted on a solid support. When an agar plate (master plate) with bacterial colonies is gently pressed against the surface of the velveteen, some cells from each colony stick to the velveteen. If another agar plate then is pressed against this velveteen cloth, some cells will be transferred (replicated) in the same pattern as on the master plate. Now, suppose you want to find a nutritional mutant unable to grow without the amino acid histidine. This mutant (written his–) has lost the ability that the wild type strain (his+) has to make its own histidine. Such a mutant having a nutritional requirement for growth is called an auxotroph (auxo = “grow”; troph = “nourishment”), while the wild type is a prototroph (proto = “original”). Phenotypically, there is no difference between the two strains when they grow on a complete medium with histidine. However, you can visually identify
62582_CH08_222_259.pdf 253
the auxotroph using a negative selection plating technique ( FIGURE 8.23 ). Any colonies missing on the minimal medium plate (lacking histidine) must be his–. As another example, suppose you want to see if there are any bacteria in a hospital ward that are resistant to the antibiotic tetracycline. Again, phenotypically there is no difference between those strains sensitive to tetracycline and those resistant to the antibiotic. However, a positive selection plating technique permits visual identification of such tetracycline resistant mutants ( FIGURE 8.24 ). CONCEPT AND REASONING CHECKS
8.16 How does negative selection differ from positive selection?
The Ames Test Can Identify Potential Mutagens KEY CONCEPT
17. Ames test revertants suggest a chemical is a potential carcinogen in humans.
Some years ago, scientists observed that about 90% of human carcinogens—agents causing tumors in humans—also induce mutations in bac-
2/4/10 2:06 PM
254
CHAPTER 8
Microbial Genetics
Only tetracycline mutants grow
All colonies grow
Complete medium plus tetracycline
Master plate (growth on complete medium)
Complete medium
Transfer imprint of colonies
Press plate on velveteen surface Sterilized velveteen
Incubate 24–48 hours
Imprint of colonies
Solid velveteen support
FIGURE 8.24 Positive Selection of Mutants. Positive selection plating techniques can be used to identify antibiotic resistant mutants. »» What do the “vacant spots” on the complete medium plus tetracycline represent?
Screening test: A process for detecting mutants by examining numerous colonies.
62582_CH08_222_259.pdf 254
terial cells. Working on this premise, Bruce Ames of the University of California developed a procedure to help identify potential human carcinogens by determining whether the agent can mutate bacterial auxotrophs. The procedure, called the Ames test, is a widely used, relatively inexpensive, rapid, and accurate screening test. For the Ames test, an auxotrophic, histidine-requiring strain (his–) of Salmonella enterica serotype Typhimurium is used. If inoculated onto a plate of nutrient medium lacking histidine, no colonies will appear because in this auxotrophic strain the gene inducing histidine synthesis is mutated and hence not active. In preparation for the Ames test, the potential carcinogen is mixed with a liver enzyme preparation. The reason for doing this is because often chemicals only become tumor causing and mutagenic in humans after they have been modified by liver enzymes. To perform the Ames test, the his– strain is inoculated onto an agar plate lacking histidine
( FIGURE 8.25 ). A well is cut in the middle of the agar, and the potential liver-modified carcinogen is added to the well (or a filter paper disk with the chemical is placed on the agar surface). The chemical diffuses into the agar. The plate is incubated for 24 to 48 hours. If bacterial colonies appear, one may conclude the agent mutated the bacterial his– gene back to the wild type (his+); that is, revertants were generated that could again encode the enzyme needed for histidine synthesis. Because the agent is a mutagen, it is therefore a possible carcinogen in humans. If bacterial colonies fail to appear, one assumes that no mutation took place. However, it is possible the mutation did occur, but was repaired by a DNA repair enzyme. This possibility has been overcome by using bacterial strains known to be inefficient at repairing errors. CONCEPT AND REASONING CHECKS
8.17 Just because a potential carcinogen generates revertants in Salmonella, does that always mean it is cancer causing in humans? Explain.
2/4/10 2:06 PM
Summary of Key Concepts
A
A histidine-requiring strain (his–) of Salmonella is inoculated onto the surface of a plate of medium lacking histidine. Normally, the bacteria will not grow in the medium.
B
A well is cut into the agar and the suspected chemical mutagen is added to the well.
C
The suspected mutagen diffuses out from the well and comes in contact with the bacterial cells in the medium.
255
Well
Diffusing chemical
Incubate
Bacterial colonies
Growth
No growth
D
If the chemical is not a mutagen, the bacterial cells remain unable to synthesize histidine and do not grow. Colonies fail to appear on the medium.
E
If the chemical is a mutagen, some bacterial cells undergo a mutation so they can again synthesize histidine. Visible colonies soon appear on the medium.
FIGURE 8.25 Using the Ames Test. The Ames test is a screening technique to identify mutants that reverted back to the wild type because of the presence of a mutagen. »» As a control, a plate with Salmonella (his–) but without mutagen is incubated. After 24–48 hours, a few colonies are seen on the plate. Explain this observation.
SUMMARY OF KEY CONCEPTS 8.1 DNA and Chromosomes 1. The bacterial and archaeal chromosomes are circular, haploid structures in the cell’s nucleoid. 2. The DNA of a microorganism’s chromosome is supercoiled and folded into a series of looped domains. Each loop consists of 10,000 bases. 3. Many microbial cells may have one or more plasmids. These small closed loops of DNA carry information that can confer selective advantages (e.g., antibiotic resistance, protein toxins) to the cells. 8.2 DNA Replication 4. DNA replicates by a semiconservative mechanism where each strand of the original DNA molecule acts as a template to synthesize a new strand. DNA replication starts with initiator proteins binding at the replication origin, forming two replication “factories.” DNA polymerase III moves along the strands inserting the correct DNA nucleotide to complementary bind with the template strand. 5. At each replication fork, one of the two strands is synthesized in a continuous fashion while the other strand is formed in a discontinuous fashion, forming Okazaki fragments, which are joined by a DNA ligase.
62582_CH08_222_259.pdf 255
8.3 Protein Synthesis 6. Transcription occurs when the RNA polymerase binds to a promoter sequence on the DNA template strand. Various forms of RNA, including mRNA, tRNA, and rRNA, are transcribed from the DNA and are important in the translation process. 7. The genetic code, a series of three-letter words to specify a polypeptide, is redundant because often more than one codon can specify an amino acid. 8. Translation occurs on ribosomes, which bring together mRNA and tRNAs. The ribosome “reads” the mRNA codons and inserts the correct tRNA to match codon and anticodon. Translation continues until the ribosome encounters a stop codon when the protein translation machinery disassembles and the protein is released. Chaperone proteins help the elongating polypeptide to fold properly during translation. A polyribosome is a string of ribosomes all translating the same mRNA. 9. Many antibiotics interfere with protein synthesis by binding to RNA polymerase, or to either the small or large ribosomal subunit. 10. Different control factors influence protein synthesis. The best understood is the bacterial operon model where binding of a repressor protein to the operon represses transcription.
2/4/10 2:06 PM
256
CHAPTER 8
Microbial Genetics
11. Research studies suggest that at least in some bacterial species, transcription and translation are spatially separated. 8.4 Mutations 12. Mutations are permanent changes in the cellular DNA. This can occur spontaneously in nature resulting from a replication error or the effects of natural radiation. In the laboratory, physical and chemical mutagens can induce mutations. 13. Base pairs in the DNA can change in one of two ways. A base-pair substitution does not change the reading frame of an mRNA but can result in a silent, missense, or nonsense mutation. A point mutation also can occur from the loss or gain of a base pair. Such mutations change the reading frame and often lead to loss of protein function. 14. Replication errors or other damage done to the DNA often can be repaired. Mismatch repair replaces an incorrectly matched base pair with the correct pair. Excision repair removes a section of damaged DNA and replaces it with the correctly paired bases.
15. Transposable genetic elements exist in many microbial cells. Insertion sequences only carry information to copy the sequences and insert them into another location in the DNA. Transposons are genetic elements that “jump” from one location to another in the DNA. 8.5 Identifying Mutants 16. Auxotrophic mutants can be identified by negative selection plating techniques. Positive selection can be used to identify mutants having certain attributes, such as antibiotic resistance. 17. The Ames test is a method of using an auxotrophic bacterial species to identify mutagens that may be carcinogens in humans. The test is based on the ability of a potential mutagen to revert an auxotrophic mutant to its prototrophic form.
LEARNING OBJECTIVES After understanding the textbook reading, you should be capable of writing a paragraph that includes the appropriate terms and pertinent information to answer the objective. 1. Describe the contents of the bacterial nucleoid. 2. Summarize the packing of the DNA and chromosome within the nucleoid. 3. Assess the role of plasmids in microbial cells. 4. Identify and explain the events of the three phases of DNA replication. 5. Explain how DNA synthesis occurs at a replication factory. 6. Describe the role of RNA polymerase in the transcription process. 7. Read the genetic code and identify start and stop codons. 8. Identify and describe the events occurring in the three stages of translation. 9. Evaluate the effect of antibiotics on the protein synthesis process.
62582_CH08_222_259.pdf 256
10. Label the sequences composing a bacterial operon and compare the functions of each sequence to the transcription process. 11. Identify the spatial relationships between transcription and translation with the nucleoid and cytoplasm. 12. Compare and contrast spontaneous and induced mutations, and differentiate between physical and chemical mutagens. 13. Distinguish between a base-pair substitution and a deletion (or insertion) mutation. 14. Explain how mismatch repair works, and describe how cells use excision repair to correct UV-induced mutations. 15. Contrast how insertion sequences and transposons can cause mutations. 16. Compare and contrast negative and positive selection plating techniques for identifying mutants. 17. Evaluate the use of the Ames test to identify chemicals that are potential carcinogens in humans.
2/4/10 2:06 PM
Step A: Self-Test
257
STEP A: SELF-TEST Each of the following questions is designed to assess your ability to remember or recall factual or conceptual knowledge related to this chapter. Read each question carefully, then select the one answer that best fits the question or statement. Answers to even-numbered questions can be found in Appendix C. 1. Which one of the following statements is NOT true of the bacterial chromosome? A. It is located in the nucleoid. B. It usually is a single, circular molecule. C. Some genes are dominant to others. D. It usually is haploid. 2. DNA compaction involves A. a twisting and packing of the DNA. B. supercoiling. C. the formation of looped domains. D. All the above (A–C) are correct. 3. Plasmids are A. another name for transposons. B. accessory genetic information. C. domains within a chromosome. D. daughter chromosomes. 4. The enzyme _____ adds complementary bases to the DNA template strand during replication. A. ligase B. helicase C. DNA polymerase III D. RNA polymerase 5. At a chromosome replication fork, the lagging strand consists of _____ that are joined by _____. A. RNA sequences; DNA ligase B. Okazaki fragments; RNA polymerase C. RNA sequences; ribosomes D. Okazaki fragments; DNA ligase 6. In a eukaryotic microbe, those sections of a primary RNA transcript that will NOT be translated are called A. introns. B. anticodons. C. “jumping genes.” D. exons. 7. Which one of the following codons would terminate translation? A. AUG B. UUU C. UAA D. UGG 8. The translation of a mRNA by multiple ribosomes is called _____ formation. A. Okazaki B. polysome C. plasmid D. transposon
62582_CH08_222_259.pdf 257
9. If an antibiotic binds to a 5OS subunit, what cellular process will be inhibited? A. DNA replication B. Intron excision C. Translation D. Transcription 10. Which one of the following is NOT part of an operon? A. Regulatory gene B. Operator C. Promoter D. Structural genes 11. Being compartmentalized, bacterial RNA polymerases are localized in the _____ and ribosomes are found _____. A. nucleoid; at the nucleoid periphery B. cytosol; in the cytosol C. cytosol; at the cell poles D. nucleoid; in the nucleoid 12. Spontaneous mutations could arise from A. DNA replication errors. B. atmospheric radiation. C. addition of insertion sequences. D. All the above (A–C) are correct. 13. Which one of the following could NOT cause a change in the mRNA “reading frame”? A. Insertion sequence B. Base-pair substitution C. Base addition D. Base deletion 14. Excision repair would correct DNA damage caused by A. antibiotics. B. UV light. C. a chemical mutagen. D. a DNA replication error. 15. Transposable genetic elements (transposons) A. were first discovered by Watson and Crick. B. are smaller than insertion sequences. C. are examples of plasmids. D. may have information for antibiotic resistance. 16. Nutritional mutants are referred to as A. prototrophs. B. wild type. C. revertants. D. auxotrophs. 17. The Ames test is used to A. identify potential human carcinogens. B. discover auxotrophic mutants. C. find pathogenic bacterial species. D. identify antibiotic resistant mutants.
2/4/10 2:06 PM
258
CHAPTER 8
Microbial Genetics
STEP B: REVIEW 18. Construct a concept map for translation using the following terms. amino acid ribosome chain elongation sense codons chain initiation small subunit chain termination start codon large subunit stop codon mRNA termination factors polypeptide tRNAs Answer the following questions that pertain to (1) transcription and translation, and (2) mutations. Use the genetic code (Table 8.3) on page 236 as needed. Answers to even-numbered questions can be found in Appendix C. 19. The following base sequence is a complete polynucleotide made in a bacterial cell. AUGGCGAUAGUUAAACCCGGAGGGUGA With this sequence, answer the following questions. A. Provide the sequence of nucleotide bases found in the inactive DNA strand of the gene. B. How many codons will be transcribed in the mRNA made from the template DNA strand?
C. How many amino acids are coded by the mRNA made and what are the specific amino acids? D. Why isn’t the number of codons in the template DNA the same as the number of amino acids in the polypeptide? 20. Use the base sequence to answer the following questions about mutations. TACACGATGGTTTTGAAGTTACGTATT A. Is the sequence above a single strand of DNA or RNA? Why? B. Using the sequence above, show the translation result if a mutation results in a C replacing the T at base 12 from the left end of the sequence. Is this an example of a silent, missense, or nonsense mutation? C. Using the sequence above, show the translation result if a mutation results in an A inserted between the T (base 12) and the T (base 13) from the left end of the sequence. Is this an example of a silent, missense, or nonsense mutation?
STEP C: APPLICATIONS Answers to even-numbered questions can be found in Appendix C. 21. You are interested in identifying mutants of E. coli; specifically mutations occurring in the promoter and operator regions of the lac operon such that their respective molecules cannot bind to the region. You have agar plates containing lactose or glucose as the energy source. How can plating the potential mutants on these media help you identify (a) promoter region mutants and (b) operator region mutants? 22. A chemical is tested with the Ames test to see if the chemical is mutagenic and therefore possibly a tumor-causing chemical in humans. On the test plate containing the chemical, no his+ colonies are seen near the central well. However, many colonies are growing some distance from the well. If these colonies truly represent his+ colonies, why are there no colonies closer to the central well? 23. Bioremediation is a process that uses bacteria to degrade environmental pollutants. You want to use one of these organisms
62582_CH08_222_259.pdf 258
to clean up a toxic waste site (biochemical refinery) that contains benzene in the soil around the refinery. Benzene (molecular formula = C6H6) is a major contaminant found around many of these chemical refineries. You have a culture of bacterial cells growing on a culture plate that were derived from a soil sample from the refinery area. You also have a supply of benzene. Explain how you could visually identify chemoheterotrophic bacterial colonies on agar that use benzene as their sole carbon and energy source for metabolism. 24. Suppose you now have such benzene colonies growing on agar. However, it also has been discovered that material containing radioactive phosphorus (32P) is in the soil around the refinery and this radioactive material can kill bacterial organisms. Because you want to identify colonies that might be sensitive to 32P, you obtain a sample of the material containing 32P. Explain how you could visually determine if any of your colonies are sensitive to 32P.
2/4/10 2:06 PM
Step D: Questions for Thought and Discussion
259
STEP D: QUESTIONS FOR THOUGHT AND DISCUSSION Answers to even-numbered questions can be found in Appendix C. 25. The author of a general biology textbook writes in reference to the development of antibiotic resistance, “The speed at which bacteria reproduce ensures that sooner or later a mutant bacterium will appear that is able to resist the poison.” How might this mutant bacterial cell appear? Do you agree with the statement? Does this bode ill for the future use of antibiotics?
26. Many viruses have double-stranded DNA as their genetic information while many others have single-stranded RNA as the genetic material. Which group of viruses do you believe is more likely to efficiently repair its genetic material? Explain. 27. Some scientists suggest that mutation is the single most important event in evolution. Do you agree? Why or why not?
HTTP://MICROBIOLOGY.JBPUB.COM/9E The site features eLearning, an online review area that provides quizzes and other tools to help you study for your class. You can also follow useful links for in-depth information, read more MicroFocus stories, or just find out the latest microbiology news.
62582_CH08_222_259.pdf 259
2/4/10 2:06 PM
9 Chapter Preview and Key Concepts
9.1 Genetic Recombination in Bacteria 1. Gene transfer can occur between generations and between individual organisms. 2. Transformation involves the transfer of exposed DNA fragments from donor to recipient. 3. Conjugation uses plasmids for DNA transfer from donor to recipient. 4. To transfer chromosomal DNA, conjugation requires chromosomally integrated plasmids. 5. Bacterial viruses can transfer chromosomal DNA from donor to recipient.
9.2 Genetic Engineering and Biotechnology 6. Plasmids can be spliced open and a gene of interest inserted to form a recombinant DNA molecule. 7. Bacterial cells can be transformed by the acquisition of a human gene. MICROINQUIRY 9: Molecular Cloning of a Human Gene into Bacterial Cells 8. DNA probes are single-stranded DNA segments.
9.3 Microbial Genomics 9. Known genome sequences are rapidly expanding for many microorganisms. 10. Some human genes and human DNA sequences may have microbial origins. 11. Understanding gene organization and function provides for new microbial applications. 12. Comparative genomics compares the DNA sequences of related or unrelated species. 13. Techniques are now being developed to analyze and understand all the genomes within a microbial community.
Gene Transfer, Genetic Engineering, and Genomics Genetic engineering is the most powerful and awesome skill acquired by man since the splitting of the atom. —The editors of Time magazine describing the potential for genetic engineering Medicinal microbe’s genome sequenced. How often have we read in the newspaper or heard from the news media about an organism’s genes (genome) being sequenced or its DNA being mapped? It must be significant, right? After all, it made the news! But what is the underlying significance of such sequencing? Here is a good example. In late spring of 2003, a group of British scientists announced they had mapped the genome of a very important bacterial species, Streptomyces coelicolor. This is a gram-positive organism commonly found in the soil. The mapping project began in 1997 and took six years to complete partly because the organism’s genome is one of the largest ever sequenced. It has 8.6 million base pairs and some 7,825 genes. On completion of the sequencing, one of the scientists on the project said, “It is a fabulous resource for scientists.” Why? Well, here is where microbial genomics shows its power. S. coelicolor belongs to a phylum of Bacteria, the Actinobacteria, which are responsible for producing over 65% of the naturally-known antibiotics used today (see Chapter 4). This includes tetracycline and erythromycin. By analyzing the genome of S. coelicolor and other Streptomyces species, additional metabolic pathways may be discovered for the production of other, yet unidentified and perhaps novel antibiotics. In fact, the researchers have identified 18 gene clusters they suspect are involved with the production of antibiotics. If correct,
260
62582_CH09_260_297.pdf 260
2/4/10 12:12 PM
CHAPTER 9 Gene Transfer, Genetic Engineering, and Genomics
knowing the genome and its organization might allow scientists to transform the organism into an “antibiotic factory” and add to the dwindling armada of usable antibiotics to which pathogens are not yet resistant ( FIGURE 9.1 ). Using genetic engineering techniques, they could rearrange gene clusters and perhaps produce even more useful and potent antibiotics than naturally possible. One example illustrating the need for newer antibiotics concerns “staph infections,” most commonly caused by methicillin-resistant Staphylococcus aureus (MRSA). These pathogens are resistant to methicillin and other common antibiotics, such as oxacillin, penicillin, and amoxicillin. MRSA infections occur most frequently among persons in hospitals and healthcare facilities who have weakened immune systems ( TABLE 9.1 ). According to MRSAInfection.org, “A patient with a hospital acquired [MRSA] infection is about 7 times more likely to die [in the hospital] than an uninfected patient.” So, new and unique anti-
261
biotics might be able to inhibit or kill the drug resistant S. aureus. But there is more. S. coelicolor is a close relative of the tuberculosis, leprosy, and diphtheria bacilli. By comparing genomes, scientists hope to learn why S. coelicolor are not pathogenic, while the other three are pathogens. What is different about their genomes might be important in understanding the pathogenicity of their relatives and perhaps even designing new antibiotics through genetic engineering to attack these pathogens. Genetic engineering involves the manipulating of genes in organisms or between organisms in order to introduce new characteristics into the recipient to either produce a useful product or to actually generate genetically modified organisms (GMOs). Genomics is the study of an organism’s genome; its study has the potential of offering new therapeutic methods for the treatment of several human diseases. So, this chapter addresses more than simply research techniques; rather, we discuss how their applications can have far-reaching consequences for all of us. Before we can explore these topics, we need to understand the process of genetic recombination, a natural mechanism for DNA transfer from one microorganism to another. Its understanding provides a unique perspective on microbial evolution, ecology, and molecular biology while providing insights for the techniques of genetic engineering and the field of microbial genomics.
TABLE
9.1
FIGURE 9.1 Streptomyces coelicolor Colonies. In this photograph of S. coelicolor, colonies growing on agar are secreting droplets of liquid containing antibiotics. »» What is the advantage to the bacterial cells to secrete a chemical with antibiotic properties?
62582_CH09_260_297.pdf 261
Hospital-Acquired Infection Statistics, Pennsylvania—2004*
Number of hospital-acquired infections Number of deaths associated with hospital-acquired infections Extra number of hospital days associated with these infections Additional hospital charges
11,668 1,510 205,000
$2 billion
*Data are from: MRSAInfection.org
2/4/10 12:12 PM
262
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
Genetic Recombination in Bacteria
9.1
Traditionally, when one thinks about the inheritance of genetic information, one envisions genes passed from parent to offspring. However, imagine being able to transfer genes between members of your own family, or between you and one of your classmates. Although many bacterial and archaeal species are accomplished at doing both types of information transfer, we will focus on bacterial species in this section. Genetic Information Can Be Transferred Vertically and Horizontally KEY CONCEPT
1.
Gene transfer can occur between generations and between individual organisms.
In Chapter 8, we discussed mutations, which were one of the ways by which the genetic material in a cell can be permanently altered. Because the permanent change occurred in the parent cell, all
future generations derived by binary fission from the parent also will have the mutation. This form of genetic transfer is referred to as vertical gene transfer ( FIGURE 9.2A ). The Bacteria lack sexual reproduction as a mechanism for genetic diversity. However, they still possess a process by which genetic recombination and diversity can arise. This is through the process of horizontal gene transfer (HGT), a type of genetic recombination that involves the lateral intercellular transfer of DNA from a donor cell to a recipient cell ( FIGURE 9.2B ). If, for example, the recipient cell receives from the donor a chromosomal DNA fragment, a plasmid, a transposon (see Chapter 8), or some combination of these elements containing a gene for antibiotic resistance, the new DNA pairs with a complementary region of recipient DNA and replaces it. In this case, there is no change in quantity of the recipient’s chromosomal DNA,
(a) Vertical gene transfer Generation 1
A
Binary fission Generation 2
A
A
Binary fission
Generation 3 A
Binary fission
A
A
A
(b) Horizontal gene transfer
Donor cell
A A A
Generation 1
Recipient cell A Recipient cell
Gene Transfer Mechanisms. Genes can be transferred between cells in two ways. (A) In vertical transfer, a cell undergoes binary fission and the daughter cells of the next generation contain the identical genes found in the parent. (B) In horizontal transfer, genes are transferred by various mechanisms to other individual cells. »» Determine which transfer mechanism (vertical or horizontal) provides the potential for the most genetic diversity. FIGURE 9.2
62582_CH09_260_297.pdf 262
2/4/10 12:12 PM
9.1 Genetic Recombination in Bacteria
263
9.1: Environmental Microbiology
Gene Swapping in the World’s Oceans Many of us are familiar with the accounts of microorganisms in and around us, but we are less familiar with the massive numbers of microbes in the world’s oceans. For example, microbial ecologists estimate there are an estimated 1029 Bacteria and Archaea in the world’s oceans. At the Axial Seamount, a Pacific deep-sea volcano, researchers have discovered some 3,000 archaeal species and more than 37,000 different bacterial species. Also, there are some 1030 viruses called bacteriophages (“bacteria eaters”) in the oceans that infect these oceanic microbes. In the infection process, sometimes bacteriophages by mistake carry pieces of the bacterial chromosome (rather than viral DNA) from the infected cell to another recipient cell. In the recipient cell, the new DNA fragment can be swapped for an existing part of the recipient’s chromosome. It is a fairly rare event, occurring only once in every 100 million (108) virus infections. That doesn’t seem very significant until you now consider the number of bacteriophages and susceptible bacteria existing in the oceans. Working with these numbers and the potential number of virus infections, scientists suggest that if only one in every 100 million infections brings a fragment of DNA to a recipient cell, there are about 10 million billion (that’s 10,000,000,000,000,000 or 1016) such gene transfers per second in the world’s oceans. That is about 1021 infections per day! We do not understand what all this recombination means. What we can conclude is there’s an awful lot of gene swapping going on!
but there is a substantial change in its quality and cell physiology—an antibiotic sensitive cell has become resistant. In fact, the increasing global resistance to antibiotics by human pathogens, such as Streptococcus pneumoniae, Staphylococcus aureus, and Pseudomonas aeruginosa, is one example of the prevalence of HGT. MICROFOCUS 9.1 provides another spectacular example for a very extensive rate for genetic recombination through HGT in the world’s oceans. Three distinctive mechanisms mediate the horizontal transfer of DNA between bacterial cells: transformation, conjugation, and transduction. All three processes involve a similar four steps. The donor DNA must be: 1. Readied for transfer. 2. Transferred to the recipient cell. 3. Taken up successfully by the recipient cell. 4. Incorporated in a stable state in the recipient. Let’s now look at each of the three recombination mechanisms involving HGT. CONCEPT AND REASONING CHECKS
9.1 How does HGT differ from vertical gene transfer?
62582_CH09_260_297.pdf 263
Transformation Is the Uptake and Expression of DNA in a Recipient Cell KEY CONCEPT
2.
Transformation involves the transfer of exposed DNA fragments from donor to recipient.
Transformation is the uptake of a free DNA fragment from the surrounding environment and the expression of the genetic information in the recipient cell; that is, by integration of the DNA fragment, the recipient (transformant) has gained some ability it previously lacked. Today, transformation represents a gene transfer process building genetic diversity. This form of HGT was first described in 1928, when the English bacteriologist Frederick Griffith published the results of an interesting set of experiments with S. pneumoniae. This bacterial species, referred to as a pneumococcus (pl., pneumococci), is a major cause of pneumonia (Chapter 10). Pneumococci occur in two different strains: a wildtype encapsulated strain, designated S, because the organisms grow in smooth colonies and cause pneumonia; and an unencapsulated mutant strain,
2/5/10 1:04 PM
264
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
Pathogenic S strain (control)
Harmless R strain (control)
Colonies of pathogenic cells isolated from dead mouse A
When Griffith injected S strain (encapsulated, pathogenic) cells into the mouse, it developed pneumonia and died.
Colonies of harmless cells from healthy mouse
B
An injection of R strain C (unencapsulated,harmless) cells did no harm to the mouse.
Heat-killed S strain (control)
Mixed R strain and heat-killed S strain
No colonies isolated from healthy mouse
Furthermore, an injection of heat-killed S strain cells did no harm because the cells were dead.
Colonies of harmless and pathogenic cells isolated from dead mouse D
But when Griffith injected a mixture of live R strain and heat-killed S strain cells into the mouse, it died. When Griffith cultivated the organism from the blood, he found live S strain cells.
FIGURE 9.3 The Transformation Experiments of Griffith. Griffith’s experiments were the first to demonstrate transformation and the horizontal transfer of genetic information. »» What is unique about the S strain pneumococci that is responsible, in part, for making them pathogenic?
designated R, because the colonies appear rough and are harmless. Griffith showed that mice injected with living S strain die, while those mice injected with living R strain or heat-killed S strain survive ( FIGURE 9.3 ). What happened next surprised Griffith. He mixed heat-killed, S strain cells with live R strain cells (both of which were non-lethal) and let the mixture incubate; then he injected the mixture into mice. The mice died! Griffith wondered how a mixture of live, harmless R strain cells and debris from the dead pathogenic S strain cells could kill the mice. His answer came when he autopsied the animals: Microscopic examination of their blood showed the presence of live S strain pneumococci. Knowing that spontaneous generation does not occur, Griffith reasoned
62582_CH09_260_297.pdf 264
that somehow the live R strain cells had been transformed into live S strain cells. In 1944 Oswald T. Avery and his associates Colin M. MacLeod and Maclyn N. McCarty of the Rockefeller Institute, purified and identified the transforming substance; it was DNA. Modern scientists regard transformation as an important genetic recombination method even though it takes place in less than 1% of a cell population. Transformation occurs regularly when bacterial cells exist in crowded conditions, such as in rich soil or the human intestinal tract. Under natural conditions, about 40 known bacterial species are highly transformable when their DNA is very similar to the DNA being received. The ability of a cell to be transformed depends on its competence, which refers to the ability of
2/5/10 1:04 PM
9.1 Genetic Recombination in Bacteria
a recipient cell to take up extracellular DNA from the environment. Competence is an intriguing but variable property among bacterial species. For example, growing cells of S. pneumoniae secrete a competence factor to induce the competence state, while Haemophilus influenzae cells become competent when the culture is switched from a rich to a minimal growth medium. In both cases, several genes encode proteins for binding and uptake of DNA fragments. The transformation process occurs as follows. In natural environments, when bacterial cells die and lyse, the chromosome typically breaks apart into fragments of DNA composed of about 10 genes to 20 genes ( FIGURE 9.4 ). Uptake of DNA fragments (or a plasmid) by recipient cells appears to occur only at the cell poles, as this is where the competence factors are found and actual DNA uptake has been observed. A competent cell usually incorporates only one or at most a few DNA fragments. Internalization of DNA is an ATP-dependent process and requires DNA-binding proteins, cell wall degradation proteins, and cell membrane transport proteins. Gram-positive bacterial species, such as S. pneumoniae and Bacillus subtilis, degrade one strand of the DNA fragment as it is being taken into the cell. Such single-stranded DNA, if stably associated with a similar region of the recipient’s chromosome, will replace a similar chromosome sequence. In gram-negative H. influenzae, a double-stranded DNA fragment is transported into the periplasmic space, but then one strand is digested by a nuclease before transport into the bacterial cytoplasm. One potential result of transformation is to increase an organism’s ability to cause disease. In Griffith’s pneumococci experiments, for example, the live R strain cells acquired the genes for capsule formation from the dead S strains, which allowed the organism to avoid body defenses and thus cause disease (see Chapter 4). Microbiologists also have demonstrated that when mildly pathogenic bacterial strains take up DNA from other mildly pathogenic strains, there is a cumulative effect, and the recipient becomes more dangerous. Observations such as these may help explain why highly pathogenic bacterial strains appear from time to time. Transformed bacterial cells also may display enhanced drug resistance from the
62582_CH09_260_297.pdf 265
265
Dead donor cell
A
Donor DNA fragment
A donor bacterium disintegrates and liberates its DNA fragments (or plasmid) into the surrounding environment. B DNA fragment binds to recipient cell at pole.
Bacterial chromosome in recipient cell
Competence-specific single-standed DNA binding proteins
DNA binding protein DNA fragment
Recombination protein
C Nuclease digestion of one DNA strand permits the other strand to enter the recipient cell.
Nuclease Free nucleotides
D The single DNA strand recombines with hom*ologous regions of the bacterial chromosome.
E The recipient cell is transformed.
Transformant
FIGURE 9.4 Transformation in a Gram-Positive Cell. Transformation is the process in which DNA fragments from the environment bind to a competent recipient cell, pass into the recipient, and incorporate into the recipient’s chromosome. »» Using this diagram, illustrate how Griffith’s experiment with mixed heat-killed S strain and live R stain pneumococci produced live S strain encapsulated cells.
2/5/10 1:04 PM
266
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
9.2: Environmental Microbiology
It’s Snowing DNA! Throughout this text, we have observed on several occasions the massive populations of microbes that live and thrive in the world’s oceans. These marine environments are home to a huge variety of Bacteria and Archaea. So what happens to all the genetic material in these organisms when they die? Where does the DNA go? A decade’s worth of data suggest that as cyanobacteria and other eukaryotic phytoplankton die in the surface layers of the oceans, they sink through the water column at rates up to 100 meters per day. This free-falling cellular and particulate debris is called marine snow (see figure). Often it is so thick that it looks like an ocean blizzard! In 2005, Roberto Danovaro and his colleague Antonio Dell’Anno of the Marine Science Institute of Marine snow represents microbial cellular debris. the University of Ancona in Italy published a paper suggesting about 65% of the DNA in the world’s oceans is found in the sea-bed sediments; 90% of that DNA is extracellular, originating from organisms in the marine snow. Danovaro suggests this DNA is a primary source for carbon, nitrogen, and phosphorus for sea-bed organisms and is essential for sustaining the microbial communities on and in the sediments. But what about horizontal gene transfer? Could this DNA represent a source of genetic diversity through transformation for the bacterial and archaeal populations on the ocean bottom? Danovaro hypothesizes that most of the snowy DNA is of eukaryotic origin. Still, with all the marine cyanobacteria, why couldn’t they be making a substantial contribution? And if so, is transformation a significant phenomenon on the sea beds?
acquisition of R plasmids (see Chapter 8). Thus, transformation can contribute to the dispersal of antibiotic-resistance genes. Extracellular DNA can be quite prevalent. MICROFOCUS 9.2 identifies a massive source of such “dead” DNA. CONCEPT AND REASONING CHECKS
9.2 Why is competence key to the transformation process?
Conjugation Involves Cell-to-Cell Contact for Horizontal Gene Transfer KEY CONCEPT
3.
Conjugation uses plasmids for DNA transfer from donor to recipient.
In the recombination process called conjugation, two live bacterial cells come together and the donor cell directly transfers DNA to the recipient cell. This process was first observed in 1946 by
62582_CH09_260_297.pdf 266
Joshua Lederberg and Edward Tatum in a series of experiments with Escherichia coli. Lederberg and Tatum mixed two different strains of E. coli and found genetic traits could be transferred if contact occurred. The process of conjugation requires a special conjugation apparatus called the conjugation pilus that was first described in Chapter 4 ( FIGURE 9.5 ). For cell-to-cell contact, the donor cell, designated F+, produces the conjugation pilus that contacts the recipient cell, known as an F– cell. The donor cell is called F+ because it contains an F factor, which is a plasmid containing about 100 genes, most of which are associated with plasmid DNA replication and production of the conjugation pilus. The F– cell lacks the plasmid, and the pilus shortens to bring the two cells close together. Following pair formation ( FIGURE 9.6A ), the F factor DNA replicates by a rolling-circle mech-
2/5/10 1:04 PM
9.1 Genetic Recombination in Bacteria
anism; one strand of plasmid DNA remains in a closed loop, while an enzyme nicks the other strand at a point called the origin of transfer (oriT). This single-stranded DNA then “rolls off ” the loop and passes through the translocation channel to the recipient cell; the transfer takes about five minutes. As the horizontal transfer occurs, DNA synthesis in the donor cell produces a new complementary strand to replace the transferred strand. Once DNA transfer is complete, the two cells separate. In the recipient cell, the new single-stranded DNA serves as a template for synthesis of a complementary polynucleotide strand, which then circularizes to reform an F factor. This completes the conversion of the recipient from F– to F+ and this cell now represents a donor cell (F+) capable of conjugating with another F– recipient. Transfer of the F factor does not involve the chromosome; therefore, the recipient does not acquire new genes other than those on the F factor. The high efficiency of DNA transfer by conjugation shows that conjugative plasmids can spread rapidly, converting a whole population into plasmid-containing cells. Indeed, conjugation appears to be the major mechanism for antibiotic resistance transfer. In laboratory experiments, for example, bacterial strains carrying plasmid antibiotic-resistance genes were introduced into mice. HGT through conjugation of these R factors rapidly occurred. In nature, conjugation readily occurs in soil and in water. CONCEPT AND REASONING CHECKS
9.3 What genes must be transferred to an F– cell to convert it to F+?
Conjugation Also Can Transfer Chromosomal DNA KEY CONCEPT
4.
To transfer chromosomal DNA, conjugation requires chromosomally integrated plasmids.
Bacterial species also can undergo a type of conjugation that accounts for the horizontal transfer of chromosomal material from donor to recipient cell. Cells exhibiting the ability to donate chromosomal genes are called high frequency of recombination (Hfr) strains. In Hfr strains, the F factor has attached to the chromosome ( FIGURE 9.6B ). This attachment
62582_CH09_260_297.pdf 267
267
FIGURE 9.5 Bacterial Conjugation in E. coli. The direct transfer of DNA between live donor (F+; left cell) and recipient (F–) cells requires a conjugation bridge. In this false-color transmission electron micrograph, the F+ cell has produced a conjugation pilus that has contacted the F– cell. Contraction of the pilus will bring donor and recipient close together. (Bar = 0.5 µm.) »» What are the other structures projecting from the F + cell?
is a rare event requiring an insertion sequence to recognize the F factor. Once incorporated into the chromosomal DNA, the F factor no longer controls its own replication. However, the Hfr cell triggers conjugation just like an F+ cell. When a recipient cell is present, a conjugation pilus forms and attaches to the F– cell. The two cells are brought together. One strand of the donor chromosome is nicked at oriT and a portion of the single-stranded chromosomal/plasmid DNA then passes into the recipient cell. The oriT site in the chromosome is in the middle of the F plasmid genes. Therefore, in the recipient cell, the first genes to enter are only a part of the F factor and these genes are not the ones to make the cell an F+ donor. Rather, the last genes transferred to the recipient cell would control the donor state. However, these rarely enter the recipient because conjugation usually is interrupted by movements that break the bridge between cells before complete transfer is accomplished. An estimated 100 minutes is required for the transfer of a complete E. coli chromosome with plasmid genes—something rarely occurring in nature. Thus, the F– cell usually remains a recipient, although it now has some recombined chromosomal genes, and is referred to as a recombinant F– cell.
2/5/10 1:04 PM
268
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
(A) (A)
Donor F+ cell
Conjugation pilus
Recipient F- cell
A Donor F+ cell produces a conjugation pilus that connects the F+ to the Fcell.
Bacterial F factor chromosome
Conjugation bridge
B The conjugation pilus contracts, bringing donor and recipient cells close together; conjugation bridge forms.
C F factor replication starts at oriT and a single-stranded DNA copy is transferred to the recipient cell.
oriT
D Once transferred, the complementary strand in the recipient cell results in both donor and recipient cells being F+. F+ cell
F+ cell (B) (B)
Recipient F- cell
Donor Hfr cell
Bacterial chromosome with F factor integrated (green) A
The Hfr donor cell has the F factor (green) integrated into its chromosome. After a conjugation pilus (not shown) brings donor and recipient cells together, a conjugation bridge forms.
B
Replication of one strand of the donor’s DNA begins at the oriT site and passes into the recipient cell.
oriT
oriT
Donor Hfr cell
Recombined F- cell
C Usually only a portion of the donor DNA enters the recipient cell before the conjugation bridge breaks. The new DNA strand replaces a complementary portion of the recipient's DNA. The recombination is now complete, and the new genes can be expressed by the Frecipient.
FIGURE 9.6 Conjugation. (A) Conjugation between an F+ cell and an F– cell. When the F factor is transferred from a donor (F+) cell to a recipient (F–) cell, the F– cell becomes an F+ cell as a result of the presence of an F factor. (B) Conjugation between an Hfr and an F– cell allows for the transfer of some chromosomal DNA from donor to recipient cell. »» Propose a hypothesis to explain why only a single-stranded DNA molecule is transferred across the conjugation pilus.
62582_CH09_260_297.pdf 268
2/5/10 1:04 PM
9.1 Genetic Recombination in Bacteria
Should the entire chromosome be transferred to the recipient, the F factor usually detaches from the chromosome, and enzymes synthesize a strand of complementary DNA. The F factor now forms a loop to assume an existence as a plasmid, and the recipient becomes a donor (F+) cell. Occasionally, in an Hfr cell, the integrated F plasmid breaks free from the chromosome and, in the process, takes along a fragment of chromosomal DNA. The plasmid with its extra DNA is now called an Fⴕ plasmid (pronounced “F-prime”). When the F⬘ plasmid is transferred during a subsequent conjugation, the recipient acquires those chromosomal genes excised from the donor. This process results in a recipient having its own genes for a particular process as well as additional genes from the plasmid DNA for the same process. In the genetic sense, the recipient is a partially diploid organism because there are two genes for a given function. Conjugation has been demonstrated to occur between cells of various bacterial genera. For example, conjugation occurs between such gram-negative genera as Escherichia and Shigella, Salmonella and Serratia, and Escherichia and Salmonella. HGT has great significance because of the possible transfer of antibiotic-resistance genes carried on plasmids. Moreover, when the genes are attached to transposons, the transposons may “jump” from ordinary plasmids to F factors, after which transfer by conjugation may occur (see Chapter 8). TEXTBOOK CASE 9 describes one case with serious medical overtones. Although conjugation pili are found only on some gram-negative bacteria, gram-positive bacteria also appear capable of conjugation. Microbiologists have experimented extensively with Streptococcus mutans, a common cause of dental caries. In this organism, conjugation appears to involve only plasmids, particularly those carrying genes for antibiotic resistance. Moreover, the conjugation does not involve pili. Rather, the recipient cell apparently secretes substances encouraging the donor cell to produce clumping factors composed of protein. The factors bring together (clump) the donor and recipient cell, and pores form between the cells to permit plasmid transfer. Chromosomal transfer has not been demonstrated.
62582_CH09_260_297.pdf 269
269
CONCEPT AND REASONING CHECKS
9.4 Unlike conjugation between an F+ and F–, where the recipient cell becomes F+, why doesn’t an Hfr and F– conjugation result in the recipient cell being an Hfr?
Transduction Involves Viruses as Agents for Horizontal Transfer of DNA KEY CONCEPT
5.
Bacterial viruses can transfer chromosomal DNA from donor to recipient.
Another form of genetic recombination was reported in 1952 by Joshua Lederberg and Norton Zinder. While working with mutant cells of Salmonella, Lederberg and Zinder observed recombination, but ruled out conjugation and transformation because the cells were separated by a thin membrane and DNA was absent in the extracellular fluid. Eventually, they discovered a virus in the fluid and uncovered the details of recombination. Transduction is the third form of HGT and it requires a virus to carry a chromosomal DNA fragment from donor to recipient cell. The virus participating in transduction is called a bacteriophage (literally “bacteria eater”) or simply phage. As with all viruses, the bacteriophages have a core of DNA or RNA surrounded by a coat of protein (Chapter 14). In the replication cycle of a bacteriophage, different phages can interact with bacterial cells in one of two ways ( FIGURE 9.7 ). In a lytic cycle, the phage DNA penetrates the cell, destroys the host chromosome, replicates itself within the cell, and then destroys (lyses) the cell as new phages are released. Because the phages killed the cell, they are called virulent phages. Other phages interact with bacterial cells in a slightly different way, called a lysogenic cycle. These phages also invade the host but do not always directly cause cell lysis. Instead, the phage DNA integrates into the host chromosome as a prophage and the phages participating in this cycle are known as temperate phages. The host cell survives and, as it undergoes DNA replication and binary fission, the prophage is copied and vertically transferred to daughter cells. However,
2/5/10 1:04 PM
270
Textbook
CASE
9
Vancomycin-Resistant Staphylococcus aureus 1
In June 2002, a 40-year-old Michigan resident with diabetes, peripheral vascular disease, and chronic renal failure developed a suspected catheter exit-site infection. A swab from the catheter exit-site was used to isolate vancomycin-resistant Staphylococcus aureus (VRSA).
2
In April 2001, the patient had been treated for chronic foot ulcerations with multiple courses of antimicrobial therapy, some of which included the antibiotic vancomycin. In April 2002, the patient underwent amputation of a gangrenous toe and subsequently developed a methicillin-resistant S. An arteriovenous graft for hemodialysis. aureus (MRSA) blood infection that resulted when hemodialysis was performed. In the form of hemodialysis used, an artificial vessel was used to join the artery and vein (called an arteriovenous graft; see figure), which often are subject to infection. The infection was treated with vancomycin, rifampin, and removal of the infected graft.
3
With the identification of VRSA from the swab, cultures from the exit site and catheter tip were made and subsequently grew S. aureus resistant to oxacillin and vancomycin.
4
A week after the patient’s catheter was removed, the exit site appeared healed; however, the patient’s chronic foot ulcer appeared infected. VRSA, vancomycin-resistant Enterococcus faecalis (VRE), and Klebsiella oxytoca also were recovered from a culture of the ulcer. Swab cultures of the patient’s healed catheter exit site and anterior nares did not grow VRSA. The ulcer was cleaned of dead and contaminated tissue. The patient was urged to maintain aggressive wound care and, as an outpatient, put on systemic antimicrobial therapy with the sulfa drug trimethoprim/sulfamethoxazole (Bactrim).
5
The VRSA isolate recovered from the catheter exit site was identified initially at a local hospital laboratory and was confirmed by the Michigan Department of Community Health and the Centers for Disease Control and Prevention (CDC).
6
Further molecular analysis indicated the VRSA isolate contained the vanA vancomycin resistance gene typically found in enterococci.
7
Epidemiologic and laboratory investigations were undertaken to assess the risk for transmission of VRSA to other patients, health-care workers, and close family and other contacts. No VRSA transmission was identified.
8
Infection-control practices in the local dialysis center were assessed; all health-care workers followed standard precautions consistent with CDC guidelines.
Questions: (Answers can be found in Appendix D.) A.
This report describes the first documented case of infection caused by vancomycin-resistant S. aureus (VRSA) in a patient in the United States. Why was this patient so susceptible to infection with S. aureus?
B.
Because vancomycin resistance determinants had not previously been identified in clinical isolates of S. aureus in the United States, how did the vanA gene get “transferred” into S. aureus in this patient?
C.
Why was a culture swab from the patient’s anterior nares tested for VRSA?
D.
Why was the patient put on a sulfa drug?
E.
Besides standard precautions, what other procedures should be in place to prevent transmission of antimicrobial resistant microorganisms in health-care settings?
For additional information see http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5126a1.htm
62582_CH09_260_297.pdf 270
2/5/10 1:04 PM
9.1 Genetic Recombination in Bacteria
A Phage attaches to host cell and injects DNA. Phage DNA (double stranded)
G Occasionally, the prophage may excise from the chromosome by another recombination event, initiating a lytic cycle.
Chromosome
271
Many binary fissions may occur.
D Cell lysis releases phages.
Lysogenic cycle (temperate phage)
Lytic cycle (virulent phage)
Prophage
B Phage DNA circularizes and enters lytic or lysogenic cycle. C Phage DNA and proteins are synthesized and assembled into new phages.
F Cell reproduces normally, copying the prophage. E Phage DNA integrates within the chromosome by recombination, becoming a prophage.
FIGURE 9.7 Bacteriophage Replicative Cycles. The consequences of infection by a virulent phage and a temperate phage are shown. »» How do the two replicative cycles differ between virulent and temperate phages?
eventually the prophage will excise itself and go through a lytic cycle (Chapter 14). Let’s examine how these two types of phage can transfer fragments of donor cell DNA to a recipient cell. Generalized transduction is carried out by virulent phages, such as the P1 phage that infects E. coli ( FIGURE 9.8 ). After injecting the DNA into the cell, the host cell’s chromosome is digested into small fragments. When the new phage DNA is produced, the DNA normally is packaged into new phage particles. However, on rare occasions (1 in 100,000,000) a random (general) fragment of host cell DNA may accidentally be captured in the packaging process and end up in a phage head rather than phage DNA. These phages are fully formed though and they can infect another cell. However, they are called “defective particles” because they carry no phage genes and cannot replicate themselves after infection. This is the type of genetic recombination described in MicroFocus 9.1. Following release from the lysed host cell, the defective phage attaches to a new (recipient) cell
62582_CH09_260_297.pdf 271
and injects the donor chromosomal DNA into the host cell. Once in the recipient, new genes can pair with a section of the recipient’s DNA and replace the section in a fashion similar to conjugation. The recipient has now been transduced (changed) using genes from the donor cell. Specialized transduction occurs as a result of a lysogenic cycle and unlike generalized transduction, results in the transfer of specific genes. One of the most studied temperate viruses is phage lambda, which also infects E. coli. Being a temperate phage, the lambda phage DNA is integrated as a prophage into the chromosomal DNA (Figure 9.8). At some time in the future, the prophage undergoes excision from the chromosome and enters the lytic cycle. Most of the time, the excision occurs precisely and the intact phage DNA is released. On rare occasions, an imprecise excision occurs, and the excised prophage takes along a few flanking E. coli genes while leaving behind a few phage genes. At the conclusion of phage replication, multiple copies of the phage, each with a donor gene, are produced. Again, these
2/5/10 1:04 PM
272
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
Phage DNA
Virulent phage A
B
A
B
Donor cell D
A
A bacteriophage attaches to the surface of a host cell.
Chromosome
B
The phage DNA enters the cytoplasm of the cell.
Virulent phage (generalized transduction) C
Temperate phage (specialized transduction) B
A
The viral DNA replicates and the host chromosome is fragmented into small pieces.
Defective particle
Virulent phage D
B D
During assembly, a DNA fragment accidentally gets packaged into a phage head producing a defective (transducing) particle. Here the defective particle carries gene B.
B
D
A
C
At some later point, the prophage is excised from the chromosome and phage DNA replication occurs as in a lytic cycle. If the excision is not precise, the phage will carry along some donor DNA. Here the phage has extracted gene D from the donor DNA.
E
D
E
All the new phage and defective particles are released from the lysed cell.
D D D
Recipient cell
Recipient cell
D
F F
All the new defective phage particles are released from the lysed cell.
Defective phage
B
B
The viral DNA integrates into the chromosome.
d
Transduction occurs if a defective particle interacts with a recipient cell.
Transduction occurs if a defective phage interacts with a recipient cell.
D
G The DNA fragment enters the cell. But note that the DNA is donor cell DNA (carrying gene B).
H
b d
B
H
B
The DNA fragment integrates into the recipient’s chromosome.
D
Transduced cell
G The DNA (carrying gene D) enters the cell cytoplasm.
Transduced cell
The viral DNA integrates with the recipient’s chromosome. The recipient cell thus acquires a gene from the donor cell and is transduced.
FIGURE 9.8 Generalized and Specialized Transduction. Phage can transfer bacterial genes by generalized transduction (can involve any bacterial gene) or specialized transduction (can involve genes from a specialized region). »» How does the outcome of transduction differ between generalized and specialized?
62582_CH09_260_297.pdf 272
2/5/10 1:04 PM
9.1 Genetic Recombination in Bacteria
are defective phages because they are missing a few phage genes needed for replication. Such a transducing phage can infect another cell and transfer its genes, which cannot encode a replicative cycle. Instead, the genes integrate into the recipient chromosome, carrying the donor’s genes with them. As before, the recipient cell acquired genes from the original donor cell and the recipient is now considered transduced. Specialized transduction is an extremely rare event in comparison to the generalized form. However, there are exceptions. For example,
273
the diphtheria bacillus, Corynebacterium diphtheriae, harbors proviral DNA providing the genetic code for a toxin causing diphtheria. Other toxins encoded by proviral DNA include staphylococcal enterotoxins in food poisoning, clostridial toxins in some forms of botulism, and streptococcal toxins in scarlet fever. FIGURE 9.9 compares the three forms of genetic recombination through horizontal gene transfer. CONCEPT AND REASONING CHECKS
9.5 What is the major difference between transformation and generalized transduction?
Horizontal Gene Transfer Methods involves a
Host cell which can transfer genes through
Transformation
Conjugation
Transduction
via the
in the form
when a dead cell releases
DNA fragments or plasmids
F factor which is transferred through a
one of which may be taken up into a competent
Generalized transduction
Bacterial chromosome part of which is transferred through a
Specialized transduction
which involves a Defective virulent virus
Defective temperate virus
Conjugation bridge that carries
to a Living recipient cell
Host DNA fragment to a Host DNA gene
FIGURE 9.9 A Summary of Genetic Recombination through Horizontal Gene Transfer. This concept map summarizes the three mechanisms of transfer of genes from donor to recipient cells. »» In which of the HGT mechanisms is the donor cell dead?
62582_CH09_260_297.pdf 273
2/5/10 1:04 PM
274
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
9.2
Genetic Engineering and Biotechnology
Prior to the 1970s, bacterial species having special or unique metabolic properties were detected through mutant analysis or by screening for cells with certain metabolic talents (MICROFOCUS 9.3). Experiments in genetic recombination entered a new era in the late 1970s, when it became possible to insert genes into bacterial DNA and thereby establish a genetically identical population that would produce proteins from the inserted genes.
The use of microbial genetics, including the isolation, manipulation, and control of gene expression had far-reaching ramifications, leading to the entirely new field of genetic engineering. Many of the products derived from genetic engineering have advanced the field of medicine and industrial production. Biotechnology is the name given to the commercial and industrial applications derived from genetic engineering.
9.3: History/Biotechnology
Clostridium acetobutylicum and the Jewish State In 1999, scientists completed sequencing the genome of Clostridium acetobutylicum, a nonpathogenic bacterial species. Because some other species of Clostridium are major pathogens (one produces the food toxin that causes botulism, and another is responsible for tetanus), the scientists hope their sequencing work will yield insights into what enables some species to become pathogens while others remain harmless. However, C. acetobutylicum’s ability to convert starch into the organic solvents acetone and butanol is what has a prominent place in history. In 1900, an outstanding chemist named Chaim Weizmann, a Russian-born Jew, completed his doctorate at the University of Geneva in Switzerland. He also was an active Zionist and advocated the creation of a Jewish homeland in Palestine. In 1904, Weizmann moved to Manchester, England, where he became a research fellow and senior lecturer at Manchester University. During this time, he was elected to the General Zionist Council. Weizmann began working in the laboratory of Professor William Perkin, where he attempted to use microbial fermentation to produce industrially useful substances. He discovered that C. acetobutylicum converted starch to a mixture of ethanol, acetone, and butanol, the latter an important ingredient in rubber manufacture. The fermentation process seemed to have no other commercial value—until World War I broke out in 1914. At that time, the favored propellant for rifle bullets and artillery projectiles was a material called cordite. To produce it, a mixture of cellulose nitrate and nitroglycerine was combined into a paste using acetone and petroleum jelly. Before 1914, acetone was obtained through the destructive distillation of wood. However, the supply was inadequate for wartime needs, and by 1915, there was a serious shell shortage, mainly due to the lack of acetone for making cordite. After his inquiries to serve the British government were not returned, a friend of Weizmann’s went to Lloyd George, who headed the Ministry of Munitions. Lloyd George was told about Weizmann’s work and how he could synthesize acetone in a new way. The conversation resulted in a London meeting between Weizmann, Lloyd George, and Winston Churchill. After explaining the capabilities of C. acetobutylicum, Weizmann became director of the British admiralty laboratories where he instituted the full-scale production of acetone from corn. Additional distilleries soon were added in Canada and India. The shell shortage ended. After the war ended, now British Prime Minister Lloyd George wished to honor Weizmann for his contributions to the war effort. Weizmann declined any honors but asked for support of a Jewish homeland in Palestine. Discussions with Foreign Minister Earl Balfour led to the Balfour Declaration of 1917, which committed Britain to help establish the Jewish homeland. Weizmann went on to make significant contributions to science—he suggested that other organisms be examined for their ability to produce industrial products and is considered the father of industrial fermentation. Weizmann also laid the foundations for what would become the Weizmann Institute of Science, one of Israel’s leading scientific research centers. His political career also moved upward—he was elected the first President of Israel in 1949. Chaim Weizman died in 1952.
62582_CH09_260_297.pdf 274
2/5/10 1:04 PM
9.2 Genetic Engineering and Biotechnology
Genetic Engineering Was Born from Genetic Recombination KEY CONCEPT
6.
Plasmids can be spliced open and a gene of interest inserted to form a recombinant DNA molecule.
The science of genetic engineering involves an alteration to the genetic material in an organism to change its traits or to allow the organism to produce a biological product, usually a protein, that the organism was previously incapable of producing. The field surfaced in the early 1970s when the techniques became available to manipulate DNA. Among the first scientists to attempt genetic manipulation was Paul Berg of Stanford University. In 1971, Berg and his coworkers opened the circular DNA molecule from simian virus-40 (SV40) and spliced it into a bacterial chromosome. In doing so, they constructed the first recombinant DNA molecule—a DNA molecule containing DNA segments spliced together from two or more organisms. This human-manipulated genetic recombination process was extremely tedious though because the cut bacterial and viral DNAs had blunt ends, making sealing of the two DNAs difficult. Berg therefore had to use exhaustive enzyme chemistry to form staggered ends that would combine easily through complementary base pairing. While Berg was performing his experiments, an important development came from Herbert Boyer and his group at the University of California.
Boyer isolated a restriction endonuclease enzyme that recognizes and cuts specific short stretches of nucleotides. Importantly, the enzyme leaves the DNA with mortise-like staggered ends. These dangling bits of single-stranded DNA extending out from the double-stranded DNA easily attached to complementary ends protruding from another fragment of DNA. Scientists quickly dubbed the single-stranded extensions “sticky ends.” Today, there is a vast array of restriction enzymes from the Bacteria and Archaea, each recognizing a specific nucleotide sequence ( TABLE 9.2 ). Enzyme designations are derived from the species from which they were isolated. For example, the restriction enzyme EcoRI stands for Escherichia coli Restriction enzyme I. Each enzyme cuts both strands of the DNA because the sequences recognized are a palindrome. Each strand has the same complementary set of nucleotide bases. Thus, restriction enzymes are “molecular scissors” used by genetic engineers to open a bacterial chromosome or plasmid at specific locations and insert a DNA segment from another organism. To seal the recombinant DNA segments, DNA ligase was used. This enzyme normally functions during the DNA replication and repair to seal together DNA fragments (see Chapter 8). Meanwhile, Stanley Cohen, also at Stanford University, was accumulating data on the plasmids of E. coli. Cohen found he could isolate plasmids from bacterial cells and insert
275
Palindrome: A series of letters reading the same left to right and right to left.
TABLE
9.2
Examples of Restriction Endonuclease Recognition Sequences
Organism
Restriction Enzyme
Recognition Sequence*
Escherichia coli
EcoRI
Streptomyces albus
SalI
Haemophilus influenzae
HindIII
Bacillus amyloliquefaciens
BamHI
Providencia stuartii
PstI
G ↓ AATTC CTTAA ↑ G G ↓ TCGAC CAGCT ↑ G A ↓ AGCTT TTCGA ↑ A G ↓ GATCmC CCmTAG ↑ G CTGCA ↓ G G ↑ ACGTC
*Arrows indicate where the restriction enzyme cuts the two strands of the recognition sequence; Cm = methylcytosine.
62582_CH09_260_297.pdf 275
2/5/10 1:04 PM
276
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
them into fresh bacterial cells by suspending the organisms in calcium chloride and rapidly heating them. This made the E. coli cells competent to take up the plasmid via the transformation process. Once inside the cells, the plasmids multiply independently and produce clones; that is, copies of themselves. Working together, Boyer and Cohen isolated plasmids from E. coli and opened them with restriction enzymes ( FIGURE 9.10 ). Next, they inserted a
A
The restriction enzyme EcoRI is used to open the plasmid at the sites indicated by the arrows. The plasmid then exists as a linear strand of DNA.
B Plasmid
segment of foreign DNA into the plasmids and sealed the segment using DNA ligase. Mimicking natural genetic recombination, they then inserted the plasmids (recombinant DNA molecules) into fresh E. coli cells. By 1973, their technique had successfully spliced genes across genera, from S. aureus into E. coli. These genetic engineering experiments intrigued the scientific community because for the first time they could manipulate genes from a wide variety of species and splice them together.
The same restriction enzyme is used to open the foreign DNA.
Foreign DNA A T A T G T T A A C C G
A A T T G T AA C C T G
EcoRI “Sticky end” G C T T A A
A A T T C G
EcoRI
“Sticky ends” G C T T A A
A A T T C G
“Sticky end”
C
A A T T C G
The two strands are brought together, and the exposed “sticky ends” join with each other. The nitrogenous bases form weak hydrogen bonds with their complementary bases. G A A T T C C T T A AG
G C T T A A
DNA ligase D
To permanently secure the "backbone" of the molecule, DNA ligase is used. This enzyme joins the deoxyribose molecules to the phosphate groups.
A A T T C G T A A G C T
Recombinant DNA molecule
A A
G
T
C
As the other “sticky ends” join, mediated by DNA ligase, a single large plasmid forms. This type of union is the basis for synthetic genetic recombinations.
G A C T A T T
E
FIGURE 9.10 Construction of a Recombinant DNA Molecule. In this construction, two unrelated plasmids (loops of DNA) are united to form a single plasmid representing a recombinant DNA molecule. »» Why is the product of genetic engineering called a recombinant DNA molecule?
62582_CH09_260_297.pdf 276
2/5/10 1:04 PM
9.2 Genetic Engineering and Biotechnology
9.6 List the steps required to form a recombinant DNA molecule.
Genetic Engineering Has Many Commercial and Practical Applications KEY CONCEPT
7.
Bacterial cells can be transformed by the acquisition of a human gene.
Today, over 18 million people in the United States have diabetes, a group of diseases resulting from abnormally high blood glucose levels. One cause is from the inability of the body to produce sufficient levels of insulin (referred to as juvenile or insulin-dependent diabetes or type I diabetes) to control the blood glucose level. This means that diabetics must receive daily injections of insulin to survive. Before 1982, diabetics received purified insulin extracted from the pancreas of cattle and pigs, or even cadavers. This can pose a problem because animal insulin could trigger allergic reactions and possibly contain unknown viruses that had infected the animal. The solution was to produce insulin using genetic engineering techniques. Eli Lilly marketed the first such synthetic human insulin, called Humulin, in 1982. Since then, other genetically engineered insulin products have been developed. Such commercial successes of biotechnology were a sign of things to come. The best way to understand how genetic engineering operates is to follow an actual procedure for the production of human insulin. MICROINQUIRY 9 describes one such method—by cloning the human gene for insulin into bacterial cells. This involves: 1. Isolating the piece of DNA containing the human insulin gene and precisely cutting the gene out; 2. Splicing the insulin gene into a bacterial plasmid; 3. Placing the recombinant plasmid in bacterial cells to form clones; 4. Screening for recombinant plasmids; 5. Identifying and isolating clones carrying the insulin gene. Besides insulin, a number of other proteins of important pharmaceutical value to humans have been produced by genetically engineered micro-
62582_CH09_260_297.pdf 277
organisms. Many of these proteins are produced in relatively low amounts in the body, making purification extremely costly. Therefore, the only economical solution to obtain significant amounts of the product is through genetic engineering. The dairy industry was the first to feel the dramatic effect of the new DNA technology. In 1982, the U.S. Food and Drug Administration (FDA) licensed recombinant bovine somatotropin (rBST), a protein that can boost milk production in dairy cattle by 40%. Another early application of genetic engineering to human disorders and diseases was the production of yet another growth hormone, human growth hormone (HGH). Genetically engineered HGH replaced the form that had been extracted from the pituitary of human cadavers. With its license by the FDA in 1985, HGH has been used to treat conditions that produce short stature, to improve muscle strength associated with some genetic disorders, and to maintain muscle mass in patients suffering from AIDS. Of course, it can be and has been used as an athletic enhancement to build muscle mass for bodybuilding. In 2010, hundreds of biotechnology companies worldwide are working on the commercial and practical applications of genetic engineering ( FIGURE 9.11 ). Many of the genetically
Number of FDA Approvals
CONCEPT AND REASONING CHECKS
277
23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 0
= Recombinant protein biopharmaceuticals = Vaccines, blood products, and other biopharmaceuticals
82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 2000 01 02 03 04 05 06 07 08
Year FIGURE 9.11 FDA Approvals of New Pharmaceutical Products. This graph shows the number of approvals of new biopharmaceutical products since 1982, when the first recombinant product was approved. Data redrawn from: Biotechnology Information Institute (http://www.biopharma.com/approvals_2008.html). »» Can you come up with a reason for the drop in recombinant protein biopharmaceuticals in 2007?
2/5/10 1:04 PM
278
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
INQUIRY 9
Molecular Cloning of a Human Gene into Bacterial Cells
62582_CH09_260_297.pdf 278
Because the SalI cut site is within lacZ, any recombinant plasmids will have a defective lacZ gene and the bacterial cells carrying those plasmids will not be able to produce B-gal. Plasmids without the insulin gene have an intact lacZ gene and will have B-gal activity. Thus, using the positive selection technique described in Chapter 8 and a selective medium as described in Chapter 5, we can identify which bacterial cells contain the recombinant plasmids.
Therefore, we plate all our bacterial cells onto an agar plate containing ampicillin and a substrate called X-gal that B-gal can hydrolyze. B-gal X ⫹ galactose X-gal • The X product is blue in color, so any colonies having an intact lacZ gene will hydrolyze X-gal and appear blue on the agar plate; • If the lacZ gene is inactive due to the presence of the insulin gene, then no product will be formed and those colonies on the plate will appear white. Question 9a. Identify what colonies on the plate contain the insulin gene. Question 9b. Explain why the bacteria without a plasmid did not grow on the plate. The answers can be found in Appendix D. 5. These colonies with the insulin gene can now be isolated and grown in larger batches of liquid medium. These batch cultures then are inoculated into large “production vats,” called bioreactors, in which the cells grow to massive numbers while secreting large quantities of insulin into the liquid.
l
Z ac
1. Plasmids often carry genes, such as antibiotic resistance. We are going to use the cloning vector shown in Figure A because it contains a gene for resistance to ampicillin (ampR) and the lacZ gene that encodes the enzyme β-galactosidase (B-gal) that splits lactose into glucose and galactose. This will be important for identification of clones that have been transformed. In addition, this vector has a single restriction sequence for the
restriction enzyme SalI (see Table 9.2). Importantly, this cut site is within the lacZ gene. Also, the plasmid will replicate independently in E. coli cells and can be placed in the cells by transformation. 2. The vector and human DNA are cut with SalI to produce complementary sticky ends on both the opened vector and the insulin gene (Figure B). Vector and the insulin gene then are mixed together in a solution with DNA ligase, which will covalently link the sticky ends. Some vectors will be recombinant plasmids; that is, plasmids containing the insulin gene. Other plasmids will close back up without incorporating the gene. 3. The plasmids are placed in E. coli cells by transformation. The plasmids replicate independently in the bacterial cells, but as the bacterial cells multiply, so do the plasmids. By allowing the plasmids to replicate, we have cloned the plasmids, including any that contain the insulin gene. 4. Because we do not know which plasmids contain the insulin gene, we need to screen the clones to identify what colonies contain the recombinant plasmids. This is why we selected a plasmid with ampR and lacZ.
R Amp
Genetic engineering has been used to produce pharmaceuticals of human benefit. One example concerns the need for insulin injections in people suffering from diabetes (an inability to produce the protein insulin to regulate blood glucose level). Prior to the 1980s, the only source for insulin was through a complicated and expensive extraction procedure from cattle or pig pancreases. But, what if you could isolate the human insulin gene and, through transformation, place it in bacterial cells? These cells would act as factories churning out large amounts of the pure protein that diabetics could inject. To do molecular cloning of a gene, besides the bacterial cells, we need three ingredients: a cloning vector, the human gene of interest, and restriction enzymes. Plasmids are the cloning vector, a genetic element used to introduce the gene of interest into the bacterial cells. Human DNA containing the insulin gene must be obtained. We will not go into detail as to how the insulin gene can be “found” from among 25,000 human genes. Suffice it to say that there are standard procedures to isolate known genes. Restriction enzymes will cut open the plasmids and cut the gene fragments that contain the insulin gene, generating complementary sticky ends. The following description represents one procedure to genetically engineer the human insulin gene into cells of Escherichia coli.
pUC19
Or
FIGURE A
SalI
i
The Cloning Vector, pUC19.
2/5/10 1:04 PM
9.2 Genetic Engineering and Biotechnology
279
Human DNA genome amp
lacZ
R
A
Restriction site
Obtain plasmid and insulin gene. B
Plasmid (cloning vector)
Insert insulin gene into plasmid.
Insulin gene
Sticky ends
Cut DNA with restriction enzyme
Mix gene with cut plasmids; add DNA ligase Recombinant plasmid
Some plasmids fail to incorporate gene
C
E. coli cell
Plasmids put into bacterial cells by transformation.
Some bacteria fail to take up plasmids
Bacterial chromosome D
Screen for recombinant plasmids. Clone (bacterial colony)
Growth medium + ampicillin = X-Gal
E
Identify and isolate clones carrying insulin gene.
Clones not carrying insulin gene
Clones carrying insulin gene
FIGURE B
62582_CH09_260_297.pdf 279
The Sequence of Steps to Engineer the Insulin Gene into Escherichia coli Cells.
2/5/10 1:04 PM
280
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
engineered products are either proteins expressed by the recombinant DNA in the bacterial cells or the recombinant DNA from the cloned plasmid ( FIGURE 9.12 ). As described, in the pharmaceutiA
A DNA-containing plasmid is isolated from a donor bacterial organism such as E. coli and opened with a restriction enzyme.
cal industry, the protein products are numerous and diverse. Let’s look at a few examples as more discussion is provided in Chapter 27. B
The DNA is obtained from a cell containing the gene of interest.
C
The gene of interest is isolated from the cellular DNA and inserted into the plasmid. The covalent bonds are formed by the DNA ligase.
D
The recombinant plasmid is inserted into fresh bacterial cells.
E
As the bacterial cells multiply, the plasmids also multiply.
Bacterial cell
Bacterial chromosome
Plasmid
Recombinant DNA (plasmid)
E. coli cell
F
In some cases, the bacterial cells are used as a source of genes. The genes then can be inserted into plants.
Genes for: Herbicide resistance Insect resistance Crop spoilage protection Genetically modified crops Animal vaccine production
G
In other cases, the protein encoded by the genes is the important product.
Protein products: Blood clotting factors (Factors VIII, IX) Anti-blood clotting factors (tissue plasminogen activator; TPA) Insulin Growth hormone (somatotropin and rBST) Antiviral proteins (alpha-interferon) Animal vaccines
FIGURE 9.12 Developing New Products Using Genetic Engineering. Genetic engineering is a method for inserting foreign genes into bacterial cells and obtaining chemically useful products. »» How do bacterial cells that have been genetically modified (F) differ from bacterial cells that encode genes for a product (G)?
62582_CH09_260_297.pdf 280
2/5/10 1:04 PM
9.2 Genetic Engineering and Biotechnology
Environmental Biology. We already have mentioned in this chapter and previous ones (see MicroFocus 8.4) the usefulness of microorganisms as a source of genes. The Bacteria and the Archaea represent a huge, mostly untapped gene pool representing metabolically diverse processes. Examples such as bioremediation have been discussed where genetically engineered or genetically recombined cells are provided with specific genes whose products will break down toxic pollutants, clean up waste materials, or degrade oil spills in an attempt to return the environment to its original condition. We have barely scratched the surface to take advantage of the metabolic diversity offered by these microbes. Medicine. The presence or threat of infectious disease represents a high demand for antibiotics in the medical field. Although antibiotics are produced in nature, the bacterial or fungal organisms often do not produce these compounds in high yield. This means new antibiotic sources must be discovered (see chapter opener) and the microbes must be genetically engineered to produce larger quantities of antibiotics and/or to produce modified antibiotics to which infectious microbes have yet to show resistance. Another product of genetic engineering is interferon, a set of three naturally produced antiviral agents produced by the human body, two of which block viral replication (Chapter 20). As with insulin and HGH, the body produces small amounts of these chemicals, so prior to the introduction of genetic engineering thousands of units of human blood were needed to obtain sufficient interferon to treat a patient. With genetic engineering, much larger amounts of pure protein can be produced to aid patients suffering from hepatitis B and C as well as some forms of cancer. Vaccine production is now safer as a result of genetic engineering. By making a vaccine that only contains a part of the whole microbial agent, or isolating a gene that will stimulate the immune system to generate protective immunity, makes the vaccine much safer because the patient is not exposed to the active virus or bacterium that can cause the disease. For example, hepatitis B, a serious viral infection spread by contact with infected blood, kills 2 million people globally per year (Chapter 16). The first vaccine against hepatitis B
62582_CH09_260_297.pdf 281
was made by extracting the virus from infected blood of chronic carriers and then isolating a viral surface protein. Such a procedure was complex and posed the risk of possible contamination by other infectious agents. In 1986, the FDA approved the first recombinant hepatitis B vaccine (Recombivax HB®) that was made by inserting the gene for the viral surface protein into common baker’s yeast, Saccharomyces cerevisiae. The protein produced by the yeast was identical to the natural viral protein and made for a much safer vaccine for humans. A second recombinant-type hepatitis B vaccine (Engerix-B®) was licensed in 1989. A more recent recombinant vaccine, Gardasil®, which generates protective immunity against many of the papilloma viruses responsible for cervical cancer and genital warts in women, was licensed by the FDA in 2006. In 2009, the vaccine was licensed for use in men to prevent penile cancer and genital warts. Lastly, it should be mentioned that genetically engineered products are not always a “no brainer” in terms of their development. This is no clearer than in the attempts to develop a vaccine for AIDS. Since 1987, scientists and genetic engineers have tried to identify viral subunits that can be used to develop an AIDS vaccine. However, it is not so much that genetic engineering can’t be done as it is the virus just seems to find ways to circumvent a vaccine and the immunity developing in the patient. Still, scientists hope a safe and effective genetically engineered vaccine can be developed. We will have much more to say about vaccines and AIDS in Chapters 22 and 23. Agricultural Applications. Genetic engineering has extended into many realms of science. In agriculture, for example, genes for herbicide resistance have been transplanted from cloned bacterial cells into tobacco plants, demonstrating that these transgenic plants better tolerate the herbicides used for weed control. For tomato growers, a notable advance was made when researchers at Washington University spliced genes from a pathogenic virus into tomato plant cells and demonstrated the cells would produce viral proteins at their surface. The viral proteins blocked viral infection, providing resistance for the transgenic tomato plants. Resistance to insect attack also has been introduced into plants using a plasmid carrying a bacterial gene that is toxic to beetle and fly larvae (Chapter 27).
281
Transgenic: Referring to an organism containing a stable gene from another organism.
2/5/10 1:04 PM
282
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
Agrobacterium tumefaciens
A
The Ti (tumor inducing) plasmid is isolated from cells of A. tumefaciens. The plasmid contains T-DNA, the gene used to insert the plasmid into the plant cell. Restriction cleavage sites
Ti plasmid T-DNA Gene of interest Restriction cleavage site
B
A restriction enzyme is used to open the Ti plasmid at a designated cleavage site. Then, a gene of interest is obtained by opening a DNA fragment at the same cleavage site. The gene is inserted into the Ti plasmid using DNA ligase to seal the chemical bonds.
DNA of plant chromosome
Inserted DNA carrying gene of interest Recombined Ti plasmid C
The recombined Ti plasmid is introduced into plant cells in culture. The plasmid inserts into the plant's DNA and carries along the gene of interest. The result is a transgenic plant.
FIGURE 9.13 The Ti Plasmid as a Vector in Plant Genetic Engineering. Agrobacterium tumefaciens induces tumors in plants and causes a disease called crown gall. The catalyst for infection is a tumor-inducing (Ti) plasmid. This plasmid, without the tumor-causing gene, is used to carry a gene of interest into plant cells. »» Why must the tumor-inducing gene in the Ti plasmid be removed before the plasmid is used in genetic engineering procedures?
As much as 60% of the food we eat today has some connection to genetic engineering. By taking traits from one organism and introducing those traits into another organism, the food can be changed such that it tastes better, grows faster and larger, or has a longer shelf life. For gene transfer experiments in plants, the vector DNA often used is a plasmid from the bacterium Agrobacterium tumefaciens. This organism causes a plant tumor called crown gall, which develops when DNA from the bacterial cells inserts itself into the plant cell’s chromosomes ( FIGURE 9.13 ). Researchers remove the tumor-inducing (Ti) gene from the plasmid and then splice the desired gene into the plasmid and allow the bacterial cells to infect the plant. The Ti system works well with dicots (broadleaf plants) such as tomato, potato, soybeans, and cotton. CONCEPT AND REASONING CHECKS
9.7 Give several examples of how genetic engineering has benefited the fields of environmental microbiology, medicine, and agriculture.
62582_CH09_260_297.pdf 282
DNA Probes Can Identify a Cloned Gene or DNA Segment KEY CONCEPT
8.
DNA probes are single-stranded DNA segments.
The genes of an organism contain the essential information responsible for its behavior and characteristics. Bacterial and viral pathogens, for example, contain specific sequences of nucleotides that can confer on the pathogen the ability to infect and cause disease. Because these nucleotide sequences are distinctive and often unique, if detectable, they can be used as a definitive diagnostic determinant. In the medical laboratory, diagnosticians are optimistic about the use of DNA probes, singlestranded DNA molecules that recognize and bind to a distinctive and unique nucleotide sequence of a pathogen. To use a DNA probe effectively, it is valuable to increase the amount of DNA to be searched. This can be done through the polymerase chain reaction (PCR); the technique is outlined in MICROFOCUS 9.4. The DNA probe binds (hybridizes) to its complementary nucleotide sequence from the pathogen, much like strips of Velcro stick together. To make a probe, scientists first identify the segment (or gene) in the pathogen that will be the target of a probe. Using this segment, they construct the single-stranded DNA probe ( FIGURE 9.14 ). More than 100 DNA probes have been developed for the detection of pathogens. One example of where DNA probes and PCR have been useful is in the detection of the human immunodeficiency virus (HIV). T lymphocytes, in which HIV replicates, are obtained from the patient and disrupted to obtain the cellular DNA. The DNA then is amplified by PCR and the DNA probe is added. The probe is a segment of DNA that complements the DNA in the virus synthesized from the genome of HIV (Chapter 23). If the person is infected with HIV, the probe will locate the viral DNA, bind to it, and emit radioactivity. An accumulation of radioactivity constitutes a positive test. A DNA probe also is available for detecting human papilloma virus (HPV). The test uses a DNA probe to detect viral DNA in a sample of tissue obtained from a woman’s cervix. Because certain forms of HPV have been linked to cervical tumors, the test has won acceptance as an important preventive technique, and it has been licensed
2/5/10 1:04 PM
9.2 Genetic Engineering and Biotechnology
283
DNA
Pathogen Target nucleotide sequence Plasmid A
Isolate target DNA and insert into plasmid.
Recombinant DNA Target nucleotide sequence
B
C
Clone plasmids in E. coli; isolate plasmids and then isolate target DNAs.
Produce single-stranded (ss) DNA probes and label with a radioactive, fluorescent, or colored chemical tag.
Cloned target DNA
ssDNA probe
DNA probe hybridized to target DNA
ssDNA D
Isolate DNA from patient tissues; fragment into ssDNA; attach to solid support.
Support E
Mix probe with DNA samples.
FIGURE 9.14 DNA Probes. Construction of a DNA probe and its use in disease detection and diagnosis. »» Why must the DNA probes be single stranded?
by the FDA. It is commercially available as the ViraPap test. Clearly, the use of DNA probes represents a reliable and rapid method for detecting and diagnosing many human infectious diseases (MICROFOCUS 9.5). A similar technique can be used to conduct water-quality tests based on the detection of coliform bacteria such as E. coli (Chapter 26). Traditionally, E. coli had to be cultivated in the laboratory and identified biochemically. With DNA probe technology, a sample of water can be filtered, and the bacterial cells trapped on the filter can be broken open to release their DNA for PCR and DNA probe analysis. Not only is the process
62582_CH09_260_297.pdf 283
time saving (many days by the older method, but only a few hours with the newer method), it is also extremely sensitive: a single E. coli cells can be detected in a 100-mL sample of water. Another useful tool in biotechnology is the DNA microarray, a small slide surface on which genes or DNA segments are attached and arranged spatially in a known pattern that can be used to assess gene expression in microorganisms. The technique is described in MICROFOCUS 9.6. CONCEPT AND REASONING CHECKS
9.8 Why are DNA probes such useful tools in the detection of disease-causing agents?
2/5/10 1:04 PM
284
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
9.4: Tools
The Polymerase Chain Reaction The polymerase chain reaction (PCR) is a technique that takes a segment of DNA and replicates it millions of times in just a few hours. The technique was developed in 1984 by Kary Mullis working for the Cetus Corporation, a biotechnology company in Emeryville, California; in 1993, he shared the Nobel Prize in Chemistry for his discovery. The PCR process is a repeating three-step process (see figure). Target DNA is mixed with DNA polymerase (the enzyme that synthesizes DNA), short strands of primer DNA, and a mixture of short chain nucleotides called oligonucleotides. The mixture is then alternately heated and cooled during which time the double-stranded DNA unravels, is duplicated, and then reforms the double helix. The process is repeated over and over again in a highly automated PCR machine, which is the biochemist’s equivalent of an office copier. Each cycle takes about five minutes, and each new DNA segment serves as a template for producing many additional identical copies, which in turn serve as templates for producing more identical copies. PCR is now a common and often essential tool in medical and biological research. Applications for PCR are numerous and include its use for DNA cloning, organismal DNA phylogeny studies, and (as described in the text) diagnosis of infectious diseases.
9.3
Microbial Genomics
In April 2003, exactly 50 years to the month after Watson and Crick announced the structure of DNA (see Chapter 2), a publicly financed, $3 billion international consortium of biologists, industrial scientists, computer experts, engineers, and ethicists completed perhaps the most ambitious project in the history of biology. The Human Genome Project, as it was called, had succeeded in mapping the human genome—that is, the 3 billion nitrogenous bases (equivalent to 750 megabytes of data) in a human cell were identified and strung together in the correct order (sequenced). The completion of the project represents a scientific milestone with unimaginable health benefits. Many Microbial Genomes Have Been Sequenced KEY CONCEPT
9.
Known genome sequences are rapidly expanding for many microorganisms.
If the human genome was represented by a rope two inches in diameter, it would be 32,000 miles long. The genome of a bacterial species like E. coli
62582_CH09_260_297.pdf 284
at this scale would be only 1,600 miles long or about 1/20 the length of human DNA. So, being substantially smaller, microbial genomes are easier and much faster to sequence. In May 1995, the first complete genome of a free-living organism was sequenced: the 1.8 million base pairs (1.8 Mb) in the genome of the bacterial species Haemophilus influenzae (MICROFOCUS 9.7). In a few short months, the genome for a second organism, Mycoplasma genitalium was reported. This reproductive tract pathogen has one of the smallest known bacterial genomes, consisting of only 580,000 base pairs and 480 protein-coding genes. In 1996, the genome for the yeast Saccharomyces cerevisiae was sequenced. In a field already filled with milestones, the sequencing of S. cerevisiae marked the first glimpse into the eukaryotic genome. Sixteen chromosomes were analyzed, 12 million bases were sequenced, and 6,000 genes were identified. The sequencing revealed many genes wholly new to biology. Since then, hundreds more genomes have been sequenced, including a variety of pathogens
2/5/10 1:04 PM
9.3 Microbial Genomics
285
First cycle Double-stranded DNA (target) sequence to be amplified Denaturation
A
The DNA sequence is briefly heated to separate (denature) the two strands.
B
The solution is cooled to allow the primer oligonucleotides (green) to hydrogen bond to each complementary strand (blue).
Primer oligonucleotides
DNA replication
C
The DNA polymerase replicates a new strand (pink) by adding the appropriate complementary nucleotides.
D
The cycle of heating, cooling, and strand replication is repeated many times to produce millions of copies of the same double-stranded DNA sequence.
Second cycle
20–30 cycles
Amplified DNA sequences
The polymerase chain reaction produces billions of copies of a DNA sequence that are identical to the starting, target sequence.
62582_CH09_260_297.pdf 285
2/5/10 1:04 PM
286
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
9.5: Tools
Discovering Emerging Pathogens In April 2007, three Australian transplant patients received organs from a single 57-year-old donor, who had died of a stroke and was not thought to have had an infectious disease. Two women, aged 44 and 63, each received one of the donor’s kidneys while a 64-year-old woman received the donor’s liver. Each of the women soon developed fever and encephalitis, a swelling of the brain. Within six weeks of the operation, all three were dead. Traditional methods of culturing microbes from samples, and even standard DNA sequencing, failed to identify the cause of the patients’ deaths. In fact, up to 40% A surgical team performing a kidney transplant. of central nervous system infectious diseases and 30 to 60% of respiratory illnesses cannot be traced back to a specific pathogen. In the case of the three Australian transplant patients, based on symptoms, a virus with an RNA genome was the best guess the medical experts could offer. Now the next generation in sequence technology is making it possible to discover and test for agents of infectious disease and is helping infectious disease epidemiologists identify the cause and origin of infections that had previously gone undiagnosed. The technique is called high-throughput DNA sequencing, and it can sequence up to 100 million nucleotide bases of DNA per 7-hour run. It was used to analyze genome sequences from the deceased transplant patients. RNA was extracted from the infected tissues of two of the patients, and the samples were then treated with DNase, an enzyme that removes all traces of human DNA. The remaining RNA was then amplified into millions of copies of the corresponding single-stranded DNA. The resulting DNA strands were sequenced using high-throughput DNA sequencing, which determines the sequence of a piece of DNA by adding new complementary nucleotides in a reaction that gives off a burst of light when the complementary nucleotides bases are added. Once the sequences were generated, additional techniques were used to eliminate any contaminating human genome sequences. The remaining pieces were then fitted together into longer strings. Of the more than 100,000 sequences initially produced, only 14 matched viral proteins in a database of all known microbial sequences. These sequences from the patients’ tissues were closely related to the sequences of a pathogen called lymphocytic choriomeningitis virus (LCMV), which usually causes only a minor flu-like illness in healthy people. Once the LCMV-like virus was characterized, probes were designed to detect the virus in clinical samples. Using these probes, evidence of the LCMV-like virus was discovered in several tissue samples from all three Australian transplant recipients. The new sequencing method is seen as a powerful new tool for pathogen surveillance and for diagnosing mysterious illnesses and emerging infectious diseases. In 2008, a 70-year-old woman died and a 57-year-old man became critically ill in a Boston hospital after each received a kidney from a donor infected with the LCMV-like virus. The virus was identified based on the probes developed from the Australian cases.
62582_CH09_260_297.pdf 286
2/5/10 1:04 PM
9.3 Microbial Genomics
287
9.6: Tools
Microarrays Once a microbial genome had been sequenced, scientists needed a way to discover how the genes interact in that organism. So, in the early 1990s, biotechnologists discovered a way to put these DNA segments on a miniaturized surface, such as a glass slide, or a plastic or silicon surface. Thousands of spots could be contained on a single microarray, often called a DNA chip. Each spot is put in place by a mechanical robot and is unique because the spot contains many copies of a unique sequence of single-stranded nucleotides produced through the polymerase chain reaction (PCR) from the DNA of the sequenced organism. Such an array may contain DNA from one species or many species. DNA microarray showing locations of differently Scientists use single-stranded, fluorescently labeled labeled DNA molecules. DNA that is complementary to a DNA sequence as a probe. Often two different samples of probes are used, each labeled with a different colored fluorescent dye (often red and green). When exposed to (washed over) the microarray, a probe will bind to any complementary sequences (the target) and the spot will fluoresce the color (red or green) of the bound probe. If both probes bind, they will fluoresce the intermediate color, yellow; or if more of one probe binds than another, the spot may be more orange or light green. The results usually are scanned and analyzed by computer. Microarrays can be used in many ways. • Gene expression: Microarrays can be developed and used to study gene expression. For example, a microbiologist might want to study the effects of oxygen on gene expression in the facultative species Escherichia coli. Using a microarray containing the E. coli genome, the microbiologist could isolate E. coli cells grown under aerobic conditions and another sample under anaerobic conditions. From these samples, the mRNAs (from active genes under the two conditions) would be isolated and copied into single-stranded DNA. The DNA probes from the aerobic condition may be labeled with the red dye while the anaerobic condition may be labeled with the green dye. The two probes allow the scientist to study the same cell (genes) under two different conditions (see figure). • Organism detection: Because of the constant threat posed by emerging infectious diseases and the limitations of existing approaches available to identify new pathogens, microarrays offer a rapid and accurate method for viral discovery. DNA microarray-based platforms have been developed to detect a wide range of known viruses as well as novel members of some viral families. For example, during the outbreak of severe acute respiratory syndrome (SARS) in March 2003 (Chapter 15), a viral isolate cultivated from a SARS patient was made into a DNA probe and, on the microarray, produced a spot representing the SARS virus. A microarray consisting of human DNA can be probed with a DNA sequence from an unknown pathogen to see if that person has been infected. For example, early infection with the malarial parasite Plasmodium falciparum can be identified by isolating DNA from the tissues of a suspected patient, fragmenting the DNA into single-stranded DNA segments, and attaching these to the solid support. This microarray is then washed with a fluorescently-labeled P. falciparum probe. Any fluorescent spots detected on the microarray indicate a match to P. falciparum DNA, confirming the patient is infected. • Phylogenetic relationships: The extent of microbial diversity in an environment can be assessed by producing a microarray, called a Phylochip, containing oligonucleotides (short sequences of nucleotides) that are complementary to 16S rRNA sequence probes of different bacterial species. Any lit spot on the microarray is an indicator that that species is part of the microbial community in that environment.
62582_CH09_260_297.pdf 287
2/5/10 1:04 PM
288
9.7: Biotechnology
Putting Humpty Back Together Again Humpty Dumpty sat on a wall. Humpty Dumpty had a great fall. All the king’s horses, And all the king’s men, Couldn’t put Humpty together again. We all remember this nursery rhyme, but it can be an analogy for the efforts required in sequencing the genome of an organism. To sequence a whole genome, you have to take thousands of small DNA fragments and, after sequencing them, try to “put the fragments together again.” The good news in genomics is that you can “put Humpty together again.” Small fragments must be used when sequencing a whole genome because current methods will not work with the tremendously long stretches of DNA, even those shorter ones found in bacterial genomes. Therefore, one strategy is to break the genome into small fragments. These fragments then are sequenced using sequencing machines and the fragments reassembled into the full genome. This technique is called the “whole-genome shotgun method.” It can be extremely fast, but there are so many little pieces that it can be very difficult to put the whole genome together again. The “shotgun” strategy first was used in 1995 by Craig Venter, Hamilton Smith, Claire Fraser, and their colleagues to sequence the genome of Haemophilus influenzae and Mycoplasma genitalium. To sequence these bacterial genomes, segments of the DNA were cut into 1,600 to 2,000 base pairs. The segments then were partly sequenced at both ends, using automated sequencing machines. These base-pair sequences— with their many overlaps—became the sequence information that was entered into the computer. Using innovative computer software, the thousands of DNA fragments generated were compared, clustered, and matched for assembling the genome of each organism. Once assembled, the genes could be located, compared to known genes, and a detailed map developed (see figure). Sequencing of each genome took about a year but demonstrated that “the king’s horses” (supercomputers and shotgun sequencing) and “the king’s men” (the large group of collaborators) could “put Humpty together again”—and with speed and accuracy. Note: Since 1995, great strides have been made in sequencing technology. If H. influenzae were to be sequenced today, it would take about five days, rather than an entire year.
A linear map of the Mycoplasma genitalium genome. The horizontal arrows identify protein-coding genes. The direction of the arrow indicates the direction of transcription.
62582_CH09_260_297.pdf 288
2/5/10 1:04 PM
9.3 Microbial Genomics
289
240 Bacteria
Number of genomes completely sequenced
220
Archaea
200
Eukarya
180 160 140 120 100 80 60 40 20 0 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 Year
FIGURE 9.15 Microorganism Genomes Sequenced. The total number of genes completely sequenced and published will surpass 1,000 in 2009. »» Why have so few genomes been sequenced from the eukaryal organisms?
Source: Data from NCBI Database (Accessed Nov. 11, 2009). Available at http://www.ncbi.nlm.nih.gov/sites/entrez?db=genome.
( FIGURE 9.15 ). Sequences by themselves, although the result of very impressive work, do not tell us much. So, what do these sequences tell us and what practical use can be derived from this information? CONCEPT AND REASONING CHECKS
9.9 Why have so many bacterial species been sequenced?
Segments of the Human Genome May Have “Microbial Ancestors” KEY CONCEPT
10. Some human genes and human DNA sequences may have microbial origins.
With the sequencing of the human genome, one interesting development was to compare the human nucleotide gene sequences to known bacterial and viral sequences. Are there any similarities in the genes each contains? Some comparisons indicate as many as 200 of our 25,000 genes are essentially identical to those found in members of the Bacteria; 25% or some 6,000 genes are found in yeast. However, these human genes were not acquired directly from these species, but rather were genes picked up by animals representing early ancestors of humans.
62582_CH09_260_297.pdf 289
So important were these genes, they have been preserved and passed along from organism to organism throughout evolution; they are life’s oldest genes. For example, several researchers suggest some genes coding for brain signaling chemicals and for communication between cells did not evolve gradually in human ancestors; rather, these ancestors acquired the genes directly from bacterial organisms. This provocative claim remains highly controversial though and more work is needed to better analyze this possibility. Another discovery from the human genome project indicates that only about 5% to 10% of our DNA appears to code for proteins and regulatory RNAs. A number of scientists believe some of the non-gene DNA may be “genetic debris” from viruses that infected vertebrate ancestors hundreds of millions of years ago. Estimates suggest that 3% to 8% of the human genome is composed of self-replicating fragments of viral DNA. So, microbial genomes will have much to tell us about our past as comparisons continue. CONCEPT AND REASONING CHECKS
9.10 How do microbial genomes compare in size and composition to the human genome?
2/5/10 1:04 PM
290
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
Microbial Genomics Will Advance Our Understanding of the Microbial World KEY CONCEPT
11. Understanding gene organization and function provides for new microbial applications.
Microorganisms have existed on Earth for more than 3.7 billion years, although we have known about them for little more than 300 years. Over this long period of evolution, they have become established in almost every environment on Earth, make up a significant percentage of Earth’s biomass, and, although they are the smallest organisms on the planet, they influence—if not control—some of the largest events. Yet, with few exceptions, we do not know a great deal about any of these microbes, and we have been able to culture and study in the laboratory less than 1% of all microorganism species. However, our limited knowledge is changing. With the advent of microbial genomics, the discipline of sequencing, analyzing, and comparing microbial genomes, we have begun the third Golden Age of microbiology, a time when remarkable scientific discoveries will be made toward understanding the workings and interactions of the microbial world. Some potential consequences from the understanding of microbial genomes are outlined below. Safer Food Production. Since microorganisms play important roles in our foods both as contamination and spoilage agents, understanding how they get into the food product and how they produce dangerous foodborne toxins, will help produce safer foods. However, a major limitation with traditional food safety surveillance is that food-contaminating or spoiling microbes can only be identified after a long time-consuming approach that requires a number of days for colony counting of surviving microorganisms or bacterial toxin production using agar culture media. In addition, separate tests need to be run for each potential foodborne pathogen. This whole process can be greatly speeded up with microbial genomic technologies, enabling a quick and reliable prediction of the safety of our foods. Microbial genomics can provide for a quick identification of microorganisms present in the (raw) food product. For example, until recently, there was little research into why Campylobacter
62582_CH09_260_297.pdf 290
jejuni, a bacterial pathogen that is the most common bacterial cause of food poisoning (Chapter 11), is so virulent. Microbial genomics studies have now shown that C. jejuni has over 1,700 genes. So, which of these genes are important to the organism when it faces different environmental challenges, such as contaminating raw chicken, residing in fecal matter, or surviving in water? There are a variety of toxins it produces, as well as adherence and invasive factors needed for infection. So knowing the sequences for these genes means one could detect their presence in a food sample. As explained earlier, microarrays would be one way to rapidly detect the presence of these diseaseenhancing genes not only from C. jejuni, but from all potential foodborne pathogens. Microarrays would provide a very rapid response to potential food contamination and enable the removal of the product or strengthen the food-chain control strategies before the pathogen could cause illness to consumers. Overall, genomics of food microbes generates valuable knowledge that can be used to protect our agriculture produce and meats, and also could be applied as a tool to trace potential food contamination between farm to table, a real problem today for fruits and vegetables coming from both within and outside the United States. Identification of Unculturable Microorganisms. Because the vast majority of bacterial and archaeal species cannot be cultured (see Chapter 5), genomics offers a way to identify these organisms. Craig Venter is just one of many scientists studying the gene sequences of these viable but not culturable (VBNC) organisms. Venter and others are attempting to sequence and identify the collective genomes, called the metagenome, of all bacterial and archaeal species in a microbial community, such as the Sargasso Sea (see Chapter 1). This ability to identify unculturable organisms is opening up the new discipline of metagenomics. Such genomic information allows microbiologists to better understand how microbial communities function and how the organisms interact with one another. Genomic information also is being used to discover if there are unculturable microbial representatives that could be used as alternative energy sources to solve critical environmental problems, including global warming and the development of
2/5/10 1:04 PM
9.3 Microbial Genomics
renewable energy sources such as hydrogen and methane. Microbial Forensics. The advent of the anthrax bioterrorism events of 2001 and the continued threat of bioterrorism has led many researchers to look for ways to more efficiently and more rapidly detect the presence of such bioweapons (see Chapter 1). Many of the diseases caused by these potential biological agents cause no symptoms for at least several days after infection, and when symptoms appear, initially they are flu-like. Therefore, it can be difficult to differentiate between a natural outbreak and the intentional release of a potentially deadly pathogen. Such concerns have lead to a relatively new and emerging area in microbiology called microbial forensics, the discipline that attempts to recognize patterns in a disease outbreak, identify the responsible pathogen, control the pathogen’s spread, and discover the source of the pathogenic agent. Investigative tools, like gene sequencing, DNA probes, microarrays, and PCR often are sufficient if such a disease outbreak is a natural one. However, if the “outbreak” is the result of a purposeful release—a bioterrorism attack—then tracking down the source of the microbe (and perpetrator) is critical. For example, the anthrax letter attacks of 2001 generated panic among the public and showed the need to establish “attribution” (who is responsible for the crime) for fear that another such attack might occur. The 2009 swine flu pandemic at one point was proposed by some to be the result of an accidental release of the virus from a research lab doing vaccine experimentation. Microbial forensics has not supported this claim. The science behind microbial forensics includes classical microbiology, genetic engineering, microbial genomics, and phylogenetics. Forensic microbiological investigations are essentially the same as any other forensic investigation as they involve a crime scene(s) investigation, evidence collection, chain of custody for the collection, handling, and preservation of evidence, interpretation of results and—unique to the scientist—court presentation. Importantly, unlike research data that must hold up to scrutiny by peer reviewers and journal editors, microbial forensic data must be undeniable and must hold
62582_CH09_260_297.pdf 291
291
up to the scrutiny of judges and juries in a court of law. Because the evidence presented must be beyond contention, the investigative tools of gene sequencing, DNA probes, microarrays, and PCR may not be enough to ensure the evidence will bring a perpetrator(s) to justice and to deter future attacks. Microbial forensics also is involved in other types of medical and hygiene cases. Cases of medical negligence, where a hospital’s inadequate or improper hygiene can lead to a patient contracting a post-surgical or hospital-acquired infection (and perhaps die), could be settled through forensics analysis. In addition, outbreaks of foodborne disease have brought lawsuits against companies alleging negligence in sanitary practices. And the potential for intentional contamination through foodborne terrorism is certainly possible. In all these cases, tracing the infecting microbe to the company or person(s) of origin will be critical. This places the fields of genetic engineering, biotechnology, and microbial genomics at the forefront of this emerging field. CONCEPT AND REASONING CHECKS
9.11 How is microbial genomics contributing to a better world?
Comparative Genomics Brings a New Perspective to Defining Infectious Diseases and Studying Evolution KEY CONCEPT
12. Comparative genomics compares the DNA sequences of related or unrelated species.
Sequencing the DNA bases of a microorganism (or any other organism) has and still does provide important information concerning the number of bases and genes comprising the organism. However, such sequences provide little understanding of how these genes work together to run the metabolism of an organism. One needs to understand how the organism uses its genome to form a functioning unit. Sequencing is only the first part of a deeper understanding. Having sequenced a microbial genome, the next step is to discover the functions for the genes. Sequences need to be analyzed (called genome annotation) to identify the location of the genes and the function of their RNA or protein products.
2/5/10 1:04 PM
292
CHAPTER 9
Pathogenicity: The ability of a pathogen to cause disease.
62582_CH09_260_297.pdf 292
Gene Transfer, Genetic Engineering, and Genomics
For example, in most of the microbial genomes sequenced to date, nearly 50% of the identified genes encoding proteins have not yet been connected with a cellular function. About 30% of these proteins are unique to each species. The challenging discipline of functional genomics attempts to discover what these proteins do and how those genes interact with others and the environment to maintain and allow the microbe to grow and reproduce. One of the most important areas beyond DNA sequencing is the field of comparative genomics, which compares the DNA sequence from one microbe with the DNA sequence of another similar or dissimilar organism. Comparing sequences of similar genes indicates how genomes have evolved over time and provides clues to the relationships between microbes on the phylogenetic tree of life (see Chapter 1). Comparisons indicate, for example, that some strains of a bacterial species contain genomic islands, sequences of up to 25 genes that are absent from other strains of the same species. Many of these islands can be identified as having come from an altogether different species, suggesting some form of HGT, such as conjugation, occurred in the past. It is believed the nonpathogenic bacterial species Thermotoga maritima has acquired about 25% of its genome from HGT. In addition, sequence analysis indicates its genome is a mixture of bacterial and archaeal genes and suggests T. maritima evolved before the split of the Bacteria and Archaea domains. One of the most interesting aspects of comparative genomics relates to infectious disease. By comparing the genomes of pathogenic and nonpathogenic bacterial species, or between pathogens with different host ranges, microbiologists are learning a lot about pathogen evolution. Here are a few examples. There are three bacterial species of Bordetella (Chapter 10). B. pertussis causes whooping cough in humans, B. parapertussis causes whooping cough in infants, but also infects sheep, and B. bronchiseptica produces respiratory infections in other animals ( FIGURE 9.16A ). Comparative genomic analysis of these three species reveals that B. pertussis and B. parapertussis are missing large segments of DNA (1,719 genes), which are present in B. bronchiseptica. This analysis sug-
gests (1) B. pertussis and B. parapertussis evolved from a B. bronchiseptica-like ancestor; and (2) the adaptation of B. pertussis and B. parapertussis to their more restrictive hosts is due to the loss of the 1,719 genes. In fact, only B. bronchiseptica is capable of surviving outside the host. So, in this genome comparison between similar species, survival of B. pertussis and B. parapertussis requires they infect organisms supplying them with the materials they no longer can make; that is, pathogenicity has evolved from the loss of gene function. At the opposite extreme is the evolution of pathogenicity through the acquisition of new genes ( FIGURE 9.16B ). Corynebacterium diphtheriae is the causative agent for diphtheria (Chapter 10). Genome analysis indicates this species in the not too distant past acquired through HGT 13 genetic regions, each representing a genomic island. These islands are called pathogenicity islands because they encode many of the pathogenic characteristics of the bacterial species (e.g., pili formation and iron uptake). E. coli O157:H7 has recently become a dangerous threat to human health worldwide, causing severe gastrointestinal ailments (Chapter 11). One of the most recent outbreaks involved the contamination of bagged spinach. Some 200 Americans became ill and at least two died. When the genome of E. coli 0157:H7 was compared to the nucleotide sequence of a non-pathogenic strain (K12), another example for the presence of pathogenicity islands was discovered ( FIGURE 9.16C ). Both strains have a large genome and have evolved from a common ancestor. Both have genomic islands acquired through HGT. However, the genomic islands in E. coli O157:H7 code for the known pathogenicity genes (e.g., pili and toxins) and therefore represent pathogenicity islands. The genomic islands in the non-pathogenic strain lack these pathogenicity genes. What is not clear is if the pathogenicity islands were acquired only by the O157:H7 strain or the non-pathogenic strain lost the pathogenicity islands. These few examples represent examples of the power of comparative genomics to resolve differences between species and shed light on the evolution of bacterial pathogens. CONCEPT AND REASONING CHECKS
9.12 Explain how comparative genomics helps explain some aspects of pathogenicity.
2/5/10 1:04 PM
9.3 Microbial Genomics
293
Microbial Genomes can evolve through
(A)
(C) Gene alteration
Gene loss
as in Escherichia ancestor
Bordella ancestor
Corynebacterium ancestor
whose core genomes are found in
which maintained core genome
where
loss of gene function
Pathogens
Nonpathogens
which then
which then
Pathogenicity islands
are gained through maintained
B. pertussis
Gene gain
as in
as in
B. bronchiseptica
(B)
lost
maintained core genome
gained HGT
Pathogenicity islands
Pathogenicity islands as in
as in B. parapertussis
as in
through ?
E. coli K12 ?
HGT
Corynebacterium diphtheriae
as in
E. coli O157:H7 FIGURE 9.16 Comparative Genomics Suggests How Microbial Genomes Can Evolve. This concept map summarizes the evolution of microbial genomes through loss or gain of gene function. »» What advantage is there to losing or gaining genes, or whole sets of genes (pathogenicity islands)?
Metagenomics Is Identifying the Previously Unseen Microbial World KEY CONCEPT
13. Techniques are now being developed to analyze and understand all the genomes within a microbial community.
Existing within, on, and around every living organism, and in most all environments on Earth, are microorganisms. Yet, as we mentioned in Chapter 5, some 99% of the bacterial and archaeal species found within us and in the environment
62582_CH09_260_297.pdf 293
will not grow on traditional growth media; we referred to these organisms as viable, but not culturable (VBNC). That means most organisms found in the soil, in oceans, and even in the human body have never been seen or named—and certainly not studied. There is now a genetic process for analyzing this unculturable majority. As mentioned earlier, the process is called metagenomics (meta = “change”), and it refers to the change (1) in the way genes and genomes within mixtures of organisms within a community (the metagenome) are studied and
2/5/10 1:04 PM
294
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
(2) in our understanding of the microbial world. Metagenomics has the potential to stimulate the development of advances in fields as diverse as medicine, agriculture, and energy production. Reread the introduction to Chapter 1, describing Craig Venter’s ocean voyage of microbial sampling and finding new genes. Here is how the metagenomics process is carried out ( FIGURE 9.17 ). Samples of the desired community of microorganisms are collected. These samples could be from soil, water, or even the human digestive tract. The DNA is then extracted from the sample, which produces DNA fragments from all the microbes in the samples. The fragments can be amplified through PCR and cloned into plasmids, which are introduced into bacteria, such as E. coli. A metagenomic library results that represents the entire community DNA from the microbes sampled. Analysis of the DNA fragments or plasmid clones can be used to do sequence analysis and functional analysis. In “sequence-based metagenomics,” the random fragments are cloned to a level that produces vast amounts of DNA that can be linked back to the probable origin of the DNA. Genes and metabolic pathways of different organisms in the community and with other communities can be compared. With “functional-based metagenomics,” the gene products from the cloned plasmids in the bacterial cells are searched for new enzymes, vitamins, antibiotics, or other potential chemicals of therapeutic or industrial use. As Venter’s explorations and those of others have shown, metagenomics already has opened our eyes to the diversity of microbes in ocean environments. The process also makes it possible to harness the power of microbial communities to help solve some of the most complex medical, environmental, agricultural, and economic challenges in today’s world. Medicine. Understanding how the microbial communities that inhabit our bodies affect human health could lead to new strategies for diagnosing, treating, and preventing diseases. Ecology and the Environment. Exploring how microbial communities in soil and the oceans affect the atmosphere and environmental conditions could help us understand, predict, and address climate change. Energy. Harnessing the power of microbial communities might result in sustainable and eco-
62582_CH09_260_297.pdf 294
Seawater sample
Break cells; extract DNA and break it into small fragments
Sequence fragments and reassemble
Ligate fragments with vectors
Construct library
Analysis
E. coli colonies
FIGURE 9.17 The Process of Metagenomics. Metagenomics allows the simultaneous sequencing of a whole community of microorganisms without growing each species in culture. Fragments can be either sequenced or subjected to functional analysis. »» What type of information is supplied by sequence-based metagenomics versus functional-based metagenomics?
friendly bioenergy sources, as exemplified by the explorations of Craig Venter and others. Bioremediation. Adding to the arsenal of microorganism-based environmental tools can help in monitoring environmental damage and cleaning up oil spills, groundwater, sewage, nuclear waste, and other hazards. Biotechnology. Taking advantage of the functions of microbial communities might lead to
2/5/10 1:04 PM
Learning Objectives
the development of newer and safer food and health products. Agriculture. Understanding the roles of beneficial microorganisms living in, on, and around domesticated plants and animals could enable detection of diseases in crops and livestock, and aid in the development of improved farming practices. Biodefense. The addition of metagenomics tools to microbial forensics will help to monitor
295
pathogens, create more effective vaccines and therapeutics against bioterror agents, and reconstruct attacks that involve microorganisms. CONCEPTS AND REASONING CHECKS
9.13 What does metagenomics offer that previous sequencing techniques have not been able to provide?
SUMMARY OF KEY CONCEPTS 9.1 Genetic Recombination in Bacteria 1. Recombination implies a horizontal transfer of DNA fragments between bacterial cells and an acquisition of genes by the recipient cell. All three forms of recombination are characterized by the introduction of new genes to a recipient cell by horizontal gene transfer. 2. In transformation, a competent recipient cell takes up DNA fragments from the local environment. The new DNA fragment displaces a segment of equivalent DNA in the recipient cell, and new genetic characteristics may be expressed. 3. In one form of conjugation, a live donor (F+) cell transfers an F factor (plasmid) to a recipient cell (F–), which then becomes F+. 4. In another form of conjugation, Hfr strains contribute a portion of the donor’s chromosomal genes to the recipient cell. 5. Transduction involves a virus entering a bacterial cell and later replicating within it. In generalized transduction, a bacterial DNA fragment is mistakenly incorporated into an assembling phage. In specialized transduction, the virus first incorporates itself into, then detaches from, the chromosome, taking a segment of chromosomal DNA with it. In both forms, the phage transports the DNA to a new recipient (transduced) cell. 9.2 Genetic Engineering and Biotechnology 6. Genetic engineering is an outgrowth of studies in bacterial genetic recombination. The ability to construct recombinant DNA molecules was based on the ability of restriction endonucleases to form sticky ends on DNA fragments. 7. Plasmids can be isolated from a bacterial cell, spliced with foreign genes, then inserted into fresh bacterial cells where the foreign genes are expressed as protein. The cells become
biochemical factories for the synthesis of such proteins as insulin, interferon, and human growth hormone. 8. DNA probes can be used to detect pathogens. 9.3 Microbial Genomics 9. Since 1995, increasingly more microbial genomes have been sequenced; that is, the linear sequence of bases has been identified. 10. A comparison of bacterial genomes with the human genome has shown there may be some 200 genes in common between these organisms. Comparisons between microbial genomes indicate almost 50% of the identified genes have yet to be associated with a protein or function in the cell. 11. With the understanding of the relationships between sequenced microbial DNA molecules comes the potential for safer food production, the identification of unculturable microorganisms, a cleaner environment, and improved monitoring of pathogens through microbial forensics. 12. Sequencing is only the first step in understanding the behaviors and capabilities of microorganisms. Functional genomics attempts to determine the functions of the sequenced genes and how those genes interact with one another and with the environment. Comparative genomics compares the similarities and differences between microbial genome sequences. Such information provides an understanding of the evolutionary past and how pathogens might have arose through the gain or loss of pathogenicity islands. 13. Metagenomics is providing new insights into the function of diverse genomes in microbial communities.
LEARNING OBJECTIVES After understanding the textbook reading, you should be capable of writing a paragraph that includes the appropriate terms and pertinent information to answer the objective. 1. Contrast vertical and horizontal gene transfer mechanisms. 2. Describe and assess the role of transformation as a genetic recombination mechanism. 3. Explain how an F factor is transferred during conjugation. 4. Distinguish between an Hfr strain, and F– recombinant cell, and an F’ plasmid.
62582_CH09_260_297.pdf 295
5. Summarize the steps involved in (a) generalized and (b) specialized transduction. 6. Differentiate between genetic engineering and biotechnology. 7. Identify the role of plasmids and restriction endonucleases in the genetic engineering process. 8. Explain how DNA probes are used to (1) identify pathogens and (2) conduct water-quality tests. 9. Describe what it means to say that a bacterial genome has been “sequenced.”
2/5/10 1:04 PM
296
CHAPTER 9
Gene Transfer, Genetic Engineering, and Genomics
10. Assess the importance of microbial genomics in understanding the human genome. 11. Summarize how microbial genomics can contribute to food safety, microorganism identification, and microbial forensics.
12. Justify the need for comparative genomics as related to pathogen evolution. 13. Identify how information from metagenomics can contribute to medicine, energy production, agriculture, and biodefense.
STEP A: SELF-TEST Each of the following questions is designed to assess your ability to remember or recall factual or conceptual knowledge related to this chapter. Read each question carefully, then select the one answer that best fits the question or statement. Answers to even-numbered questions can be found in Appendix C. 1. Which one of the following is NOT an example of genetic recombination? A. Conjugation B. Binary fission C. Transduction D. Transformation 2. Transformation refers to A. using a virus to transfer DNA fragments. B. DNA fragments transferred between live donor and recipient cells. C. the formation of an F– recombinant cell. D. the transfer of naked fragments of DNA. 3. An F– cell is unable to initiate conjugation because it lacks A. double-stranded DNA. B. a prophage. C. an F factor. D. DNA polymerase. 4. An Hfr cell A. has a free F factor in the cytoplasm. B. has a chromosomally integrated F factor. C. contains a prophage for conjugation. D. cannot conjugate with a F– recombinant. 5. A _____ is NOT associated with specialized transduction. A. virulent phage B. lysogenic cycle C. prophage D. recipient cell 6. Which complementary sequence would NOT be recognized by a restriction endonuclease? A. GAATTC CTTAAG B. AAGCTT TTCGAA C. GTCGAC CAGCTG D. AATTCC TTAAGG
62582_CH09_260_297.pdf 296
7. A _____ seals sticky ends of recombinant DNA segments. A. DNA ligase B. restriction endonuclease C. protease D. RNA polymerase 8. _____ are single-stranded DNA molecules that can recognize and bind to a distinctive nucleotide sequence of a pathogen. A. Prophages B. Plasmids C. Cloning vectors D. DNA probes 9. The first completely sequenced genome from a free-living organism was from A. humans. B. E. coli. C. Haemophilus. D. Bordetella. 10. What percentage of the human genome is identical to the yeast genome? A. 5% B. 10% C. 25% D. 50% 11. A metagenome refers to A. a large genome in an organism. B. the collective genomes of many organisms. C. the genome of a metazoan. D. two identical genomes in different species. 12. Genomic islands are A. gene sequences not part of the chromosomal genes. B. adjacent gene sequences unique to one or a few strains in a species. C. acquired by HGT. D. Both B and C are correct. 13. Craig Venter’s sampling of ocean microorganisms is an example of A. microarrays. B. horizontal gene transfer. C. microbial forensics. D. metagenomics.
2/5/10 1:04 PM
Step D: Questions for Thought and Discussion
297
STEP B: REVIEW Use the following syllables to compose the term that answers each of the clues below. The number of letters in each term is indicated by the blank lines, and the number of syllables is shown by the number in parentheses. Each syllable is used only once, and the answers to even-numbered statements are in Appendix C. ASE BAC CLE COC COM CON CUS DO DROME EN FITH GA GASE GE GRIF HOR I I IN JU LENT LI MIDS MO NOME NU O PAL PE PHAGE PLAS PNEU TAL TENCE TER TION U VIR ZON 14. Closed loops of DNA (2) ___ ___ ___ ___ ___ ___ ___ ___ 15. Restriction recognition sequence (3) ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ 16. Transforming property (3) ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ 17. Transduction virus (5) ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ 18. Recombinant DNA enzyme (5) ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ 19. Transformed bacterium (4) ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ 20. DNA linking enzyme (2) ___ ___ ___ ___ ___ ___ 21. Discovered transformation (2) ___ ___ ___ ___ ___ ___ ___ ___ 22. Type of HGT (4) ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ 23. Phage that causes lysis (3) ___ ___ ___ ___ ___ ___ ___ ___ 24. Complete set of genes (2) ___ ___ ___ ___ ___ ___ 25. Type of gene transfer (4) ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
STEP C: APPLICATIONS Answers to even-numbered questions can be found in Appendix C. 26. In 1976, an outbreak of pulmonary infections among participants at an American Legion convention in Philadelphia led to the identification of a new disease, Legionnaires’ disease. The bacterial organism, Legionella pneumophila, responsible for the disease had never before been known to be pathogenic. From your knowledge of bacterial genetics, can you postulate how it might have acquired the ability to cause disease? 27. You are going to do a genetic engineering experiment, but the labels have fallen off the bottles containing the restriction endonucleases.
One loose label says EcoRI and the other says PvuI. How could you use the plasmid shown in MicroInquiry 9 to determine which bottle contains the PvuI restriction enzyme? 28. As a research member of a genomics company, you are asked to take the lead on sequencing the genome of Legionella pneumophila (see Question 26). (a) Why is your company interested in sequencing this bacterial species, and (b) what possible applications are possible from knowing its DNA sequence?
STEP D: QUESTIONS FOR THOUGHT AND DISCUSSION Answers to even-numbered questions can be found in Appendix C. 29. Which of the recombination processes (transformation, conjugation, or transduction) would most likely occur in the natural environment? What factors would encourage or discourage your choice from taking place? 30. Some bacterial cells can take up DNA via the transformation process. From an evolutionary perspective, what might have been the original advantage for the cells taking up naked DNA fragments from the extracellular environment? 31. Since the 1950s, the world has been plagued by a broad series of influenza viruses that differ genetically from one another. For example, we
have heard of swine flu, Hong Kong flu, Bangkok flu, and avian flu. How might the process of transduction help explain this variability? 32. It is not uncommon for students of microbiology to confuse the terms reproduction and recombination. How do the terms differ? 33. While studying for the microbiology exam covering the material in this chapter, a friend and biology major asks you why genomics, and especially microbial genomics, was emphasized. How would you answer this question?
HTTP://MICROBIOLOGY.JBPUB.COM/9E The site features eLearning, an online review area that provides quizzes and other tools to help you study for your class. You can also follow useful links for in-depth information, read more MicroFocus stories, or just find out the latest microbiology news.
62582_CH09_260_297.pdf 297
2/5/10 1:04 PM
PART
3
Bacterial Diseases of Humans CHAPTER 10 Airborne Bacterial Diseases CHAPTER 11 Foodborne and Waterborne Bacterial Diseases CHAPTER 12 Soilborne and Arthropodborne Bacterial Diseases CHAPTER 13 Sexually Transmitted and Contact Transmitted Bacterial Diseases
hroughout history, bacterial diseases have posed a formidable challenge to humans and often swept through populations virtually unchecked. In the eighteenth century, the first European visitors to the South Pacific found the islanders robust, happy, and well adapted to their environment. But the explorers introduced syphilis, tuberculosis, and pertussis (whooping cough) to a susceptible population. Soon these diseases spread like wildfire. For example, the Hawaiian population was about 300,000 when Captain Cook landed in 1778; by 1860, disease had reduced the population to fewer than 37,000. With equally devastating results, the Great Plague came to Europe from Asia, False-color transmission electron microscope image of Mycobacterium tuberculosis, which has and cholera spread westward from India. Together with tuberculosis, diphtheria, infected one-third of the human population. and dysentery, these bacterial diseases ravaged European populations for centuries and insidiously wove themselves into the pattern of life. Infant mortality was particularly shocking: England’s Queen Anne, who reigned in the early 1700s, lost 16 of her 17 babies to disease; and until the mid-1800s, only half the children born in the United States reached their fifth year. Today, humans can cope better with bacterial diseases. Though credit often is given to antimicrobial drugs, the major health gains have resulted from understanding disease and the body’s resistance mechanisms, coupled with modern sanitary methods to prevent microorganisms from reaching their targets. Immunization also has played a key role in preventing disease. Indeed, very few people in our society die of the bacterial diseases that once accounted for the majority of all deaths. In Part 3 of this text, we study the bacterial diseases of humans. The diseases have been grouped according to their major mode of transmission. Airborne diseases are discussed in Chapter 10; foodborne and waterborne diseases in Chapter 11; soilborne and arthropodborne diseases in Chapter 12; and sexually transmitted and contact transmitted diseases in Chapter 13. Many of these diseases are of historical interest and are currently under control. However, the human body is continually confronted with newly emerging or resurgent infectious diseases. In this regard, disease has not changed; only the pattern of disease has changed.
T
PART
298
62582_CH10_298_333.pdf 298
2/4/10 2:24 PM
MICROBIOLOGY
PATHWAYS
Clinical Microbiology One of the most famous books of the twentieth century was Microbe Hunters by Paul de Kruif. First published in the 1920s, de Kruif’s book describes the joys and frustrations of Pasteur, Koch, Ehrlich, von Behring, and many of the original microbe hunters. The exploits of these scientists make for fascinating reading and help us understand how the concepts of microbiology were formulated. I would urge you to leaf through the book at your leisure. Microbe hunters did not come to an end with Pasteur, Koch, and their contemporaries, nor did the stories of microbe hunters end with the publication of de Kruif’s book. Approximately 25% of all deaths worldwide and 60% of all deaths in children under four years of age are due to infectious agents. Today, clinical microbiology is concerned with the microbiology of infectious diseases, and the men and women working in hospital, public, and private laboratories are today’s diseases detectives. These individuals search for the pathogens of disease. Many travel to far corners of the world studying organisms, and many more remain close to home, identifying the pathogens in samples sent by physicians, identifying their interactions with the immune system, and working out the diagnosis and epidemiology of these diseases. In fact, a well-developed knowledge of clinical microbiology is critical for the physician and medical staff who are faced with the concepts of disease and antimicrobial therapy. Microbiologists even work in dental clinical labs, since many bacterial species are involved in tooth decay and periodontal disease. Microbiology is one of the few courses where much of the fundamentals of microbiology are used regularly. This includes the clinical aspects of infectious diseases: manifestations (signs and symptoms), diagnosis, treatment, and prevention. A career in clinical microbiology usually requires a master of science in clinical microbiology. With such a degree, jobs include supervisory positions in medical centers or private reference laboratories, infection control positions in clinical settings, public health, marketing and sales in the pharmaceutical and biotechnology industries, teaching at community colleges or technical colleges, or research in academic, government or industry (pharmaceutical and biotechnology) settings. Clinical microbiology also offers an outlet for the talents of those who prefer to tinker with machinery. New instruments and laboratory procedures are constantly being designed and developed in an effort to shorten the time between detection and identification of microorganisms. Many tests used in the clinical laboratory reflect human ingenuity. For example, there is a test that detects bacterial species by their interference with the passage of light and their ability to scatter light at peculiar angles. Such modern devices as laser beams are used in this kind of instrumentation. The microbe hunters have not changed materially in the past 100 years. The objectives of the search may be different, but the fundamental principles of the detective work remain the same. The clinical microbiologist is today’s version of the great masters of a bygone era.
299
62582_CH10_298_333.pdf 299
2/4/10 2:24 PM
10 Chapter P Ch Preview i and d K Key Concepts
10.1 Structure and Indigenous Microbiota of
the Respiratory System 1.
Microbial colonization usually is limited to the upper respiratory tract.
10.2 Bacterial Diseases Affecting the Upper
Respiratory Tract 2. 3.
4. 5. 6. 7.
Streptococcus pyogenes causes strep throat and scarlet fever. Corynebacterium diphtheriae secretes a toxin that inhibits protein synthesis in epithelial cells. Swelling of the epiglottis can block the trachea. Indigenous microbiota of the URT can cause sinus infections. Infections can occur in the outer and middle ear. Acute bacterial meningitis is most common among children aged 1 month to 2 years.
10.3 Bacterial Diseases of the Lower
Respiratory Tract 8. 9. 10. 11. 12.
Bordetella pertussis secretes toxins that destroy cells of the ciliated epithelium. Mycobacterium tuberculosis causes a twostage illness. Bronchitis produces excessive mucus and a narrowing of the bronchi. Bacterial pneumonia can be community or hospital acquired. Some pneumonia-causing bacteria are transmitted by dust particles or animal droppings. MICROINQUIRY 10: Infectious Disease Indentification
Airborne Bacterial Diseases Pertussis is the only vaccine-preventable childhood illness that has continued to rise since the 1980s with an increasing proportion of cases in adolescents and adults. —Centers for Disease Control and Prevention On August 14, 2002, a 39-year-old male oil refinery worker in Crawford County, Illinois, visited the refinery’s health unit complaining of a two-week cough. Later that day, the worker’s 50-year-old supervisor also visited the unit with a spastic cough, which had started three days earlier. Both patients were advised to see their own health care provider where blood samples indicated a recent infection with Bordetella pertussis. The Crawford County Health Department and Illinois Department of Public Health were contacted because a possible outbreak could be brewing. In the early parts of the 20th century, one of the most common childhood diseases and causes of death in the United States was pertussis, commonly called whooping cough. Before the introduction of a pertussis vaccine in 1940, B. pertussis was responsible for infection and disease in 150 out of every 100,000 people. By 1980, the incidence, or frequency with which the disease occurs, had dropped to one in every 100,000 individuals. The vaccine had almost eliminated the pathogen. At the oil refinery, active surveillance and case investigations were initiated by the health officials. Those workers with a persistent and spastic cough were sent to the local hospital for evaluation and interviews. Health department officials needed to know the time of illness onset, where workers
300
62582_CH10_298_333.pdf 300
2/4/10 2:24 PM
CHAPTER 10 Airborne Bacterial Diseases
worked in the refinery, work schedule, and individuals with whom they had close contacts. Local school officials and health care providers were alerted and given guidelines on ways to recognize pertussis and prevent its spread. In the course of the epidemiological investigation, 17 cases of pertussis were identified at the refinery, 15 having had close contact with the supervisor originally diagnosed; 7 cases occurred among the community and had no apparent relation to the refinery. In all, 21 of the cases occurred in adults 20 years of age or older. Patients received an antibiotic effective against the pathogen and all recovered. How the disease was passed from the supervisor remains unclear. B. pertussis is spread by airborne droplets ( FIGURE 10.1 ). Other than an indoor, 5-minute morning meeting each day, work assignments were all outdoors, although workers often congregated in an indoor dining area at lunch.
301
vaccine, vaccine-induced protection does not last a lifetime; therefore, adolescents and adults can become susceptible to disease when vaccineinduced immunity wanes, approximately 5 to 10 years after vaccination. As a result, college students and adults (like the refinery workers) may be vulnerable ( FIGURE 10.2 ). Pertussis is but one of a group of bacterial infectious diseases affecting the respiratory tract. We will divide these diseases into two general categories. The first category will include diseases of the upper respiratory tract, such as strep throat and diptheria. The second category will include diseases of the lower respiratory tract: pertussis, tuberculosis, and pneumonia. As we proceed, note that antibiotics are available for treating the bacterial diseases while immunizations are used for protecting the community at large.
Every 3 to 4 years, a pertussis outbreak occurs in the United States—and, as indicated above, many of these cases occur in adults. Although nearly all youngsters growing up receive the pertussis
3,000 2,700 2,400 Number of cases
2,100 1,800 1,500 1,200 900 600 300
15 4 –1 20 9 –2 30 9 –3 40 9 –4 50 9 –5 9 > 60
9
4
–1
10
5–
1–
![Alcamo\'s Fundamentals of Microbiology, Ninth Edition ( PDFDrive.com ) [PDF] | Online Book Share (2024)](data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAAEAAAABCAQAAAC1HAwCAAAAC0lEQVR42mP8/h8AAvMB+NzmkbcAAAAASUVORK5CYII=)
